ID: 963882904

View in Genome Browser
Species Human (GRCh38)
Location 3:150547858-150547880
Sequence CCTTTTAAACAGTCTTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963882904_963882906 6 Left 963882904 3:150547858-150547880 CCAGGCAAAGACTGTTTAAAAGG 0: 1
1: 0
2: 1
3: 23
4: 211
Right 963882906 3:150547887-150547909 TACATAATAAATTTTTTTTTAGG 0: 1
1: 0
2: 8
3: 161
4: 1577
963882904_963882907 16 Left 963882904 3:150547858-150547880 CCAGGCAAAGACTGTTTAAAAGG 0: 1
1: 0
2: 1
3: 23
4: 211
Right 963882907 3:150547897-150547919 ATTTTTTTTTAGGTTTGTAAAGG 0: 1
1: 1
2: 10
3: 150
4: 1766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963882904 Original CRISPR CCTTTTAAACAGTCTTTGCC TGG (reversed) Intronic
901135015 1:6987459-6987481 CATTTAAAAGAGTCTTTGGCCGG - Intronic
902643179 1:17779747-17779769 GCTTTTTAACAGTCTTAGCATGG + Intronic
903316186 1:22509212-22509234 CCTCTTTCACAGTCTCTGCCAGG - Exonic
904176824 1:28635615-28635637 CCTTTTAAACTGTGGTTGACTGG + Intronic
904958460 1:34309562-34309584 CCTTTTTCACTGTCTCTGCCAGG - Intergenic
906221591 1:44084380-44084402 GCTCTTAAAAAGTTTTTGCCAGG + Intergenic
907768456 1:57435746-57435768 CCTTTAAAACAGCCTTAGGCAGG - Intronic
911208245 1:95114537-95114559 CATTTAAAACAGTTTTTGGCTGG + Intergenic
912791280 1:112653672-112653694 CCTTTTAGACAGGCTATGCCTGG + Intronic
916273216 1:162966560-162966582 ACATTTTAGCAGTCTTTGCCTGG - Intergenic
919054039 1:192546696-192546718 CCTTATACACATTCTTTGGCAGG + Intergenic
920799156 1:209171409-209171431 CCATTTAAACAGTCTATCCCTGG + Intergenic
921590191 1:216994031-216994053 TTTTTTAAAAAGTCTTTGCAAGG - Intronic
924947605 1:248856782-248856804 CCTTCTTAAAAGTCTCTGCCTGG - Intronic
1062784706 10:253839-253861 CCTTTTAAAAAGTATTCTCCAGG + Exonic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065260707 10:23920656-23920678 CCTTTTGAACAGTCAGTGACAGG + Intronic
1065789098 10:29243409-29243431 CCATTTAAAAAGCCTTTCCCTGG + Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067019237 10:42780950-42780972 CACTTTAATCATTCTTTGCCTGG - Intergenic
1071145643 10:82567387-82567409 CAGTTTAAACACTCTTTTCCAGG - Intronic
1072732636 10:97857870-97857892 TCTTTAACACAGTCTTTCCCCGG + Intronic
1074812090 10:117114801-117114823 CCTTTAAAACTGTCTTGGCAAGG - Intronic
1076859725 10:133135129-133135151 CATTTTAAACAGTGTTTACCAGG - Intergenic
1077154549 11:1085542-1085564 CCTTTTCCACAGTGTGTGCCGGG + Intergenic
1078157912 11:8814518-8814540 CCTACCAAGCAGTCTTTGCCTGG + Intronic
1079687246 11:23375034-23375056 CTTTTTAATGTGTCTTTGCCTGG - Intergenic
1079924477 11:26476707-26476729 ACCTTTAACCAGTCTTGGCCAGG - Intronic
1080266695 11:30408649-30408671 CCTTTTAATCATTCTTTGTCTGG - Intronic
1085337851 11:75710425-75710447 CCTGTGAAACTGTCTGTGCCTGG + Intergenic
1085417470 11:76328913-76328935 TCTTTAAAATAGTCTTGGCCAGG - Intergenic
1085613610 11:77976385-77976407 CCTTTAAAAAAGTCTAGGCCAGG + Intronic
1087813690 11:102635446-102635468 GCTTTTAAAAAGTATTGGCCAGG + Intergenic
1088097806 11:106120184-106120206 CCTTTAAAACTGACTTTGGCAGG - Intergenic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094705575 12:32911310-32911332 CCTTTTAAAAATTCTAGGCCGGG + Intergenic
1095035877 12:37370487-37370509 CCTTTGAAACAGTCTTTTTGTGG - Intergenic
1095228785 12:39708819-39708841 CTTTTTAAAAAGTTTTTTCCTGG + Intronic
1097923359 12:65101485-65101507 CATTTTAGGCAGTTTTTGCCTGG - Intronic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1100651204 12:96590983-96591005 TCTGTTAAACAGTCGTTTCCTGG - Intronic
1101349850 12:103919225-103919247 ACTTTTAAATAGTGTTTGCATGG - Intergenic
1101686913 12:107033438-107033460 TCTTTTATACTGTCTTTGTCTGG - Intronic
1105357808 13:19675282-19675304 CCTTTTCAACGCTCTGTGCCTGG - Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107904367 13:45048572-45048594 CCTTTTATTCAGGATTTGCCTGG - Intergenic
1108054502 13:46472335-46472357 CCTTTTAAAAAATCTTGGCCTGG - Intergenic
1109149789 13:58831530-58831552 TCTTTTAAACATTCTTTTACAGG + Intergenic
1109584745 13:64384931-64384953 ACTTTTAAACAGTATTTGTTAGG - Intergenic
1109855178 13:68117842-68117864 TCTTTTAAAAAGTGTTTGCATGG - Intergenic
1110537482 13:76668485-76668507 CCTGTTAACCACACTTTGCCAGG - Intergenic
1110799272 13:79676062-79676084 GCTTTTAAACATTCTTAGGCAGG + Intergenic
1114794112 14:25693004-25693026 TATTTTCAACAGTTTTTGCCCGG - Intergenic
1114942926 14:27638523-27638545 CCATTTCACCAGTCTTTTCCTGG + Intergenic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115388065 14:32820907-32820929 CATTTTAAGCAGCTTTTGCCTGG - Intronic
1115724078 14:36194161-36194183 CCTTATAAAATGTCTTTGCCTGG + Intergenic
1116843990 14:49847734-49847756 TCTTTAAGAGAGTCTTTGCCAGG + Intronic
1117378893 14:55140281-55140303 CCTTATAACCTGCCTTTGCCTGG + Exonic
1118702800 14:68450512-68450534 TCTTTTAAAAAGTCCTGGCCAGG - Intronic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1123698484 15:22896909-22896931 TCTTTTAAAGAGTGTTGGCCGGG + Intronic
1126748101 15:51847621-51847643 CCTTTAAAAAAGTCTTAGACAGG + Intronic
1127368227 15:58310974-58310996 CTTTTTAAAAATTCTTGGCCGGG + Intronic
1128375519 15:67071977-67071999 TTTTTTAAAAAGTCTTTGCAAGG + Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130333814 15:82941963-82941985 CCTTGGACCCAGTCTTTGCCTGG - Intronic
1131180759 15:90238002-90238024 ACTTTTAAACATTTTTGGCCAGG + Intronic
1131419438 15:92292286-92292308 CCTATTTAACAGACTGTGCCTGG - Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133124032 16:3633309-3633331 ACTTTTAAAAAGTCTTGGCTGGG + Intronic
1135937087 16:26790830-26790852 GCTTTTAAACTTTCTTTGGCAGG + Intergenic
1136099050 16:27979973-27979995 CTTTTTAAAAATTCTTTCCCTGG + Intronic
1137766237 16:50979691-50979713 CCTTTTAAACAGTGTTTTCAGGG + Intergenic
1138839100 16:60476463-60476485 CCTTTGGACCACTCTTTGCCTGG - Intergenic
1139502041 16:67374834-67374856 CTTTTTAAAAAGTCTAGGCCAGG + Intronic
1140621896 16:76744802-76744824 CCTTTTAAAAAATGTTTTCCCGG - Intergenic
1140740118 16:77934117-77934139 TCTTTTGAACAGTCTTATCCAGG - Intronic
1141360595 16:83391935-83391957 CCTGATAAACAGTCTTTGGGTGG - Intronic
1143774337 17:9188006-9188028 CCTATTAAACAGCCGCTGCCCGG - Intronic
1145057757 17:19714519-19714541 CCTTTGAAAGAGTCTGGGCCAGG - Intronic
1147658979 17:42107064-42107086 CCTTTTAAAAAATCTGGGCCGGG + Intronic
1150464011 17:65376463-65376485 GCTTTTACACAGTTTTTACCAGG + Intergenic
1151743980 17:76001689-76001711 CCTTCTGACCAGCCTTTGCCGGG + Intronic
1153695438 18:7636087-7636109 CCTTTCAAAAAGTATTTGCTTGG + Intronic
1154947879 18:21180239-21180261 TCCTTTATACAGTCTTTTCCTGG + Intergenic
1155538265 18:26840334-26840356 TTTTTTAAAAAGTCTTGGCCGGG + Intergenic
1155740651 18:29284131-29284153 GCTTTTAATTACTCTTTGCCTGG + Intergenic
1156001828 18:32394111-32394133 TCTTTAAAACAGTCTTGGCCTGG + Intronic
1157002547 18:43544018-43544040 ACTTAGAAACAGTCTTTTCCTGG + Intergenic
1157098108 18:44705595-44705617 CCATATAAGCTGTCTTTGCCTGG - Intronic
1158596761 18:58823451-58823473 CATTTTAAAAAGTCTTTTCCTGG - Intergenic
1159927674 18:74283253-74283275 CCATTTAAACAATCCTTCCCAGG + Intronic
1159953926 18:74506429-74506451 CGTTAAAAACAGTCTGTGCCCGG - Intronic
1159981281 18:74783843-74783865 CCTTTTAAAAATTCTTTGAGAGG + Intronic
1163342309 19:16716996-16717018 GCTTTTAAAGAGTCTGGGCCAGG - Intergenic
1165654924 19:37524785-37524807 CCTTTTAAACACACATTCCCAGG - Intronic
1166517516 19:43458423-43458445 CCTCTTTAAAAGTCTTGGCCGGG - Intergenic
927550351 2:23992784-23992806 CCTTCTAATTAGTATTTGCCTGG + Intronic
928671156 2:33605136-33605158 ACTTTTGTACAGACTTTGCCTGG + Intergenic
931300814 2:60976180-60976202 CCATTTATTCAGTATTTGCCAGG - Intronic
933254342 2:80063574-80063596 CCTGATTAACAGTATTTGCCTGG + Intronic
935761430 2:106324327-106324349 CCTTTCAAAATGTTTTTGCCTGG + Intergenic
938751795 2:134338664-134338686 CCTTTGAACCTGTCTTTGTCAGG + Intronic
939621458 2:144424258-144424280 CCTTTTAAATAATTTTTTCCAGG - Intronic
941826030 2:169898062-169898084 CCTATCAAAGAGTCTTTGACAGG - Intronic
941944745 2:171082852-171082874 CCTTTTAAAAAATCTTTAACAGG - Exonic
942245324 2:174002978-174003000 CTCTTTAAAAAGTCTTAGCCAGG + Intergenic
943560583 2:189456943-189456965 CTTTTTAAACAGTGTTGGGCCGG + Intronic
944205889 2:197157934-197157956 CCTTTTAAAGGGTCTCTGCTGGG + Intronic
944577136 2:201100601-201100623 TCATTTAAAAAGTCTTAGCCAGG + Intergenic
945711742 2:213305806-213305828 CCTTTTAACATGTCTTTGTCTGG + Intronic
946348413 2:219130082-219130104 CCTTTTAAACTGGATGTGCCTGG - Intronic
948338135 2:237227226-237227248 CCTTTCAAACACACTTTGCTGGG - Intergenic
1169399311 20:5266267-5266289 CCTTTTAAAAAGTTTTGGCCAGG + Intergenic
1173109806 20:40176095-40176117 CCTTTTAAAGAGAGGTTGCCAGG + Intergenic
1174619358 20:51862437-51862459 CCATTTAAAAAATCTTGGCCTGG + Intergenic
1177618385 21:23555564-23555586 CCTTATAACAAGTCTTTTCCCGG - Intergenic
1178664182 21:34532240-34532262 CCTGTTAAACTGACTTTGCGGGG + Intronic
1178786651 21:35659947-35659969 CCTTTTAAATGTTCTTAGCCAGG + Intronic
1179778198 21:43681632-43681654 TCTTTTAAAGATTCTTGGCCGGG - Intronic
1184276999 22:43414554-43414576 ACTTGTTAAAAGTCTTTGCCTGG - Intronic
950646412 3:14379775-14379797 CTTTTTAAAAAGTCTATGTCAGG + Intergenic
955253012 3:57303696-57303718 CCTTTTAAAAAGTTCTGGCCAGG - Intronic
959405281 3:105954427-105954449 TTTTTTAAAATGTCTTTGCCTGG + Intergenic
959472325 3:106767230-106767252 CTTTAAAAACAGTCTTTCCCTGG + Intergenic
959555743 3:107715076-107715098 ATTTTTAAAAAGTCTTGGCCAGG - Intronic
963077548 3:141361267-141361289 CTTTTTAAACATTCTTTGTAAGG + Intronic
963461534 3:145619929-145619951 GCTTTTAAACATTCTTTTTCTGG - Intergenic
963688595 3:148470280-148470302 CATTTTGAAGAGGCTTTGCCAGG - Intergenic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
965299903 3:166996362-166996384 CCTGTTAAACAGTTTGTGTCAGG + Intergenic
965363782 3:167773870-167773892 CTTTATAAACAGTCTTTTTCAGG - Intronic
965468789 3:169064745-169064767 ATTTTTAAACAGTTATTGCCAGG + Intergenic
969258896 4:6021494-6021516 ACATTTAAACAGGGTTTGCCAGG - Intergenic
970169724 4:13277612-13277634 CTTGTTAAGCACTCTTTGCCAGG - Intergenic
970186011 4:13454814-13454836 CCTTAGAAACAGTCCTTGGCAGG - Intronic
970585547 4:17511429-17511451 GCATTTAAACAGTTTTTACCAGG + Intronic
971364760 4:25968835-25968857 CCTTTTAAAAAATCTCAGCCGGG + Intergenic
971427685 4:26532250-26532272 CGTTTTAAACTGTCTGTGCATGG + Intergenic
971764850 4:30817762-30817784 TCTTTTAGATACTCTTTGCCAGG - Intronic
973748891 4:53992369-53992391 TCTTCAAAACAGTCTGTGCCAGG + Intronic
974094578 4:57349401-57349423 GCTTTTATTCTGTCTTTGCCAGG + Intergenic
975774139 4:77765453-77765475 CCTGTAAAACTGTCATTGCCTGG - Intronic
978445890 4:108779523-108779545 CTTTTAAAAAACTCTTTGCCGGG - Intergenic
979849271 4:125556270-125556292 CCTTGCAAAAAGTCTCTGCCTGG + Intergenic
981506818 4:145510318-145510340 CCTTTTAAAAAATCTTTGGCGGG + Intronic
983195606 4:164802998-164803020 CATTTTAAAAAATCTTTGCTGGG + Intergenic
984456048 4:179970322-179970344 TCTTTTAATGAGTATTTGCCTGG + Intergenic
984768240 4:183415860-183415882 CCTGTTCATCAGTCTTTGCGAGG + Intergenic
984996786 4:185440690-185440712 ACTTTTAAACCGTCTTCTCCTGG + Exonic
985302083 4:188500843-188500865 CATTTTAAAAAGTCTTGGCTGGG - Intergenic
985908141 5:2857685-2857707 CCTTTTAATCACTCTTTTCTTGG + Intergenic
985953128 5:3238343-3238365 CCTTTGAGATAGGCTTTGCCCGG + Intergenic
986524694 5:8661402-8661424 CCTTGAAAACAATCTTTCCCTGG - Intergenic
988713025 5:33797256-33797278 CCTCTTCAACAGGCTTGGCCAGG - Intronic
992911268 5:81398219-81398241 TCTTTAAAACTGTCTTTGTCTGG + Intergenic
993519970 5:88889032-88889054 CATTTTAAAAAATCTTTACCCGG + Intronic
994277947 5:97862265-97862287 CTTTTTAACCAGTCTCTGCATGG + Intergenic
994349584 5:98729187-98729209 ACTTTTAAAAAGTCTCAGCCAGG + Intergenic
995419963 5:111953350-111953372 CCTTTTGAACACTCTATGCCTGG + Intronic
996640331 5:125743982-125744004 CCCTGTAATCAGTCTCTGCCTGG - Intergenic
997499267 5:134358989-134359011 TCTTTTAAAAAATCTGTGCCAGG + Intronic
998774954 5:145588822-145588844 GATTTTAAACAGTCATTGCAGGG - Intronic
998845667 5:146307251-146307273 CCTTTAAAACAGACGTGGCCTGG - Intronic
999999692 5:157126018-157126040 CCTTTTAAAAAATTTTGGCCGGG - Intronic
1001126735 5:169026131-169026153 CCTGCTGAACAGTCTCTGCCAGG - Intronic
1001430602 5:171658653-171658675 ATTTTTAAACAGTCTTTAACTGG + Intergenic
1001921609 5:175604558-175604580 GCTTTAAAACATTCTTTGCAGGG + Intergenic
1003664071 6:8093165-8093187 CATTTTTAAGAGTCTTGGCCGGG - Intronic
1010120197 6:72366342-72366364 CCTTTTAAACAAACTTATCCTGG + Intronic
1011090241 6:83589684-83589706 GCTATTTAACAGTCTTTCCCAGG - Intronic
1011217886 6:85024602-85024624 CCTTTAAAACACACTTTTCCTGG + Intergenic
1011422542 6:87188902-87188924 GCTTTTAAAAAGTCTTTTTCAGG + Intronic
1012077096 6:94703147-94703169 ACTTTTAAACAGTCTCAGGCAGG - Intergenic
1012678532 6:102148998-102149020 CCTACTAAAAAGTCTTTGTCTGG + Intergenic
1012921192 6:105222591-105222613 CTTTCTAAACAGTTTATGCCAGG + Intergenic
1013741004 6:113285007-113285029 TCTTTTAATCAGTGTTTGCATGG + Intergenic
1015427890 6:133093379-133093401 CCTTTAAAACAGACTCAGCCAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018439888 6:163801852-163801874 TCTTTTGAACAGTCTTAGCATGG - Intergenic
1018503029 6:164433232-164433254 CTTTTTACTCAGTCTTTGCATGG + Intergenic
1020611731 7:10405614-10405636 GCTTTTAAAATGTCATTGCCTGG + Intergenic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1025533742 7:61922414-61922436 CCTTTTAAAGAATCTTTGAAGGG + Intergenic
1026764309 7:73150293-73150315 GCTTTTAAACAGTTTTGGCCAGG + Intergenic
1027040778 7:74960064-74960086 GCTTTTAAACAGTTTTGGCCAGG + Intergenic
1027082859 7:75242293-75242315 GCTTTTAAACAGTTTTGGCCAGG - Intergenic
1028532081 7:91849311-91849333 CCTTTTAATAAGTCTTTGGATGG - Intronic
1028657724 7:93229820-93229842 CCTTTTAAAAAGTGTTTGTTAGG + Intergenic
1030375538 7:108749214-108749236 GCTTTAAAAAAGTCTTTACCAGG + Intergenic
1030613773 7:111716784-111716806 CCTTTTAAAGAATCTTAGGCTGG + Intergenic
1030680413 7:112428035-112428057 CCTTCTAAACTCTCTTTACCAGG - Intronic
1033177573 7:139139353-139139375 ACTTTTTATCAGTCTTTCCCAGG - Intronic
1033509585 7:142041734-142041756 CCTTTCCAACATTCTTTGCCTGG + Intronic
1034314106 7:150113754-150113776 CTTTCTAAACAGTCTATGCCTGG + Intergenic
1036959808 8:13231793-13231815 CCTTTTAAACAATCTTTAAAAGG + Intronic
1037781285 8:21870944-21870966 GCTTTTAATCATTCTTTGCTAGG - Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038905012 8:31891180-31891202 CCTTTTAAAGGGTCTTTTGCAGG - Intronic
1039031536 8:33315080-33315102 CTCTATAAACATTCTTTGCCAGG - Intergenic
1040007643 8:42633577-42633599 CCTTTTATTCAGTCTTTCCTAGG + Intergenic
1040483988 8:47853265-47853287 CCTTTTAGACAGTCACTGGCTGG - Intronic
1040624571 8:49132264-49132286 CTATTTAAACCATCTTTGCCTGG + Intergenic
1043723656 8:83580552-83580574 CTCTTTAAACATTCTTTTCCAGG + Intergenic
1044635075 8:94315240-94315262 CTTTTTAATGAGTCTTTGTCTGG + Intergenic
1046762714 8:118038119-118038141 CTTTTTAAAAAATCTTGGCCGGG - Intronic
1046899173 8:119505400-119505422 CATTTAAAACATTCTTGGCCAGG - Intergenic
1049935399 9:497118-497140 CCTTTCAAACAGTTGTTTCCAGG + Intronic
1054906645 9:70419161-70419183 CCTTTTAAAAAGTCTTCCGCAGG + Intergenic
1055001482 9:71454920-71454942 TCATTGAAACTGTCTTTGCCTGG + Intergenic
1055708005 9:79028982-79029004 TCTTAAAAACAGTCTTTGCAGGG + Intergenic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1059050422 9:110918774-110918796 GTTTTTAAAAAGTTTTTGCCAGG - Intronic
1059787029 9:117597109-117597131 CCTTTGAAACAATCTTTTCTGGG + Intergenic
1060111056 9:120906472-120906494 TCTATTAAAAATTCTTTGCCGGG - Intronic
1060677984 9:125533747-125533769 CCTTTCAAAAAGTTTATGCCTGG - Intronic
1061664098 9:132150294-132150316 CCTTCTCAACAGCCTGTGCCAGG + Intergenic
1062448523 9:136605881-136605903 CCATTTAACAAGTCTTTACCAGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186626648 X:11301467-11301489 AATTGTAAACAGTCTTTGCAGGG + Intronic
1187701136 X:21965333-21965355 ACTTTTAAAAAGTCTGTGCAGGG + Intronic
1188893482 X:35638074-35638096 CCTTTTTAATATTCTATGCCAGG - Intergenic
1189143408 X:38630502-38630524 ACTCATAAACAGTCTTTACCTGG - Intronic
1190617292 X:52247609-52247631 CCTTTAAAACCGTCTTGGCTTGG + Intergenic
1192506565 X:71688889-71688911 TCTTTTATACAGTCTTTGGGTGG + Intergenic
1192520132 X:71792657-71792679 TCTTTTATACAGTCTTTGGGTGG - Intergenic
1192525998 X:71845078-71845100 TCTTTTATACTGTCTTTGGCTGG + Intergenic
1195024717 X:100864897-100864919 CCTTTTAGAAAGTCTTTGACAGG - Intronic
1195296026 X:103478410-103478432 CCTTTTAATCAGACTTAGCAAGG - Intergenic
1197498944 X:127221000-127221022 CCTTCTCAAAAATCTTTGCCAGG + Intergenic
1197884820 X:131207579-131207601 CCTTATAACCTATCTTTGCCTGG - Intergenic
1198257977 X:134941695-134941717 CCTTTTAAAAAGTTATTGGCTGG + Intergenic
1200013971 X:153144909-153144931 CCTATGAAACAGTCTGTGCCTGG - Intergenic
1200025629 X:153255044-153255066 CCTATGAAACAGTCTGTGCCTGG + Intergenic
1200742152 Y:6865190-6865212 AATTGTAAACAGTCTTTGCGGGG - Intergenic