ID: 963886514

View in Genome Browser
Species Human (GRCh38)
Location 3:150588757-150588779
Sequence TGTAAGTGCTAGACTTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 6, 2: 13, 3: 29, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963886514_963886516 25 Left 963886514 3:150588757-150588779 CCTATAAAAGTCTAGCACTTACA 0: 1
1: 6
2: 13
3: 29
4: 173
Right 963886516 3:150588805-150588827 TAATTATAAATGACTGTTCCTGG 0: 1
1: 0
2: 3
3: 57
4: 293
963886514_963886515 1 Left 963886514 3:150588757-150588779 CCTATAAAAGTCTAGCACTTACA 0: 1
1: 6
2: 13
3: 29
4: 173
Right 963886515 3:150588781-150588803 TTATGTACAGTACATAATACTGG 0: 6
1: 9
2: 12
3: 18
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963886514 Original CRISPR TGTAAGTGCTAGACTTTTAT AGG (reversed) Intronic
900034934 1:399824-399846 TATCAGTGCTTGACTTTGATAGG - Intergenic
900056551 1:635576-635598 TATCAGTGCTTGACTTTGATAGG - Intergenic
905191465 1:36238359-36238381 TATGAGTGCTAGGCATTTATTGG + Intronic
905957799 1:42013697-42013719 TGTAAGTGGAAGACTGCTATGGG - Intronic
907661878 1:56400779-56400801 TGGAAGGGGTAGAATTTTATAGG + Intergenic
909426885 1:75535890-75535912 TGAAAGTGGTAGTGTTTTATAGG - Intronic
910027897 1:82680384-82680406 TGGAAGTGGTAGACTTTTCCAGG + Intergenic
912621228 1:111160682-111160704 TTTGAGGTCTAGACTTTTATAGG + Intronic
914871195 1:151476089-151476111 TGTAATTAATATACTTTTATTGG + Intergenic
916406692 1:164504794-164504816 TGTATGTACTATTCTTTTATAGG + Intergenic
916410096 1:164538710-164538732 TGTATGTGCTATATTTCTATAGG - Intergenic
918505117 1:185245605-185245627 TGTATGTGCTATACTTTTAGAGG + Intronic
918953949 1:191180541-191180563 TGAAAGTACTGGAATTTTATTGG - Intergenic
919199717 1:194340196-194340218 TGTAAGTGTTAAAATTTTGTTGG - Intergenic
919398355 1:197078758-197078780 TGTAGGTGCAAGATTGTTATAGG - Intergenic
920717155 1:208350684-208350706 TGTATGTGCTAGACTTTTATTGG - Intergenic
922257461 1:223905381-223905403 TATCAGTGCTTGACTTTGATAGG - Intergenic
924338657 1:243008161-243008183 TATCAGTGCTTGACTTTGATAGG - Intergenic
1065891955 10:30128927-30128949 TGGAATTGCTAGACCTTTAAGGG - Intergenic
1067072514 10:43145245-43145267 TGCAAGTGGAAGACTTCTATAGG + Intronic
1068152674 10:53154087-53154109 TGAATGTGCTGTACTTTTATAGG - Intergenic
1068546434 10:58351765-58351787 TGTATGTGCTATACTTTTATAGG + Intronic
1069211271 10:65762443-65762465 CGTATGTGCTATACTTTAATAGG + Intergenic
1070577268 10:77688496-77688518 TGTATGTGAAAGACTTTGATTGG - Intergenic
1070868436 10:79725441-79725463 TGTATGTACTATACTTTTATAGG - Intergenic
1071052238 10:81465057-81465079 TGAATGTGTTACACTTTTATAGG + Intergenic
1071629959 10:87211761-87211783 ATAAAGTGCTAGAATTTTATTGG - Intergenic
1071635350 10:87247647-87247669 TGTATGTACTATACTTTTATAGG - Intergenic
1071659897 10:87490340-87490362 TGTATGTACTATACTTTTATAGG + Intergenic
1073467124 10:103700756-103700778 TGTAAATGCCAGACTGTTCTTGG + Intronic
1074660604 10:115652389-115652411 GGTCAGTGCAAGAATTTTATAGG - Intronic
1074733278 10:116400362-116400384 TGTATGTGCTATACTTTTTTAGG + Intergenic
1076019468 10:127060196-127060218 TGTAATTCCTAGACCTGTATGGG - Intronic
1076394410 10:130128618-130128640 TGTCATAGCTAGATTTTTATTGG - Intergenic
1077751999 11:4982241-4982263 TGTATGTGCTATACTTCTGTAGG + Intronic
1083705338 11:64510299-64510321 TGTACGTTCTTGAATTTTATAGG + Intergenic
1084073433 11:66753326-66753348 TATAAATGGAAGACTTTTATGGG + Intronic
1084615938 11:70235978-70236000 TGTAAACTCTAGACTTTGATGGG + Intergenic
1085107263 11:73855936-73855958 TGTAATTACTTGACTATTATTGG + Intronic
1086851727 11:91817149-91817171 TCTAAGTGCTGGAATTTTCTAGG + Intergenic
1089079425 11:115763441-115763463 TGTAAGTGATATATGTTTATTGG + Intergenic
1089995491 11:122902984-122903006 TGTGTGTGCTATACTTTTATAGG + Intronic
1091108834 11:132946424-132946446 TACATGTGCTAGACTTTCATGGG + Intronic
1091361253 11:134980128-134980150 TGTGTGTGCTAGACTTTTATAGG + Intergenic
1091511953 12:1136136-1136158 TCTAGGAGCTTGACTTTTATTGG - Intronic
1091527822 12:1322519-1322541 TGTAAGTGCTAGATTTTATCAGG - Intronic
1093678401 12:21971199-21971221 TGTAAGTGGTAGAGTTTGGTTGG - Intergenic
1093679475 12:21984702-21984724 TGTATGTGCTATACTTTTATAGG - Intergenic
1093856456 12:24110096-24110118 GGTAAGTGGTAGCCTCTTATAGG - Intergenic
1094277872 12:28699289-28699311 TGTAAGGGACAGGCTTTTATAGG - Intergenic
1096614989 12:52827141-52827163 TGGAAGGGCTAGACTTCTAGAGG - Intronic
1097272527 12:57785709-57785731 TGTATGTGCTATACTTTAATAGG + Intronic
1098022940 12:66174117-66174139 TGTAAGTGGTTGACATTTACAGG - Intergenic
1098418928 12:70270525-70270547 TGTAAGTCCTAAGTTTTTATAGG + Intronic
1098746791 12:74247550-74247572 TTTAAGTCCTATGCTTTTATTGG - Intergenic
1099544686 12:83963826-83963848 AGTAAGTGCTAGACTGACATTGG + Intergenic
1099757273 12:86868863-86868885 TGTAAGTTCTACACTTTTATTGG - Intergenic
1099856258 12:88170836-88170858 TTTATGTGCTAGTTTTTTATGGG + Intronic
1103033387 12:117636106-117636128 TTTAAATGCTAGACTTTATTTGG + Intronic
1103310132 12:119999359-119999381 TGCCAGTGATAGACTTTCATAGG - Intronic
1105786847 13:23758403-23758425 TGTAGTTGCCATACTTTTATGGG - Intronic
1107294934 13:38898474-38898496 TGTATGTGCTAGACTTTTATAGG + Intergenic
1108574727 13:51781513-51781535 GGTAAGTGCTAGAGTGCTATGGG + Intronic
1109512574 13:63398577-63398599 TGTAAATTCTTGTCTTTTATAGG - Intergenic
1109664136 13:65508004-65508026 GGTGAGTGATAGATTTTTATGGG - Intergenic
1109873641 13:68368731-68368753 TTTATGTGCTAGACTTGTAATGG - Intergenic
1110500970 13:76227681-76227703 TGTATGTGCGATACTTTTATTGG - Intergenic
1111289973 13:86153503-86153525 TCTATGTGCTATGCTTTTATAGG + Intergenic
1112559467 13:100499883-100499905 TGGAGGTGCTAGCATTTTATTGG + Intronic
1112665713 13:101570643-101570665 TGCAAGTGGGAGGCTTTTATAGG + Intronic
1113390921 13:109895770-109895792 TGTATGTGCTATCCTTTTATGGG + Intergenic
1116417044 14:44690832-44690854 TCTAGGTGTAAGACTTTTATTGG - Intergenic
1117254003 14:53960166-53960188 TGTAAGGGCTAGAGATATATAGG - Intergenic
1120554632 14:85914571-85914593 TGTGAGTGCAGGGCTTTTATGGG - Intergenic
1124870918 15:33541636-33541658 TGAAAGTACTAGACTTTAATAGG - Intronic
1125035601 15:35120750-35120772 TCAAAGTGCTAGGATTTTATAGG + Intergenic
1125320858 15:38486615-38486637 AGCAAGTGCTAAACTTTGATAGG - Exonic
1125334932 15:38617681-38617703 TGGAAGTGCAAGAGATTTATTGG - Intergenic
1126276623 15:46891139-46891161 TCTAAGTTCTAGATTTTTATTGG + Intergenic
1131706461 15:95001229-95001251 TCTCAGTGCTAAACTTTTCTGGG + Intergenic
1135231264 16:20710375-20710397 TGTAAGTGCTACACTCAGATGGG - Intronic
1135749952 16:25049793-25049815 TGTATGTGTTACACTTTTATAGG - Intergenic
1138970010 16:62132752-62132774 TTTATGTGTAAGACTTTTATGGG + Intergenic
1144343181 17:14327487-14327509 TTTAAGTTCAAGACTTTTATGGG + Intronic
1146920897 17:36710317-36710339 TCTAATTGCTAGACATATATAGG + Intergenic
1150355480 17:64481027-64481049 TGTTGGTGCTAGACTGTTAAGGG - Intronic
1152053368 17:78000366-78000388 AGTATTTGCTAGACTTTTGTGGG - Intergenic
1153953901 18:10080048-10080070 TGTACGTGCTAGGCTTTTATAGG + Intergenic
1154494043 18:14942762-14942784 TGTGTGTGCTAGACTTTTATAGG - Intergenic
1155520709 18:26665891-26665913 TGTACTTGCTACAGTTTTATTGG + Intergenic
1156289105 18:35729911-35729933 TGTAAGTCTTACACTTTTTTTGG - Intergenic
1157147949 18:45184992-45185014 CGTATGTGCTAGTATTTTATTGG + Intergenic
1157945852 18:51979983-51980005 TCTAACTGCTAGACTTATAAGGG + Intergenic
1158911855 18:62071734-62071756 TGTGTGTGCCAGACTTTTATAGG - Intronic
1159206353 18:65257726-65257748 TGTATGTGCTATACTTTTATAGG - Intergenic
1159289081 18:66393311-66393333 TGTAAGCTCTAGACATTTCTAGG + Intergenic
1159473779 18:68890675-68890697 TGTCAGTTCTAGAACTTTATAGG + Intronic
1160483869 18:79270170-79270192 TAAAAGTGCTAGCCTTTAATAGG + Intronic
925959340 2:9001317-9001339 ACAATGTGCTAGACTTTTATAGG + Intronic
926034144 2:9621542-9621564 TGTAACTGCTAGAAATGTATGGG - Intronic
926760311 2:16272737-16272759 TGAAAGTGCTGGCCTTTTAAAGG + Intergenic
927529993 2:23787970-23787992 TTTAAGTGTTAGATTTTTCTTGG - Intronic
928541351 2:32286870-32286892 TGTAACTGCTAGACCTATACTGG - Intronic
928630060 2:33182103-33182125 TATAAATACTGGACTTTTATTGG + Intronic
933641454 2:84765544-84765566 TGTAAGTGTTAAAATTTTAGGGG + Intronic
935248835 2:101243296-101243318 TTTAAGTGGTATAGTTTTATTGG - Intronic
935411694 2:102771192-102771214 TCTAAGTACTTGACATTTATGGG - Intronic
937744967 2:125401520-125401542 TTAAAGTGCTTGACTATTATAGG - Intergenic
938925275 2:136034601-136034623 TGTAAGCCCTAGACTCATATAGG + Intergenic
939198864 2:139008879-139008901 TTTAAGTGCTTAACTTTTACTGG - Intergenic
939208032 2:139133048-139133070 TCTGAATACTAGACTTTTATTGG + Intergenic
939292862 2:140218087-140218109 TGTATTTGCTATACTTTGATAGG + Intergenic
939349026 2:141008540-141008562 TGAAAGTAATAGACTTTTGTTGG - Intronic
940697593 2:156998970-156998992 TAATTGTGCTAGACTTTTATAGG + Intergenic
943390078 2:187255304-187255326 TGTATGTGCTATTATTTTATAGG - Intergenic
944029393 2:195215737-195215759 TGCAAATGCTAGATTTTTGTAGG - Intergenic
945558664 2:211310761-211310783 TGTATATGCTAGAATTTTGTAGG - Intergenic
946502129 2:220260662-220260684 TGTGAGTCCTACACTTTTCTAGG - Intergenic
947189347 2:227485597-227485619 TGTAGATGCATGACTTTTATTGG + Intronic
1170193284 20:13664904-13664926 TGTAAGTCCAACACTTTGATGGG - Intergenic
1173237390 20:41259394-41259416 TGTATGTGCAAGTATTTTATAGG - Intronic
1177077254 21:16592018-16592040 TGTAAGGGGTAGATGTTTATTGG + Intergenic
1184803829 22:46779144-46779166 TGTATGTGCTATACTGTTATAGG + Intronic
949132199 3:517165-517187 TCCATGTGCTAGACTTTTATAGG - Intergenic
949284675 3:2388028-2388050 TTTAAGTGGAAGGCTTTTATTGG + Intronic
952178933 3:30897291-30897313 TGTATGTGTTGTACTTTTATAGG + Intergenic
953342812 3:42149857-42149879 TGTAAGTGTTATACTTCTATTGG + Intronic
957542302 3:81588049-81588071 GGTATGTGATAGTCTTTTATAGG - Intronic
959516173 3:107269535-107269557 TGAAAGTGCAAGAGGTTTATTGG - Intergenic
960117101 3:113906125-113906147 TGTTTGTGCTATACCTTTATAGG - Intronic
960329193 3:116337617-116337639 GTTAAGTGGTTGACTTTTATAGG - Intronic
963024389 3:140904320-140904342 TGTATGTACTATACTTTTATAGG + Intergenic
963144538 3:141979262-141979284 TGCATGTGCTAGACTTTTATAGG - Intronic
963632604 3:147751943-147751965 TTCAAGTAATAGACTTTTATGGG + Intergenic
963886514 3:150588757-150588779 TGTAAGTGCTAGACTTTTATAGG - Intronic
964245948 3:154653767-154653789 TGTACATGATAGACATTTATTGG - Intergenic
965981417 3:174696401-174696423 TATGAGTGCTAGACTTATGTGGG + Intronic
966469895 3:180277456-180277478 TGTAAGGCCTGGACTTTTTTGGG + Intergenic
970656753 4:18239457-18239479 AGTATCTGCTAGACTTTTAGGGG + Intergenic
970742921 4:19258865-19258887 TGTATGTGCTAGACTTTTATAGG - Intergenic
970816312 4:20160387-20160409 TGTAAATGCTAGACATGTGTTGG + Intergenic
973658520 4:53077241-53077263 TTTAAGTGCTTGTGTTTTATGGG + Intronic
975492470 4:75003781-75003803 TGTAGGTGCGAAACTTTTGTAGG + Intronic
976802960 4:89013687-89013709 TGTGTATGCTATACTTTTATAGG - Intronic
979238463 4:118427078-118427100 TATCAGTGCTTGACTTTGATAGG + Intergenic
979983633 4:127288249-127288271 TAAAAGTGCTAGCCTTTGATGGG + Intergenic
980510325 4:133777086-133777108 TGTATGTGTTATACTTTTATAGG + Intergenic
980531142 4:134056761-134056783 TGTAAGTTCTAGATGTTTTTTGG + Intergenic
980738767 4:136924020-136924042 TCTAAGTTCAAGTCTTTTATGGG - Intergenic
981125490 4:141101630-141101652 TGTATGTGCTACACTTTTACAGG + Intronic
982398482 4:154939831-154939853 TGCAAATGCTAGAATATTATGGG + Intergenic
982905524 4:161064629-161064651 TGTATGTGCTGTACATTTATTGG + Intergenic
982905596 4:161066046-161066068 TGTATGTGCTGTACATTTATTGG + Intergenic
983591741 4:169420435-169420457 TGTATGTCCTAAACTTTTATAGG + Intronic
987766407 5:22237085-22237107 TGTACGTGCAACACTTTTATAGG + Intronic
990075967 5:51846178-51846200 TGTATGTAGTATACTTTTATAGG + Intergenic
990190274 5:53251865-53251887 TGTATGTGTTATAGTTTTATAGG + Intergenic
990203737 5:53406918-53406940 TGTATGTGCTATACTTTCAAAGG - Intergenic
991459035 5:66837166-66837188 ATTAAGTGCTAGTGTTTTATTGG - Intronic
992317736 5:75575513-75575535 TTTAAGTGCTTGATTTTTACTGG + Intronic
996992020 5:129646388-129646410 TGTTAGTGCTTTACTTTTATAGG - Intronic
1000994895 5:167948794-167948816 TGTAAGTTCCATACATTTATTGG - Intronic
1001588511 5:172849824-172849846 TGTCAGTGCTAGACATTTGCAGG + Intronic
1002738885 5:181419047-181419069 TATCAGTGCTTGACTTTGATAGG + Intergenic
1004524664 6:16395584-16395606 TGCATGTGCTATACTTTTATAGG - Intronic
1005176766 6:23055610-23055632 TGTAAATGTTAGCCTTTTAAAGG + Intergenic
1005920909 6:30400515-30400537 TGTATGTGCTAGACTTTTATAGG + Intergenic
1005923932 6:30424866-30424888 TGTATGGGGTAGACTTTTATAGG - Intergenic
1008023147 6:46603046-46603068 TGTAAGCTCCAGACTTTTGTAGG - Intronic
1008272163 6:49503045-49503067 TTTAAGTGGTATAGTTTTATTGG + Intronic
1008618506 6:53249009-53249031 TGTAAGTGATAGTAATTTATGGG - Intergenic
1009317047 6:62232931-62232953 TGTAAGTGCTACTCTTTGGTTGG - Intronic
1010126279 6:72436074-72436096 TGTTAGTGCTAGGATTTTAGAGG + Intergenic
1010565165 6:77401860-77401882 TGTAAGTGCTAGCCCTTTTAGGG + Intergenic
1012839641 6:104313633-104313655 TTTATGTGCTAGACTTTTATAGG + Intergenic
1014177678 6:118348378-118348400 CCAAAGTGCTAGAATTTTATGGG + Intergenic
1015723006 6:136265237-136265259 TCTAAGTGCTCTAATTTTATAGG - Intronic
1017655866 6:156629031-156629053 TGTATGTGCTAGACTTTTATAGG - Intergenic
1017833157 6:158150912-158150934 TGTATGAGCTAGACTTTTATAGG - Intronic
1019243993 6:170694599-170694621 TATCAGTGCTTGACTTTGATAGG + Intergenic
1020209981 7:6151785-6151807 CGTATGTGCTAGACTTCCATGGG + Intronic
1020529226 7:9309300-9309322 TATATGTGCTACACTTTTATAGG - Intergenic
1020805728 7:12788138-12788160 TGTATGTGCTAGACTTTCATAGG - Intergenic
1022764909 7:33401248-33401270 TGGAAGTGATAGATTTTCATGGG + Intronic
1024784554 7:52892564-52892586 TCCTTGTGCTAGACTTTTATAGG - Intergenic
1026670035 7:72382249-72382271 TGTCAGTGCAAGACATTCATAGG + Intronic
1027545805 7:79526160-79526182 TGTGTGTGGTATACTTTTATAGG + Intergenic
1029870256 7:103683643-103683665 TTTATATGCTATACTTTTATAGG - Intronic
1030975604 7:116118551-116118573 TGTAGGTGCAGGACTTATATAGG - Intronic
1031948931 7:127871347-127871369 TGTATGTGCTATACATTTATAGG + Intronic
1033188709 7:139255398-139255420 TGTGTGTGCTAGATTTTGATGGG + Intronic
1033944842 7:146703985-146704007 TTTAAGTGGGAGACTTTTATAGG + Intronic
1035504132 8:113561-113583 TATCAGTGCTTGACTTTGATAGG - Intergenic
1038903739 8:31873674-31873696 AGTACCTGCTAGTCTTTTATAGG - Intronic
1039496101 8:37981484-37981506 TGTAGGTGCGTTACTTTTATAGG - Intergenic
1040814363 8:51492040-51492062 TGCAACTGCTATACTTCTATAGG + Intronic
1041369663 8:57145318-57145340 TGTATATGTTAGACTTTTACAGG - Intergenic
1042164087 8:65928700-65928722 TGTATGTGCTAGACTTTTATAGG + Intergenic
1043307240 8:78810429-78810451 TGCATGTGGTATACTTTTATAGG + Intergenic
1044793181 8:95868875-95868897 TCTTTGTGCTAAACTTTTATGGG + Intergenic
1046017760 8:108626490-108626512 TGTAAGAGCAAGTCGTTTATTGG + Intronic
1046644790 8:116774406-116774428 TTTAATTGCTAGTTTTTTATAGG + Exonic
1047552936 8:125896323-125896345 TGTAAGTGCAAGAATTTCATAGG - Intergenic
1047923642 8:129660615-129660637 TGTATGTATTATACTTTTATAGG + Intergenic
1048058732 8:130895192-130895214 TTAAAGTGCTATACGTTTATTGG + Intronic
1048803591 8:138218046-138218068 TATAATTGGTAGACTTTAATGGG + Intronic
1051017440 9:12496021-12496043 TGCAAGTGCTTTACTTTTGTAGG - Intergenic
1052542173 9:29825677-29825699 TGAAAGTGCAACATTTTTATTGG + Intergenic
1055826100 9:80326535-80326557 TGTAAGTGCTGGTCTATTTTTGG - Intergenic
1055832184 9:80393267-80393289 TGTATGTGCTAGACTTTCATAGG + Intergenic
1056240259 9:84638477-84638499 TGTAAGTGCTGGACGATTGTTGG + Intergenic
1059092618 9:111376605-111376627 TGGAAGTGAAAGTCTTTTATGGG - Intronic
1203604182 Un_KI270748v1:43823-43845 TATCAGTGCTTGACTTTGATAGG + Intergenic
1186381449 X:9064486-9064508 TTTCAGTGCTAGAAATTTATGGG - Intronic
1186906509 X:14116920-14116942 TGAATGTCCTAGACTTTAATTGG + Intergenic
1188199392 X:27280496-27280518 GGTAAGTGCTAGAGTTGTAGGGG + Intergenic
1188442409 X:30225543-30225565 TGTATGTGCTATACTTTTATAGG - Intergenic
1193742363 X:85232522-85232544 TGTCATTTCTAGACTTATATTGG + Intergenic
1194724374 X:97377338-97377360 TGTATGCACTATACTTTTATAGG + Intronic
1199058143 X:143321653-143321675 GGTAATTGCTACACATTTATGGG - Intergenic
1202386237 Y:24328870-24328892 TATCAGTGCTTGACTTTGATAGG + Intergenic
1202484549 Y:25341258-25341280 TATCAGTGCTTGACTTTGATAGG - Intergenic