ID: 963894788

View in Genome Browser
Species Human (GRCh38)
Location 3:150673747-150673769
Sequence GTCTCCACAAAGTGTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963894788_963894791 0 Left 963894788 3:150673747-150673769 CCCAGCTAACACTTTGTGGAGAC 0: 1
1: 0
2: 1
3: 25
4: 298
Right 963894791 3:150673770-150673792 GGAGTTTTGCCATGTTGCCCAGG 0: 311
1: 4738
2: 23032
3: 70855
4: 198074
963894788_963894792 4 Left 963894788 3:150673747-150673769 CCCAGCTAACACTTTGTGGAGAC 0: 1
1: 0
2: 1
3: 25
4: 298
Right 963894792 3:150673774-150673796 TTTTGCCATGTTGCCCAGGCTGG 0: 5847
1: 27241
2: 64012
3: 195381
4: 302887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963894788 Original CRISPR GTCTCCACAAAGTGTTAGCT GGG (reversed) Intronic
901273266 1:7970346-7970368 GTCTACTCAAAGTCTTAACTGGG + Intronic
902059106 1:13626902-13626924 GTCTCTACAAAGAGTTAGCCAGG + Intergenic
903091782 1:20926508-20926530 ATCTCTACAAAAAGTTAGCTGGG + Intronic
903436066 1:23350141-23350163 GTCTCTACAAAAAATTAGCTGGG + Intergenic
903854646 1:26329638-26329660 GTCTCTACAAAAAATTAGCTGGG - Intronic
904656060 1:32048336-32048358 GTCTCTACAAAAAGTTAGCTGGG + Intronic
906287865 1:44599502-44599524 ATCTCTACAAAAAGTTAGCTGGG + Intronic
906348730 1:45038762-45038784 GTCTCTACAAAATATTAGCCAGG - Intronic
906412142 1:45587059-45587081 GTCTGCAAAAAGTCTTAGGTTGG + Intronic
906570238 1:46831656-46831678 GTCTCTACAAAAAATTAGCTGGG - Intergenic
906758932 1:48353745-48353767 TTTTCCACATAGTGGTAGCTAGG - Intronic
907217039 1:52873149-52873171 GTCTCTACAAAATATTAGCCAGG + Intronic
908663973 1:66468518-66468540 GTCCTCACAAAGAATTAGCTTGG - Intergenic
909369969 1:74872208-74872230 GTCTCTAAAAAATGTTATCTAGG - Intergenic
910196618 1:84647875-84647897 GTCTCTACAAAAAATTAGCTGGG + Intronic
911004162 1:93200143-93200165 GTCTCTACAAAAAGTTAACTGGG - Intronic
912633447 1:111269377-111269399 GTCTTCACAAAGTCTTCCCTAGG - Intergenic
913769395 1:122231435-122231457 GTCGTCACAAAGTGTTTCCTAGG - Intergenic
913777800 1:122344147-122344169 GTCGTCACAAAGTGTTTCCTGGG - Intergenic
913779482 1:122366534-122366556 GTCGTCACAAAGTGTTTCCTGGG - Intergenic
913782139 1:122401992-122402014 GTCGTCACAAAGTGTTTCCTGGG - Intergenic
913782845 1:122411325-122411347 GTCGTCACAAAGTGTTTCCTAGG - Intergenic
914338359 1:146737593-146737615 GTCTCTACAAAAAATTAGCTGGG - Intergenic
917943710 1:179948244-179948266 GTCTCTACAAAAAATTAGCTGGG - Intergenic
918424973 1:184399521-184399543 CTCTCTACAAAATATTAGCTGGG - Intronic
918777282 1:188650101-188650123 GGCTCCAAAAAGGGTTAACTTGG - Intergenic
919911826 1:202115955-202115977 GTCTCCACTAAAATTTAGCTGGG - Intergenic
920552489 1:206874486-206874508 ATCTCTACAAAAAGTTAGCTAGG + Intergenic
921802020 1:219412194-219412216 GTCTCTACAAAAAATTAGCTGGG - Intergenic
922315949 1:224442177-224442199 GTCTCTACAAAAAGTTAGCCAGG - Intronic
922688514 1:227667202-227667224 GTCTCTACAAAAAATTAGCTGGG - Intronic
923708336 1:236363993-236364015 GTCTCTACAAAAAATTAGCTGGG + Intronic
924114474 1:240731520-240731542 GTCTCTACAAAATATTAGCTAGG + Intergenic
1065333692 10:24631887-24631909 GTCTCTACAAAAAATTAGCTGGG - Intronic
1066100944 10:32117966-32117988 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1066207946 10:33208219-33208241 GTCTCCACAAAAAATTAGCTCGG - Intronic
1067379338 10:45758766-45758788 GTCTCCACAAAAAATTAGCCGGG - Intronic
1067887038 10:50099428-50099450 GTCTCCACAAAAAATTAGCCGGG - Intronic
1068326397 10:55493385-55493407 GTCACTACAAAATATTAGCTGGG + Intronic
1069097262 10:64274015-64274037 GTCACCACAATGTGTTTGGTAGG + Intergenic
1070286895 10:75090127-75090149 GTCTCTACAAAAAGTCAGCTGGG + Intergenic
1071341606 10:84653855-84653877 ATCTCCACAAAATATTAGCTGGG - Intergenic
1072301240 10:94064380-94064402 GTCTCTACAAAAAATTAGCTGGG + Intronic
1072301778 10:94068768-94068790 GTCTCTACTAATTATTAGCTTGG - Intronic
1073164766 10:101436474-101436496 GTCTCTACAAAAAATTAGCTGGG + Intronic
1074173615 10:110972674-110972696 GTCTCTACAAAAAATTAGCTGGG + Intronic
1074456721 10:113602044-113602066 GTCTCTACAAAAAATTAGCTGGG - Intronic
1075988679 10:126813702-126813724 GTCTCTACAAAAAGTAAGCTGGG - Intergenic
1077912954 11:6589182-6589204 GTCTCCAAAAAATCTTGGCTGGG + Intronic
1078243667 11:9553130-9553152 CTCTACACAAAAAGTTAGCTGGG + Intergenic
1079424015 11:20323300-20323322 ATCTCCACAAAAAATTAGCTAGG + Intergenic
1079850902 11:25533001-25533023 GACTCCAAAAAGTGGGAGCTAGG - Intergenic
1081116093 11:39203391-39203413 GTCTCCACTAAAAATTAGCTGGG + Intergenic
1082074424 11:47965235-47965257 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1082145888 11:48668176-48668198 GTATCCACAAAGGGATATCTGGG + Intergenic
1083818548 11:65151997-65152019 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1084994234 11:72959629-72959651 GTCTCCACACAATGTGGGCTTGG + Intronic
1086272580 11:85084970-85084992 TTCTCCATAAACTGTTAGTTTGG + Intronic
1087178127 11:95114275-95114297 GTCTCTACAAAAAATTAGCTAGG - Intronic
1087667434 11:101066909-101066931 GTCTACAAAAAGTGAAAGCTGGG - Intronic
1088123933 11:106400642-106400664 CTCTCCACTAAGAGTTAACTTGG - Intergenic
1089611266 11:119670805-119670827 GTCTCTACAAAATATTAGCCGGG - Intronic
1090778477 11:129985621-129985643 GTCTCTACAAAAAGTTAGCCAGG + Intronic
1091273570 11:134334222-134334244 GGCTCCACAAAGAGTGAACTTGG - Intronic
1091777938 12:3196905-3196927 GCCTGGACAAAGTGTGAGCTGGG + Intronic
1092888591 12:12947723-12947745 GTCTCTACAAAAAATTAGCTGGG - Intronic
1092929701 12:13304368-13304390 GTCTACACAAACTTTTAGCTGGG + Intergenic
1094646466 12:32329263-32329285 GTCTCCACAAAAAGTTAGCCAGG - Intronic
1096315320 12:50559570-50559592 GTCTCCACAAAAAATTAGCCAGG + Intronic
1096645918 12:53035672-53035694 ATCTCTACAAAATTTTAGCTGGG - Intronic
1097978958 12:65717575-65717597 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1098354156 12:69594684-69594706 GTCTCTACAAAAAATTAGCTGGG + Intronic
1099079368 12:78157292-78157314 GGCCCCGCAAAGTGTTGGCTGGG - Intronic
1099619821 12:84988750-84988772 TTCTATAAAAAGTGTTAGCTTGG + Intergenic
1101955437 12:109208374-109208396 GTCTCTACAAAAAATTAGCTGGG - Intronic
1103389085 12:120557340-120557362 GTGTCCACAACGGGTTATCTTGG - Exonic
1103689708 12:122761649-122761671 GTCTCTACAAAAAATTAGCTGGG + Intronic
1104553528 12:129779448-129779470 ATCTCTACAAAATATTAGCTGGG - Intronic
1104691197 12:130827743-130827765 GTCTCTACAAAAAATTAGCTGGG + Intronic
1105327053 13:19380302-19380324 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1107355909 13:39566570-39566592 GTCTCTACAAAAAATTAGCTGGG + Intronic
1107422341 13:40259711-40259733 GACTCCAACAAGTGTTTGCTTGG - Intergenic
1107992406 13:45830271-45830293 GTCTCCATAAAGAGTGAGCCTGG + Intronic
1109689192 13:65864254-65864276 GTCTCCCCAAATTATTAGCTTGG - Intergenic
1110783014 13:79489166-79489188 TACTCCACATAGTGTTAGCTAGG + Intronic
1112287673 13:98118445-98118467 GTCTCCACTAAAAATTAGCTGGG - Intergenic
1113846022 13:113392206-113392228 ATCTCTACAAAAAGTTAGCTGGG - Intergenic
1114590246 14:23857945-23857967 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1116716174 14:48430254-48430276 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1117506313 14:56406560-56406582 ATCTCTACAAAATATTAGCTGGG + Intergenic
1118574682 14:67230409-67230431 GTCTCCACAAAAAATAAGCTGGG + Intergenic
1119551482 14:75517123-75517145 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1119798989 14:77425928-77425950 AACTCTACAAAATGTTAGCTGGG + Intergenic
1122557059 14:102586302-102586324 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1122674995 14:103405509-103405531 GTCTCTACAAAAAATTAGCTGGG - Intronic
1122701266 14:103590697-103590719 GTCTCTACAAAAAATTAGCTGGG + Exonic
1126354872 15:47784448-47784470 CTCTCCACAGAGTGTTGACTAGG + Intergenic
1126575669 15:50193988-50194010 ATCTCTACAAAAAGTTAGCTGGG + Intronic
1127156460 15:56131425-56131447 GTCTCTACAAAAAATTAGCTGGG - Intronic
1127440608 15:59003271-59003293 GTCTCTACAAAAACTTAGCTGGG - Intronic
1128189844 15:65681734-65681756 GTCTCTACAAAAAATTAGCTGGG - Intronic
1129854829 15:78815945-78815967 GTCTCTACAAAAAATTAGCTGGG + Intronic
1130570861 15:85042333-85042355 GTCTCTACAAAAAATTAGCTGGG - Intronic
1131042920 15:89289100-89289122 GTCTGAACAAATGGTTAGCTTGG - Intronic
1133046488 16:3091149-3091171 CTCTCTACAAAAAGTTAGCTGGG + Intronic
1133484923 16:6210559-6210581 GTCTCTACAAAAAATTAGCTGGG + Intronic
1134079264 16:11313896-11313918 GTCTCTACAAAAAATTAGCTGGG - Intronic
1134824643 16:17274813-17274835 ATGTTCACTAAGTGTTAGCTGGG - Intronic
1135292165 16:21249313-21249335 GTCTCTACAAAAAATTAGCTAGG + Intronic
1137659541 16:50192911-50192933 GTCTCTACAAAAAATTAGCTGGG + Intronic
1138407138 16:56805216-56805238 CTCTCTACAAAAAGTTAGCTGGG - Intronic
1138517801 16:57546877-57546899 ATCTCTACAAAATATTAGCTGGG - Intronic
1139995919 16:70979761-70979783 GTCTCTACAAAAAATTAGCTGGG + Intronic
1140227770 16:73092552-73092574 GTCTCCACACAAGGTTTGCTGGG + Intergenic
1140415377 16:74770537-74770559 GTCTCTACAAAAAATTAGCTGGG - Intronic
1141223036 16:82089624-82089646 GTCTAAACCAAGTGTTAGCAGGG + Intronic
1143231167 17:5356809-5356831 GTCTCTACAAAAAATTAGCTGGG - Intronic
1143657384 17:8303555-8303577 GTCTCTACAAAAAGTTAGCCAGG + Intergenic
1144868468 17:18352657-18352679 GTCTCTACAAAAAATTAGCTGGG + Intronic
1145035697 17:19539100-19539122 GTCTCTACAAAATGTTGCCTGGG + Intronic
1146396272 17:32470171-32470193 ATCTCTACAAAAAGTTAGCTTGG - Intronic
1146734703 17:35228442-35228464 GTCTCCACAAAAATTTAGCCAGG - Intergenic
1147188069 17:38723329-38723351 GTCTCTACAAAAAATTAGCTGGG + Intronic
1147416222 17:40292195-40292217 GTCTCTACAAAAAATTAGCTGGG - Intronic
1148728628 17:49816041-49816063 GTCTCCAAAAAGGGACAGCTGGG - Intronic
1149346106 17:55738037-55738059 TGCTCCAGATAGTGTTAGCTGGG + Intergenic
1150052060 17:61974241-61974263 GTCTCTACAAAAAGTTAGCTGGG + Intronic
1150130332 17:62665723-62665745 GTCCCCACAAAGTTCTATCTCGG - Intronic
1152219783 17:79056980-79057002 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
1153477571 18:5513597-5513619 GACTCCACAATGAATTAGCTGGG + Intronic
1155421482 18:25661301-25661323 GTCTCCACAAAAAGTTAGCCTGG + Intergenic
1155441590 18:25868049-25868071 TGCTCCACACAGTGTTGGCTGGG - Intergenic
1155574941 18:27234403-27234425 CTCTCCACAAAAAATTAGCTGGG - Intergenic
1156013190 18:32517397-32517419 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1158525831 18:58212637-58212659 GTCTCCACAAAAAATTGGCTAGG - Intronic
1162119026 19:8450568-8450590 ATCTCTACAAAATATTAGCTAGG - Intronic
1162719657 19:12654832-12654854 GTCTCTACAAAAAATTAGCTGGG - Intronic
1162836854 19:13325328-13325350 GTCTCTATCAAGTATTAGCTGGG + Intronic
1162863769 19:13528129-13528151 ATCTCTACAAAAAGTTAGCTGGG - Intronic
1163128717 19:15258755-15258777 GTCTGCACAAAAATTTAGCTGGG - Intronic
1163308540 19:16497944-16497966 GTTTCTACAAAAAGTTAGCTAGG + Intronic
1165010178 19:32840331-32840353 GTCTCTACAAAAAGATAGCTGGG - Intronic
1165430961 19:35772456-35772478 GTCTCCACTAAAAATTAGCTGGG + Intergenic
1166499439 19:43329905-43329927 GTCTCCACACAGTTTTCACTGGG - Intergenic
1167027322 19:46930196-46930218 GTCTCTACAAAATATTATCTGGG + Intronic
1168009593 19:53519891-53519913 GCCTCTAGAAAGTGTTAGGTAGG - Intergenic
1168532688 19:57142308-57142330 GTCTCTACAAAAAATTAGCTGGG - Intronic
927828164 2:26324088-26324110 ATCTCTACAAAAAGTTAGCTGGG + Intronic
927970150 2:27300705-27300727 GTCTCTACAAAAAATTAGCTGGG + Intronic
928322808 2:30296601-30296623 GTCTCCACTAAGTCTTGTCTGGG + Intronic
928690647 2:33794964-33794986 GTCTCTACAAAAACTTAGCTGGG + Intergenic
929378854 2:41324897-41324919 TGCTCCACTCAGTGTTAGCTGGG - Intergenic
930434998 2:51329562-51329584 GTCTACACACACTGTTACCTAGG + Intergenic
932558865 2:72849863-72849885 GTCTCTACAAAACGTTAGCCGGG + Intergenic
933693643 2:85198698-85198720 GTCTCTACAAAAAATTAGCTGGG + Intronic
933707122 2:85299696-85299718 GTCTCTACAAAATATTAGCGAGG + Intronic
934687216 2:96330081-96330103 GTCTCTACAAAAAATTAGCTGGG + Exonic
940581916 2:155591236-155591258 GTCTCCACAAAAAGTTTACTTGG + Intergenic
942113854 2:172708131-172708153 GTCTCTACAAAAAATTAGCTGGG + Intergenic
942135528 2:172921255-172921277 GTCTCCACAAAAAACTAGCTGGG - Intronic
942771478 2:179526195-179526217 GTCTCTACAAAAAATTAGCTGGG - Intronic
943668566 2:190636163-190636185 GACAGCACAAAGTGTTGGCTAGG - Intergenic
944399698 2:199311307-199311329 TTCCCCACAAAGTGTTTGCTTGG + Intronic
944703314 2:202264769-202264791 GTCTCTACAAAAAATTAGCTGGG + Intergenic
944714617 2:202366309-202366331 GTCTCTACTAAATGTTAGCCAGG + Intergenic
945234213 2:207619476-207619498 GTCACTACAAAGTGTTAGGTTGG - Intronic
946430727 2:219626109-219626131 GTCTCTACTAAGAATTAGCTGGG - Intergenic
948688810 2:239689136-239689158 GTCTCCCCAAAGTGTTCACAGGG + Intergenic
1168770807 20:415205-415227 GTCTCTACAAAACATTAGCTAGG + Intronic
1170623822 20:18015631-18015653 GTCTCTACAAAATATTAACTGGG + Intronic
1171546414 20:26005414-26005436 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1172341869 20:34164383-34164405 GTCTCTACAAAAAATTAGCTAGG - Intergenic
1172486478 20:35301092-35301114 GTCTCTACAAAAAGTTAGCTGGG - Intergenic
1172912424 20:38419895-38419917 GTCTCCACAAAAAATTAGCCAGG - Intergenic
1174641366 20:52047286-52047308 GTCTCCACCAAAAATTAGCTGGG - Intergenic
1175905111 20:62375744-62375766 GGCTCCACAAAGGGCTTGCTGGG + Intergenic
1179675377 21:42977739-42977761 GGCTCTACTAAATGTTAGCTAGG + Intronic
1180963283 22:19772464-19772486 GTCTCTACAAAATATTAGCAGGG - Intronic
1181347749 22:22232440-22232462 GTCTCCACAAAAAGTTAGCTGGG + Intergenic
1181642469 22:24210518-24210540 ATCTCTACAAAATATTAGCTGGG + Intergenic
1182760222 22:32716689-32716711 GTCTCCACAAAAAATTAGCCGGG - Intronic
1183104913 22:35608758-35608780 GACTCCAGAAAGTCTGAGCTGGG - Intronic
954669842 3:52284324-52284346 GTCTCCACAAAAAATTAGCCAGG + Intronic
955168779 3:56542304-56542326 GTCTCCCCAAACTCTCAGCTTGG + Intergenic
955352798 3:58206449-58206471 GTCTCCCCAAAGTGGAAGCCCGG - Intronic
955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG + Intronic
957521124 3:81319731-81319753 GTGTCCTCACAGTGTTAGATTGG - Intergenic
958984723 3:100767106-100767128 GTCTCTACAAAAAATTAGCTGGG - Intronic
961132861 3:124484933-124484955 GTCTCTACAAAAAATTAGCTGGG + Intronic
961161584 3:124731059-124731081 GTCTCTACAAAAAATTAGCTGGG + Intronic
961831304 3:129624293-129624315 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
961866865 3:129959759-129959781 GTCTCTACAAAAAATTAGCTGGG - Intergenic
962578723 3:136778079-136778101 ATCTCCACAAAAAATTAGCTGGG + Intergenic
962951437 3:140223342-140223364 CTCTCAACAAAGACTTAGCTAGG - Intronic
963894788 3:150673747-150673769 GTCTCCACAAAGTGTTAGCTGGG - Intronic
964341761 3:155715771-155715793 GTTTCCACAAAAAATTAGCTGGG - Intronic
964797597 3:160516609-160516631 GTCTCTACAAAATATTAGCTGGG + Intronic
965496295 3:169402843-169402865 GCCTTCACAAAGTGTTTGCCAGG + Intronic
966530490 3:180973339-180973361 GTTTCAACAATGTGTTAGGTTGG + Intronic
966716144 3:183014872-183014894 GTCTCCACAAAAAATAAGCTGGG - Intergenic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969815726 4:9685982-9686004 GTCTCTACAAAAAATTAGCTGGG + Intergenic
970149618 4:13075384-13075406 GTCTCTACAAAAAATTAGCTGGG - Intergenic
972352421 4:38248472-38248494 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
973279676 4:48345963-48345985 GTCTACACAAAATGTTATATGGG - Intronic
974071016 4:57123716-57123738 GTCTCTACAAAAAATTAGCTGGG - Intergenic
976775537 4:88701961-88701983 GTCTCCACAAAAAATTAGCCAGG - Intronic
979983580 4:127287664-127287686 GTCTCCACCAGGTGTTATTTTGG - Intergenic
981389993 4:144178145-144178167 GTCTTCACAGAGTATTAACTTGG - Intergenic
981570015 4:146142035-146142057 CTCTTCACAAAGTGTAGGCTGGG + Intergenic
981756270 4:148144363-148144385 GTCTCTACAAATAATTAGCTAGG - Intronic
982053202 4:151524139-151524161 GTCTCTACAAAAAATTAGCTGGG + Intronic
982185867 4:152798087-152798109 GTCTCTACAAAAAATTAGCTGGG + Intronic
982324462 4:154115245-154115267 GTCTACACAAATTGCTAGTTTGG - Intergenic
983443347 4:167816010-167816032 GTCTCTACAAAAAATTAGCTGGG + Intergenic
983559426 4:169086123-169086145 GTCTCTACAAAAAGTTACCTGGG + Intergenic
985971138 5:3379488-3379510 GTCTCCACAATGAGTTTGCTCGG + Intergenic
987294160 5:16535576-16535598 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294174 5:16535656-16535678 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294181 5:16535696-16535718 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294188 5:16535736-16535758 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294217 5:16535896-16535918 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987294224 5:16535936-16535958 GCCTTCACAAAGTGGGAGCTGGG + Intronic
987985668 5:25142289-25142311 GTCTCCACTAAAAATTAGCTGGG - Intergenic
988570369 5:32359024-32359046 GTCTCTACAAATAATTAGCTGGG + Intronic
992385144 5:76277603-76277625 GTCTCTACAAAAAGTTAGCCGGG + Intronic
993062906 5:83061561-83061583 GTCTCTACTAAAAGTTAGCTGGG - Intronic
993807289 5:92426770-92426792 GTCTCTACAAAAAATTAGCTGGG - Intergenic
994210042 5:97077439-97077461 GTCTCTACAAAAAGTTAGCCAGG + Intergenic
995109837 5:108416995-108417017 GTCTCCACAACCTTTTAACTCGG + Intergenic
995504768 5:112848752-112848774 GTCTCTACAAAAAATTAGCTGGG + Intronic
996086513 5:119310664-119310686 GTCTCTACTAAGAATTAGCTGGG + Intronic
996375952 5:122807115-122807137 GTCTCTACAAAAAATTAGCTGGG + Intronic
997262018 5:132472565-132472587 GTCTCTACAAAAAATTAGCTGGG + Intronic
998032203 5:138880304-138880326 GTCTCCACAAAAAATTAGCCAGG - Intronic
999464366 5:151788082-151788104 GTCTCTACAAAAAATTAGCTGGG - Intronic
1001079628 5:168657843-168657865 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1001130903 5:169062629-169062651 GTTTCCACAAAGTGTAAAATAGG - Intronic
1002166941 5:177353688-177353710 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1004759615 6:18652023-18652045 GTCTCTACAAAGAATTAGCCAGG + Intergenic
1004986694 6:21090963-21090985 GTCTCTACAAAAAATTAGCTAGG - Intronic
1005638244 6:27771318-27771340 TTCTCCACAGGGTGTCAGCTGGG + Intergenic
1005757952 6:28942293-28942315 GTCTCCCAAAAGTCTAAGCTGGG - Intergenic
1007515659 6:42409116-42409138 GTCTCTACAAAAAATTAGCTGGG + Intronic
1007654226 6:43442567-43442589 GTCTCCAAAAAAATTTAGCTGGG + Intronic
1010628216 6:78165303-78165325 CTCTCAATAAAGTGTTATCTTGG + Intergenic
1010692761 6:78930094-78930116 GTCTCTACAAAAAATTAGCTGGG - Intronic
1011240320 6:85265281-85265303 ATCTCTACAAAATATTAGCTGGG + Intergenic
1012894925 6:104937292-104937314 GTCTCTACAAAATACTAGCTGGG - Intergenic
1012927302 6:105280729-105280751 GTCTCTACAAATAATTAGCTGGG - Intronic
1013283504 6:108660811-108660833 GTCTCTACATCGTGTTAGCCAGG - Intronic
1014467026 6:121768433-121768455 ATCTCCACTTAGTGTTAGCTTGG + Intergenic
1015115818 6:129648330-129648352 GTCTCTACAAAAAGTTAGCCAGG - Intronic
1016318664 6:142818506-142818528 GTCTCCACAAAAAATTAGCCAGG + Intronic
1016324876 6:142889300-142889322 GTCTCTACAAAATATTAGCTGGG + Intronic
1016637826 6:146315179-146315201 GTCTCTCCAAAAAGTTAGCTGGG + Intronic
1017787053 6:157765203-157765225 TCCTCCACAAAGAGTTAGATGGG + Intronic
1020126856 7:5537860-5537882 GTCTCTACAAAACATTAGCTGGG - Intronic
1020793655 7:12657375-12657397 ATCTCTACAAAGAATTAGCTGGG - Intergenic
1021095825 7:16535026-16535048 GTCTCTACAAAAAATTAGCTAGG + Intronic
1022602183 7:31771883-31771905 GTCTCTACAAAAAATTAGCTGGG + Intronic
1022682848 7:32566335-32566357 ATCTCCACAAAAAATTAGCTGGG - Intronic
1022728472 7:33001372-33001394 GTCTCTACAAAAAATTAGCTGGG + Intronic
1023740521 7:43277216-43277238 GTCTCAACAAAGTGTGAAGTAGG - Intronic
1024157820 7:46643337-46643359 ATCTCCACAAAAAATTAGCTGGG - Intergenic
1025193639 7:56915618-56915640 GTTTCCACACAGTGTAAGGTAGG - Intergenic
1025678304 7:63661323-63661345 GTTTCCACACAGTGTAAGGTAGG + Intergenic
1026989825 7:74578344-74578366 GTCTCTACAAAAAATTAGCTGGG - Intronic
1027980012 7:85206003-85206025 GTCTCTCCAAACTGGTAGCTAGG + Intergenic
1028545385 7:91993347-91993369 GTCTCTACAAAAAATTAGCTGGG - Intronic
1029204247 7:98859349-98859371 GTATCCACCAAGGGTTGGCTGGG + Intronic
1029568029 7:101351947-101351969 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1029669154 7:102017000-102017022 GTGTCCATAAAACGTTAGCTTGG + Intronic
1031001200 7:116417123-116417145 GTCTACACAAAGTCTTACCGGGG - Intronic
1031543564 7:123025649-123025671 TTCTTCACAAAGTCTTAGTTAGG - Intergenic
1032298584 7:130666504-130666526 GTCTCCACTGAGTGTTATATTGG - Intronic
1032412464 7:131706998-131707020 GTCTCTACAAAAACTTAGCTGGG - Intergenic
1033714379 7:143984642-143984664 GTCTCCACTAAAAATTAGCTGGG + Intergenic
1034458205 7:151183239-151183261 ATCTCCACAAAAAATTAGCTGGG + Intronic
1035870894 8:3135082-3135104 GTCTCTACAAAAAATTAGCTGGG - Intronic
1036144618 8:6243512-6243534 GTCTCCACAGAAAATTAGCTGGG + Intergenic
1036615550 8:10384839-10384861 GTCTCCAAAAAAAATTAGCTGGG + Intronic
1037944344 8:22977409-22977431 GTCTCTACAAAACATTAGCTGGG + Intronic
1039615714 8:38953518-38953540 GTCTCCTCCCTGTGTTAGCTTGG - Intronic
1040663105 8:49598166-49598188 GTCTTCCCACAGTGTTGGCTAGG - Intergenic
1041619446 8:59949313-59949335 GTCTCTACAAAAAATTAGCTAGG + Intergenic
1041802114 8:61811866-61811888 CTCTCCACAAAGGGTGAGCTGGG - Intergenic
1042532383 8:69829515-69829537 ATCTCCACAAAAAATTAGCTGGG + Intronic
1044255583 8:90056725-90056747 GTCTCTACAAAAAGTTAGCTAGG - Intergenic
1044976100 8:97667151-97667173 GTCTCTACAAAAAATTAGCTGGG - Intronic
1045018067 8:98016210-98016232 GTCTCCACAAAAAATTAGCCTGG + Intronic
1045204782 8:100027058-100027080 GTCTCTACAAAACATTAGCTGGG + Intronic
1047742077 8:127814553-127814575 GTCCCCTCAAAGGGTTTGCTAGG - Intergenic
1049303541 8:141884598-141884620 GACTCCCCTAATTGTTAGCTGGG + Intergenic
1050347020 9:4700314-4700336 GTCTCTACAAAAAATTAGCTGGG - Intronic
1051238045 9:15022699-15022721 GTCTCTACAAAATATTAGCCAGG + Intergenic
1053032975 9:34798054-34798076 GTGACCACAAAGGGTTAGCATGG + Intergenic
1054121627 9:61214076-61214098 TTCTTCTCCAAGTGTTAGCTAGG + Intergenic
1057411891 9:94823846-94823868 GCTTCCACAAAGTGATAGCTTGG - Intronic
1058398247 9:104581237-104581259 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1060705794 9:125799342-125799364 GTCTCTACAAAATGTTATCTGGG + Intronic
1061167776 9:128934131-128934153 GACTTCTCAAAGTGTTAGTTAGG - Intronic
1061562313 9:131413534-131413556 GTCTCCACTAAAAATTAGCTGGG - Intronic
1061616943 9:131786624-131786646 ATCTCCACAAAAAATTAGCTAGG - Intergenic
1185952080 X:4448639-4448661 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1186108700 X:6232550-6232572 GTCTCCAGATATTGTTAACTTGG - Intergenic
1186291599 X:8105947-8105969 GTCTCCCTGAAGTGTTAGGTTGG + Intergenic
1186371780 X:8954417-8954439 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1187244408 X:17540909-17540931 GTCTCTACAAAAAATTAGCTGGG + Intronic
1188324948 X:28790131-28790153 GACTCCACATAGTGTGAGCATGG - Intronic
1188536462 X:31202022-31202044 GTCTCCACAAAAAATTAGCCAGG + Intronic
1189728124 X:43989304-43989326 TTCTTCACAAACTGATAGCTGGG + Intergenic
1189728473 X:43993626-43993648 TTCTTCACAAACTGATAGCTGGG - Intergenic
1189807811 X:44752849-44752871 GTCTCTACAAAAAGTTAGCTGGG + Intergenic
1190051276 X:47151197-47151219 GTCTCTACAAAAAATTAGCTGGG - Intronic
1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG + Intronic
1192541566 X:71977579-71977601 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1194880203 X:99241637-99241659 GTTTCCCCAAAGTGTTATCTTGG + Intergenic
1195196402 X:102501539-102501561 GTCTCCACAAAAAATTAGCTGGG - Intergenic
1195294762 X:103464884-103464906 TTCTCTACAAAGTGTAAGCAAGG - Intergenic
1198119689 X:133579702-133579724 GTCTCTACAAAAAATTAGCTGGG - Intronic
1198477473 X:137009403-137009425 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1199204980 X:145138002-145138024 ATCTCCACATAGTGTCAACTGGG - Intergenic
1201738770 Y:17301162-17301184 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1202604757 Y:26629295-26629317 GTCTCTACAAAAAATTAGCTGGG + Intergenic