ID: 963895813

View in Genome Browser
Species Human (GRCh38)
Location 3:150683943-150683965
Sequence CCCCCAAGACGTCCCTGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 92}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963895813_963895815 -10 Left 963895813 3:150683943-150683965 CCAGTTCAGGGACGTCTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 963895815 3:150683956-150683978 GTCTTGGGGGAGAAGCCGCAAGG 0: 1
1: 0
2: 1
3: 15
4: 140
963895813_963895825 28 Left 963895813 3:150683943-150683965 CCAGTTCAGGGACGTCTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 963895825 3:150683994-150684016 GACCCATCTCTGGGTGTTGCGGG 0: 1
1: 0
2: 1
3: 12
4: 142
963895813_963895821 18 Left 963895813 3:150683943-150683965 CCAGTTCAGGGACGTCTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 963895821 3:150683984-150684006 CCCATGGTAAGACCCATCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 94
963895813_963895816 2 Left 963895813 3:150683943-150683965 CCAGTTCAGGGACGTCTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 963895816 3:150683968-150683990 AAGCCGCAAGGCCTTCCCCATGG 0: 1
1: 0
2: 0
3: 9
4: 126
963895813_963895823 19 Left 963895813 3:150683943-150683965 CCAGTTCAGGGACGTCTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 963895823 3:150683985-150684007 CCATGGTAAGACCCATCTCTGGG 0: 1
1: 0
2: 0
3: 7
4: 104
963895813_963895824 27 Left 963895813 3:150683943-150683965 CCAGTTCAGGGACGTCTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 92
Right 963895824 3:150683993-150684015 AGACCCATCTCTGGGTGTTGCGG 0: 1
1: 0
2: 0
3: 23
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963895813 Original CRISPR CCCCCAAGACGTCCCTGAAC TGG (reversed) Intronic
902649322 1:17826348-17826370 CCCCCATCAGCTCCCTGAACAGG - Exonic
904309152 1:29614601-29614623 CAACCAAGATGTCCCTCAACAGG - Intergenic
904893777 1:33798927-33798949 CCCACAAGACTGCCCTGAGCTGG - Intronic
905500418 1:38432150-38432172 CCCCCAACCCTTCCCTGACCAGG + Intergenic
907181364 1:52573138-52573160 CCCCCAAGACAGCCTGGAACTGG - Intergenic
914918841 1:151834167-151834189 CCCCCAGGCCCTCCCTGAAAGGG - Intergenic
919958103 1:202438927-202438949 CCCCGAAGACGGCCGTGGACTGG + Intronic
1068254135 10:54486277-54486299 CTCCCAAGACTTTCCTTAACAGG + Intronic
1069328798 10:67265332-67265354 TCCCCAAGACTTCCCTAAAATGG + Intronic
1069630646 10:69895204-69895226 CCCACCAGACAGCCCTGAACAGG - Intronic
1070943983 10:80372965-80372987 GCAGCAAAACGTCCCTGAACAGG - Intergenic
1074643571 10:115417659-115417681 CTCCCAGGAGGTCTCTGAACAGG - Intronic
1076266082 10:129110824-129110846 TCCCCAATACTTCCCTTAACAGG + Intergenic
1076687759 10:132205796-132205818 CCCCCACGCCGTCTCTGCACAGG + Intergenic
1076691961 10:132228364-132228386 CCCCCCAGAGGTTCCTGTACTGG + Intronic
1076747391 10:132521311-132521333 GCCCCCAGACCTCCCTGAAAGGG + Intergenic
1077601990 11:3580713-3580735 CTCCCACGACGTCCCTGGCCGGG - Intergenic
1078020564 11:7653164-7653186 CCCCCTTGATGCCCCTGAACTGG + Exonic
1079102144 11:17548209-17548231 CTCCCAAGACCTCCCTTACCTGG - Exonic
1083423127 11:62567435-62567457 CGCCCAAGACAGCCCGGAACTGG + Exonic
1087684252 11:101245331-101245353 CACCCATGACGTGCCTGTACTGG + Intergenic
1089279314 11:117361856-117361878 CCCCCAAGAGGAACATGAACTGG - Exonic
1089432765 11:118436893-118436915 CCCCAAACACGGCCCGGAACCGG - Exonic
1092122662 12:6055491-6055513 TCCCCAAGACATCCCAGAGCTGG + Intronic
1092428132 12:8390056-8390078 CTCCCACGACGTCCCTGGCCGGG - Intergenic
1099906952 12:88782768-88782790 CCACAAAGTCTTCCCTGAACTGG + Intergenic
1102020014 12:109675800-109675822 CCCCCAAGGGGTCCCTGACTTGG - Intergenic
1104811995 12:131624935-131624957 CCCCCAGGAACTCCCAGAACCGG + Intergenic
1109802411 13:67397955-67397977 CACCCATGACGTGCCTGTACCGG + Intergenic
1111742907 13:92226948-92226970 ACCCCAGAAAGTCCCTGAACTGG + Intronic
1113783325 13:112988846-112988868 CGCCCAAGTCCTCCCTGAGCAGG + Intronic
1113783367 13:112989031-112989053 CGCCCAAGTCCTCCCTGAGCAGG + Intronic
1122068458 14:99189840-99189862 CCCCCAAGATGACCCTTATCGGG + Intronic
1122946668 14:105014155-105014177 CCCCCAAGATCTCCCTGCGCAGG - Intronic
1122998647 14:105279796-105279818 CACCCTAGACGTCCATCAACAGG + Intronic
1126584724 15:50272627-50272649 CCCCCAAAATGGCCATGAACTGG + Intergenic
1128365101 15:66994119-66994141 CTCCCAAGGCACCCCTGAACTGG + Intergenic
1129746193 15:78023237-78023259 GCCCCAAGGCGTCCCTCACCTGG - Intronic
1131947757 15:97646042-97646064 CCCCCCAAATGTCCATGAACAGG + Intergenic
1133370100 16:5240314-5240336 CTCCCACGACGTCCCTGGCCAGG + Intergenic
1136540685 16:30926213-30926235 CCCCCAAGATGTCTCTGTGCAGG + Intronic
1143706389 17:8700550-8700572 CCCCCAAGACCTTCCAGAAGAGG + Intergenic
1148944174 17:51244389-51244411 CCACAATGATGTCCCTGAACTGG + Intronic
1151560093 17:74865373-74865395 CCTCCAGGACTTCCCTGAATTGG - Intronic
1151960289 17:77402236-77402258 CCCCCAAGGCGTCCCTGCGGAGG + Exonic
1159783793 18:72690921-72690943 CCCCCAAAAAGACCCTGAATTGG + Intergenic
1163991540 19:21003165-21003187 CACCCACGACGTGCCTGTACCGG + Intergenic
1165061902 19:33208956-33208978 CCCCCAGGACGCCCCCGAAGAGG - Exonic
1167156614 19:47742844-47742866 CGCCCACGACATCCCTGAAAAGG - Exonic
925969706 2:9097760-9097782 CCCCCAAGACTTGCCTGCAGGGG + Intergenic
928757829 2:34547268-34547290 CTCCCAAGAAGTCTCTGCACTGG + Intergenic
931238478 2:60432153-60432175 CCCCCAAACAGCCCCTGAACTGG + Intergenic
932095731 2:68846796-68846818 CCCCAAAGCAGTCCCAGAACCGG + Intergenic
933942980 2:87260516-87260538 CCCCTCAGCCCTCCCTGAACAGG - Intergenic
936337233 2:111601046-111601068 CCCCTCAGCCCTCCCTGAACAGG + Intergenic
937060618 2:118977932-118977954 CCCCCAATACGGCCCTCACCTGG - Exonic
943828790 2:192431118-192431140 CTCCCAAGATTTCCCTTAACTGG + Intergenic
1169020531 20:2327727-2327749 CCAGGAAGACTTCCCTGAACAGG - Intronic
1172221978 20:33280400-33280422 CCCCTAAGTGGTCCCTGAAAAGG + Intronic
1172618768 20:36306606-36306628 CCCGACAGACCTCCCTGAACCGG + Intronic
1173013636 20:39205135-39205157 CCCCCTAGAGATCTCTGAACAGG - Intergenic
1179063413 21:38001449-38001471 CCATCAAAACGTCCCTCAACAGG - Intronic
1183442136 22:37829272-37829294 CACCCAAGTGGTCCCTGAGCTGG - Intergenic
1184606264 22:45576461-45576483 CCCCCAAGACAGCCCAGAGCTGG + Intronic
950450713 3:13063585-13063607 CCCCCAATGCCTCCCAGAACCGG - Intronic
951166575 3:19489886-19489908 CACCCACGACGTGCCTGTACTGG - Intronic
957072828 3:75579747-75579769 CTCCCACGACGTCCCTGGCCGGG - Intergenic
961165970 3:124764163-124764185 CCCCCATGACCTTCCTGACCTGG + Intronic
961281243 3:125767010-125767032 CTCCCACGACGTCCCTGGCCGGG + Intergenic
961675583 3:128563592-128563614 CCAACATGACGTCACTGAACAGG + Intergenic
961873132 3:130002575-130002597 CTCCCACGACGTCCCTGGCCGGG - Intergenic
963895813 3:150683943-150683965 CCCCCAAGACGTCCCTGAACTGG - Intronic
967270635 3:187729430-187729452 CCCCCAATGCACCCCTGAACCGG - Exonic
968467669 4:760663-760685 CCCCCAAGATGTGCCTGACAAGG - Intronic
969475987 4:7422681-7422703 CCTCCAGGATGTCCCGGAACAGG + Intronic
969737515 4:9001267-9001289 CTCCCACGACGTCCCTGGCCTGG + Intergenic
972216838 4:36906974-36906996 CACCCACGACGTGCCTGTACCGG + Intergenic
979663131 4:123281682-123281704 CCACCAAGATGTCCTTCAACAGG + Intronic
980072738 4:128260790-128260812 CACCCATGACGTGCCTGTACCGG + Intergenic
1006830086 6:36963355-36963377 ACCCCAAGATGTCCCTGACAGGG + Exonic
1013428118 6:110033332-110033354 CCCCCCAGGCCTCCCTGACCAGG + Intergenic
1016246266 6:141984870-141984892 TCCCCAAGATCTCCCTAAACAGG + Intergenic
1018235695 6:161721634-161721656 CACCAAAGAGGGCCCTGAACAGG - Intronic
1032401693 7:131628732-131628754 ACCCCAAGAAGGCCCTGAACTGG - Intergenic
1032574215 7:133035305-133035327 CCCCCAAGACAGCCCGGAACTGG + Intronic
1040793562 8:51263696-51263718 CCCCCAAGATGACCCTCAATAGG - Intergenic
1045689583 8:104746634-104746656 TCCCCAAGAAGTCCCTGTAGGGG - Intronic
1049806307 8:144542228-144542250 TCCCCAGGACCTCCCTCAACAGG - Intronic
1052798029 9:32942009-32942031 CACACAAGATGTCCCTGGACAGG + Intergenic
1057512585 9:95693095-95693117 CCCCCAAAATGCACCTGAACTGG - Intergenic
1059433609 9:114264074-114264096 CCCCCAAGGTCTCTCTGAACAGG + Intronic
1203485595 Un_GL000224v1:51110-51132 CCACCATCACGTCCCTGTACAGG - Intergenic
1189273797 X:39770388-39770410 CCCACAAGACCTTCCTGACCTGG + Intergenic
1190426433 X:50337915-50337937 CACCCATGACGTGCCTGCACTGG - Intronic
1198763083 X:140053988-140054010 CTCCCAAGAAGCCCCTGCACGGG - Intergenic