ID: 963901472

View in Genome Browser
Species Human (GRCh38)
Location 3:150737095-150737117
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963901467_963901472 1 Left 963901467 3:150737071-150737093 CCAAATAAGAATAATGATGGATC No data
Right 963901472 3:150737095-150737117 CGTGATATGGTGAAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr