ID: 963902483

View in Genome Browser
Species Human (GRCh38)
Location 3:150745853-150745875
Sequence TTCTGTGTGCTCTAGGATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963902483_963902486 -9 Left 963902483 3:150745853-150745875 CCTCTATCCTAGAGCACACAGAA 0: 1
1: 0
2: 1
3: 20
4: 180
Right 963902486 3:150745867-150745889 CACACAGAAGGAATCAGCTGTGG 0: 1
1: 0
2: 1
3: 46
4: 307
963902483_963902487 6 Left 963902483 3:150745853-150745875 CCTCTATCCTAGAGCACACAGAA 0: 1
1: 0
2: 1
3: 20
4: 180
Right 963902487 3:150745882-150745904 AGCTGTGGATCCTGCCCTTGTGG 0: 1
1: 1
2: 3
3: 38
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963902483 Original CRISPR TTCTGTGTGCTCTAGGATAG AGG (reversed) Intronic
900927567 1:5715810-5715832 TTCTGGGGGCTCTAGGAGTGGGG + Intergenic
903684201 1:25119177-25119199 TTCTTTGTGCTCTTGGTTCGTGG + Intergenic
903882210 1:26518726-26518748 GTCTCTGCCCTCTAGGATAGAGG - Intergenic
907947861 1:59152071-59152093 TTATGTTTGCTCTAGGGCAGTGG + Intergenic
908452675 1:64271558-64271580 TTCTGGGTGGGCTAGGACAGGGG + Intergenic
909655353 1:78025752-78025774 ATCTGTGTGATCTGGGATAGAGG - Intronic
909690918 1:78407299-78407321 TTCTGAGGGCTCTTGGATATGGG + Intronic
910168933 1:84357581-84357603 TTCTGTAAGCCCTTGGATAGTGG + Intronic
912226542 1:107740715-107740737 TTATTTGTGCTGTAGGACAGGGG + Intronic
915918874 1:159959417-159959439 TCCTGGGTGCTGTACGATAGGGG - Intergenic
916812254 1:168315770-168315792 TTCTGTCTGCTCCAGGCTAGGGG - Intergenic
916836108 1:168546989-168547011 ATCTGTGTGCTCCTGGATTGGGG - Intergenic
916866070 1:168860291-168860313 TTCTTTATCCTCTAAGATAGTGG + Intergenic
918485817 1:185027299-185027321 TTCTGGGTGCTGTAGGACAGTGG + Intergenic
918913721 1:190607884-190607906 TTCTGTGTGCTTTAAGCTAAGGG - Intergenic
922439076 1:225637148-225637170 TTCTGTGTGCTCCAGGGTGCAGG + Intronic
923456069 1:234166697-234166719 TTCTGTCTGACCTAGGTTAGAGG - Intronic
1063184639 10:3639610-3639632 TGCTGTGTGATCTGGGACAGTGG - Intergenic
1068155849 10:53197574-53197596 TTATGTATGCTATAGGATAAGGG + Intergenic
1068501189 10:57841306-57841328 ATTTGTTTCCTCTAGGATAGAGG + Intergenic
1071112520 10:82176525-82176547 TTCAGTGTGCTCTGTGACAGAGG - Intronic
1071181122 10:82984768-82984790 TACTTTGTATTCTAGGATAGAGG + Intronic
1072363936 10:94689877-94689899 TTCTGTGGGCTCTGGGATATAGG - Intronic
1073693473 10:105837683-105837705 TTCAGTTTGCTATAGGATATTGG - Intergenic
1074491617 10:113944179-113944201 TTCTCAGGGCTCTAGGAGAGAGG - Intergenic
1074747879 10:116553484-116553506 TTCTGTGTACTCTAGGCAACTGG - Intronic
1075416149 10:122265852-122265874 TTCAGTGGGCTCTGGGATATAGG + Intergenic
1078496495 11:11822766-11822788 TTCTGTGTGTTATAGGATTTTGG + Intergenic
1078897635 11:15611534-15611556 GTCTGTGTGCTCTGGGATGCAGG + Intergenic
1079017356 11:16880537-16880559 TTCAGCCTGCTCTAGGACAGAGG + Intronic
1080695698 11:34601238-34601260 GTCAGTGTGCTCAAGGAAAGAGG + Intergenic
1087002519 11:93435093-93435115 TTCTGTGAGCCCTAAGATAGTGG + Intronic
1087376031 11:97341752-97341774 TTCTGTGTGCCCCAGGAAATTGG + Intergenic
1088483357 11:110317608-110317630 TTCTGTGAACTCTAAGATAATGG + Intergenic
1089718144 11:120383794-120383816 CACTGTGTACTCTAGGACAGGGG - Intronic
1095561283 12:43569221-43569243 TTCTGTGTGATCTCTGCTAGCGG - Intergenic
1095646155 12:44550209-44550231 TTCTGTATGCTTTAAGATAAGGG - Intronic
1096438150 12:51613057-51613079 ATCTGTGTTCACTAGGATATTGG + Intronic
1097239765 12:57567262-57567284 TTCTGTGTCCTCTGGGGTGGAGG + Intronic
1098858460 12:75681014-75681036 TTCTGAGTGTTCTAGAACAGAGG + Intergenic
1099414483 12:82370279-82370301 ATCTGTTTCCTCTAGGATCGAGG - Intronic
1100030682 12:90186515-90186537 TTCTGTGTGATATAGAATAGAGG - Intergenic
1101976756 12:109366154-109366176 ATCTGGGTGGTCTAGGACAGCGG - Intronic
1102260962 12:111443046-111443068 TTCTGTGTGCTGAGGGACAGGGG - Intronic
1104302044 12:127573068-127573090 TACTGTGTGGTCTAAGATACAGG + Intergenic
1104418824 12:128618114-128618136 TGGTGTGTGCTCTAGGACACAGG - Intronic
1106609504 13:31264968-31264990 TTCTGTGTACTATAGGCTAGAGG - Intronic
1106755397 13:32817986-32818008 TTGTGTGTGTTGTAAGATAGAGG - Intergenic
1107138209 13:36967981-36968003 TTTTGTTTGCTTTAGGATAATGG + Intronic
1108151017 13:47534455-47534477 ATCTGGGTGCTCTTGAATAGGGG + Intergenic
1109590074 13:64467386-64467408 TTCTGTTTGCCTTAAGATAGAGG - Intergenic
1116007937 14:39316671-39316693 TTCTGTATGCTTTAGTATTGAGG + Intronic
1116603006 14:46951650-46951672 TTCTTTGTGTTGTATGATAGAGG - Intronic
1116749773 14:48868770-48868792 TTCCTTGTGCTATAGGATTGAGG + Intergenic
1116812026 14:49548417-49548439 TTCAATGGGCTCCAGGATAGGGG + Intergenic
1119373994 14:74173930-74173952 TCCTTTGTGCTTCAGGATAGAGG + Intronic
1120751182 14:88199670-88199692 TTCTGGGTACTCTTGGATACTGG - Intronic
1121157718 14:91702164-91702186 TTCTGTGAGCCATAGGAGAGCGG - Intronic
1124175808 15:27422959-27422981 TCCTGTGTGGCCCAGGATAGGGG - Intronic
1125160782 15:36641166-36641188 TTCTGTGTTCTCTAGTAAGGTGG - Intronic
1125455356 15:39853609-39853631 TTCTTTCTCCTCTAGAATAGTGG + Intronic
1129261695 15:74372148-74372170 TTCTGTGTCCTGGAGGAAAGGGG + Intergenic
1129306460 15:74667830-74667852 TGCTGTGTCCTCAAGGAGAGGGG + Intronic
1130397419 15:83515025-83515047 TTCTGGAGGCTCTAGGAGAGAGG - Intronic
1134182238 16:12057137-12057159 TTATATGTGCTCTATGATACCGG + Intronic
1137872637 16:51965202-51965224 TTCCATGTGCTCAAGTATAGAGG + Intergenic
1139901830 16:70334132-70334154 TGCTGTGGGCACTAGGACAGGGG - Exonic
1141513553 16:84527974-84527996 TTCTCTGTGATCTAGGGCAGTGG - Intronic
1151481241 17:74371094-74371116 TTCTGTGTCCTCCAGAATGGAGG - Intronic
1153199700 18:2635551-2635573 TTCTCTTTGCCCCAGGATAGAGG - Intergenic
1158424243 18:57324784-57324806 TTCTGTGTCCTGTTGGAAAGGGG - Intergenic
1160088050 18:75798001-75798023 TTCTGTCTTCTTTAGGATAGAGG - Intergenic
1162497732 19:11032850-11032872 TTCTGTGTGCACTGTGAGAGTGG + Intronic
1163848404 19:19650238-19650260 TTCTGTGTGTTTCAGGTTAGGGG - Intronic
1164852044 19:31492131-31492153 TTCTATGTGTTCTCAGATAGTGG + Intergenic
1168366803 19:55795198-55795220 CTCTGTCTGCTCTGGGAAAGTGG - Intronic
929512471 2:42575350-42575372 TTCTGAGTGCCTTAGAATAGTGG + Intronic
933105058 2:78314080-78314102 TTCTGTGTGGTGTAAGATAGAGG - Intergenic
933373892 2:81453821-81453843 TTCTGTGTGCTCTTTGAATGTGG - Intergenic
933493815 2:83021937-83021959 TTCTGTGTTTTCTGGGAAAGTGG + Intergenic
936153712 2:110035319-110035341 TTCTGTGTGCCCAAGGAGAGAGG - Intergenic
936190973 2:110336096-110336118 TTCTGTGTGCCCAAGGAGAGAGG + Intergenic
936638371 2:114285001-114285023 TTCTGTGTCCTATCAGATAGAGG - Intergenic
938798119 2:134735641-134735663 TTCAGTGGGCTCTAGGTTACAGG + Intergenic
939790927 2:146575815-146575837 TTTTGTGTCCTTTATGATAGTGG + Intergenic
940129011 2:150360278-150360300 TTCTTTCTGCTCAAGGATAGTGG + Intergenic
945333248 2:208562931-208562953 TTCTGTGTTCTGGAGGATGGTGG + Intronic
946183641 2:217964582-217964604 TCCTGTGTGTGCTAGGATATAGG + Intronic
946756853 2:222956053-222956075 TTCTGTGTGTTCTAAGATTGAGG - Intergenic
1170636113 20:18106083-18106105 TTCAGTGGGCTCTAGGCTACAGG + Intergenic
1170893129 20:20392539-20392561 TTCTGAGTGTTCTAAGATAGGGG + Intronic
1172929873 20:38578864-38578886 TTGTGTGTGCTTTTGGATACAGG + Intergenic
1174357430 20:50008036-50008058 GTCCCTGTGCTCAAGGATAGGGG + Intergenic
1174579817 20:51563383-51563405 TTTTGTGTGTTCAAGGATGGTGG + Intergenic
1177461111 21:21412113-21412135 TTCTGAGTTCTGGAGGATAGAGG + Intronic
1179068937 21:38053769-38053791 TTCTGTGTGGGCTAGGAGAGAGG - Intronic
1181437291 22:22918263-22918285 TTCTGTTCTCTCTAGGGTAGAGG + Intergenic
1185202044 22:49513517-49513539 TTCTGTGACCTCTAGCATAATGG - Intronic
949456967 3:4249147-4249169 TTCTGTGTTCTCTAGCAGAGTGG + Intronic
949607633 3:5671838-5671860 TTCTGTGTGACCTAGAACAGGGG + Intergenic
949994282 3:9603867-9603889 TGCTGTGTGTTCTAGGTCAGTGG + Intergenic
952462600 3:33544477-33544499 ATTTGTGTGCATTAGGATAGTGG - Intronic
955991063 3:64627768-64627790 TTCTGTGTATTCTAGGAGGGAGG - Intronic
956370115 3:68549921-68549943 TTCTATTAGCTTTAGGATAGGGG - Intergenic
956393543 3:68800266-68800288 TTCTGGATGCTCTAGGGCAGTGG - Intronic
956466486 3:69525262-69525284 TCCTGTGTGCTCTGAGAAAGGGG - Intronic
958634837 3:96730575-96730597 TTCTGTGAACTCTCAGATAGTGG + Intergenic
959826311 3:110800954-110800976 TTGTGTGTGGTATAAGATAGGGG + Intergenic
960396156 3:117139847-117139869 CACTGTGTCCTCTAGAATAGGGG - Intergenic
963639445 3:147840188-147840210 TTCTGTGTGGACTAGGAAAGTGG - Intergenic
963902483 3:150745853-150745875 TTCTGTGTGCTCTAGGATAGAGG - Intronic
964425602 3:156550507-156550529 TTCTGAGAGCTCTAAGACAGAGG - Intronic
966649301 3:182281474-182281496 TTTTGTGTGCTCTAGAATACAGG + Intergenic
968056312 3:195694643-195694665 GTCTATGTGCTCAAGGACAGTGG + Intergenic
968056324 3:195694712-195694734 GTCTATGTGCTCAAGGACAGTGG + Intergenic
968056349 3:195694850-195694872 GTCTATGTGCTCAAGGACAGTGG + Intergenic
971217032 4:24671387-24671409 TGCTGTGTCCTCAAGGACAGGGG - Intergenic
974750522 4:66134648-66134670 TTCTGTGTGTTCTCACATAGTGG + Intergenic
982698114 4:158627611-158627633 TCCTGTGTAGTCTAGGATAATGG - Intronic
982923446 4:161304979-161305001 TTCTGGGTTCTCGAGGATGGTGG - Intergenic
983084617 4:163427862-163427884 ATTTGTGTCCTCTAGGATCGAGG + Intergenic
983393951 4:167169219-167169241 TTCTGGGTTCTGGAGGATAGTGG - Intronic
984219440 4:176955285-176955307 TTCTGGGTTCTGGAGGATAGTGG + Intergenic
986275971 5:6275217-6275239 TTCTTTGTGGTGTAGGATGGAGG - Intergenic
987888628 5:23845619-23845641 TTCTGTGTTCTATAGCACAGTGG + Intergenic
989127764 5:38073712-38073734 TTCTGTGTGCTCTGAGGTACAGG + Intergenic
990289396 5:54333334-54333356 TTCTATGTGATTTAAGATAGGGG - Intergenic
990605259 5:57403423-57403445 ATCTGTGTGAGCTAGGACAGGGG - Intergenic
991311142 5:65243683-65243705 TTCAGAGTGCTCTAGGTTAAAGG + Intronic
994720590 5:103375605-103375627 TTTTGTGTGCTCTGGGTTACTGG - Intergenic
997283062 5:132660552-132660574 TACAGTGTGCTCTAGGGCAGGGG - Exonic
1000244392 5:159437209-159437231 TTCTGTGTGCTCATGGTAAGTGG + Intergenic
1002655720 5:180745133-180745155 CTCTGTGAGCTCTAGGGTGGTGG - Intergenic
1002682120 5:180974382-180974404 TTGTGTGTGGTGTAAGATAGGGG - Intergenic
1002703091 5:181141052-181141074 TTCTGTGGGCTCTGGGACATAGG - Intergenic
1003023270 6:2530459-2530481 TTCTGTGAGCCCCTGGATAGTGG - Intergenic
1003771711 6:9311692-9311714 TTCTTTTTACTTTAGGATAGAGG + Intergenic
1004553958 6:16677263-16677285 TTACGTGTGCTCTGGGAGAGGGG + Intronic
1006317909 6:33301225-33301247 TTCTTGGAGCTCTAGGACAGTGG - Intronic
1009697445 6:67125621-67125643 TTCTGTGTGCTGTAGGATTGAGG + Intergenic
1013159428 6:107527406-107527428 TTCTTTGTATTCAAGGATAGTGG + Intronic
1013228733 6:108141871-108141893 GTCTGTGTGTTATATGATAGAGG - Intronic
1013249297 6:108318179-108318201 CTCTGTGTGCCCAAGGAAAGTGG + Intronic
1013771024 6:113628446-113628468 TTTTGTGTGATCTAGTATACTGG - Intergenic
1015852955 6:137593430-137593452 TTCTGGGTTCTGGAGGATAGCGG + Intergenic
1016606760 6:145937776-145937798 TTCTGTTTCCTCTACAATAGAGG + Intronic
1016705474 6:147102043-147102065 TTGTGTGTTCTCAAGAATAGAGG + Intergenic
1017256503 6:152339591-152339613 TTCTGTATGGTCTGGGAAAGGGG + Intronic
1019850359 7:3549520-3549542 TTCAGTGTGAAGTAGGATAGAGG + Intronic
1020791071 7:12628691-12628713 TTCCCTGTGCTTTAAGATAGCGG - Intronic
1021914412 7:25417244-25417266 TTCTGTGTCTTCTAGGAGTGGGG - Intergenic
1023876242 7:44287789-44287811 TTCTGTGTGAGCTGGGAAAGCGG - Intronic
1026874869 7:73873484-73873506 TTCTCAGTCTTCTAGGATAGGGG + Intergenic
1027814212 7:82948802-82948824 TTCTGTGAGCACTAGGATTAAGG + Intronic
1028655631 7:93203255-93203277 TCTTGTGTGTTCTGGGATAGAGG - Intronic
1030336085 7:108328207-108328229 TTTTGTGTGCTATTGGTTAGTGG - Intronic
1030424983 7:109364878-109364900 TTCTTTGTTCTTGAGGATAGAGG + Intergenic
1030702214 7:112653529-112653551 TTTTGTGTGATATAAGATAGAGG - Intergenic
1032592227 7:133202230-133202252 TTCTGTGGGCTGTAGGACACAGG - Intergenic
1033995066 7:147335502-147335524 TTTTGTTTTCTCTATGATAGTGG - Intronic
1034316581 7:150138725-150138747 GTGTGTGTGCTCTAGCACAGGGG + Intergenic
1034484819 7:151353063-151353085 TACTGTCTGTTCTATGATAGTGG + Intronic
1034790279 7:153961949-153961971 GTGTGTGTGCTCTAGCACAGGGG - Intronic
1036285474 8:7441331-7441353 TCCTGTGTGCTCCTGGAGAGAGG + Intergenic
1036336000 8:7870198-7870220 TCCTGTGTGCTCCTGGAGAGAGG - Intergenic
1037725926 8:21482667-21482689 TTGTGTGTTCTCTGGGAGAGGGG - Intergenic
1038292151 8:26259576-26259598 TTCTGTGAGCTCTGAGACAGTGG - Intergenic
1038904948 8:31890214-31890236 TTCTATTTTCTCTAGGATAATGG - Intronic
1040522187 8:48187671-48187693 TTGTGTGAGGTCTAGCATAGAGG - Intergenic
1042173801 8:66018991-66019013 TTCTGTGTGCTCCAGGTGTGAGG + Intergenic
1042785835 8:72546018-72546040 TTCTGTGAGTTCTTGGATATTGG + Intronic
1045067262 8:98460014-98460036 TTCTGTGTTCTGGAGGAGAGTGG - Intronic
1045073634 8:98538820-98538842 TTCTGTGTGCTCTTGGTCCGTGG - Intronic
1045535192 8:103021084-103021106 TTCTGTGTTCGCTTGGGTAGAGG + Exonic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1046285957 8:112092824-112092846 TTTTGCATGCCCTAGGATAGGGG - Intergenic
1048457196 8:134589101-134589123 TTCTGTGTGCTCTTGTATTTTGG + Intronic
1053461151 9:38272501-38272523 TTCTTTGTGCTCTACCAAAGGGG - Intergenic
1055753355 9:79531178-79531200 TTCTGTGACCTCAAGGATACAGG - Intergenic
1057021615 9:91702627-91702649 TTGTGTGTGATGTAAGATAGGGG + Intronic
1057301903 9:93891426-93891448 TTCAGTGGGCTCTAGGGTACAGG + Intergenic
1059649029 9:116297256-116297278 ATGTGTATTCTCTAGGATAGTGG - Intronic
1061852371 9:133423739-133423761 TTCTTTGTGGTCTAGGCCAGAGG + Intronic
1062307237 9:135914919-135914941 TTCTGGAGGCTCTAGGGTAGGGG - Intergenic
1062350126 9:136134416-136134438 TTCTGTGAGCTCTAGGAGACAGG + Intergenic
1187378589 X:18779822-18779844 ATCAGTTTGCTCTAGGACAGTGG + Intronic
1191044634 X:56122530-56122552 TTTTTTCTGCTCTATGATAGTGG + Intergenic
1191605463 X:63057673-63057695 TTCTGTCTGCTCTTGAGTAGGGG - Intergenic
1192202180 X:69073412-69073434 TGCTGTGTCCTCCAGGCTAGTGG + Intergenic
1192335653 X:70217185-70217207 TTCTGTGGGCTGGAGGATGGTGG - Intergenic
1193139917 X:78016920-78016942 TTCTGTGGTCTGGAGGATAGTGG + Intronic
1194527766 X:94999108-94999130 TTGTGTGTGGTCTAAGATAGAGG + Intergenic
1194657578 X:96592012-96592034 AACTGTGTCCTCTAGGACAGCGG + Intergenic
1194982361 X:100453472-100453494 TTCTGGGTTCTCGAGGATGGTGG - Intergenic
1198297251 X:135299788-135299810 TTGTGTATGATCTAAGATAGAGG + Intronic
1198794933 X:140384678-140384700 ATCTGAGGGCTCTAGGATAAGGG - Intergenic
1199461540 X:148090875-148090897 TTTTGATTGCTCTAGAATAGGGG - Intergenic
1199466636 X:148145236-148145258 TTCTAAGTACTCTAGGACAGTGG - Intergenic
1199871724 X:151904401-151904423 GTCTGTGTGCTCTCTGATGGTGG - Intergenic
1199895992 X:152128235-152128257 GTGTGTGTGTTCTAGGATGGTGG + Intergenic
1200271184 X:154685882-154685904 TTGTGTGTGCTGTGAGATAGGGG - Intronic
1200342136 X:155409004-155409026 TTCTGGGTGCTGGAGGATGGTGG - Intergenic