ID: 963904399

View in Genome Browser
Species Human (GRCh38)
Location 3:150762389-150762411
Sequence GTACCTCCGCCGGTGACCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963904399_963904409 14 Left 963904399 3:150762389-150762411 CCTGAGGTCACCGGCGGAGGTAC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 963904409 3:150762426-150762448 GGCTTACCTTACAGGGAAACAGG 0: 1
1: 0
2: 0
3: 10
4: 142
963904399_963904403 -8 Left 963904399 3:150762389-150762411 CCTGAGGTCACCGGCGGAGGTAC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 963904403 3:150762404-150762426 GGAGGTACGTGGGCTGTCCCTGG 0: 1
1: 0
2: 1
3: 20
4: 150
963904399_963904411 24 Left 963904399 3:150762389-150762411 CCTGAGGTCACCGGCGGAGGTAC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 963904411 3:150762436-150762458 ACAGGGAAACAGGACTGCCGAGG 0: 1
1: 0
2: 1
3: 6
4: 140
963904399_963904404 -7 Left 963904399 3:150762389-150762411 CCTGAGGTCACCGGCGGAGGTAC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 963904404 3:150762405-150762427 GAGGTACGTGGGCTGTCCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 112
963904399_963904406 7 Left 963904399 3:150762389-150762411 CCTGAGGTCACCGGCGGAGGTAC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 963904406 3:150762419-150762441 GTCCCTGGGCTTACCTTACAGGG 0: 1
1: 0
2: 0
3: 2
4: 107
963904399_963904405 6 Left 963904399 3:150762389-150762411 CCTGAGGTCACCGGCGGAGGTAC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 963904405 3:150762418-150762440 TGTCCCTGGGCTTACCTTACAGG 0: 1
1: 0
2: 1
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963904399 Original CRISPR GTACCTCCGCCGGTGACCTC AGG (reversed) Intronic
900576910 1:3387548-3387570 GTAGCACAGCCGGTGACGTCGGG + Intronic
911727885 1:101261519-101261541 GCACCACCGCCTGTCACCTCAGG - Intergenic
917973250 1:180222037-180222059 GTACCTCCTCAGGTGAGGTCTGG + Intergenic
923706396 1:236348098-236348120 GTTCCTCCTCCTCTGACCTCTGG - Intergenic
1064030808 10:11881524-11881546 GCACCTCCGTACGTGACCTCCGG + Intergenic
1071695460 10:87864176-87864198 CTGCCTCCGCCGGCGGCCTCCGG - Exonic
1072618106 10:97063059-97063081 GTGCCTCCTCCGATGTCCTCTGG - Intronic
1076861755 10:133141193-133141215 GTGCCTCCCCCGGGGGCCTCTGG + Intergenic
1077164257 11:1128024-1128046 GTCCCCCCGCCTGTGACCTGAGG + Intergenic
1101425639 12:104586019-104586041 GAACCTCAGAAGGTGACCTCCGG - Intronic
1103970614 12:124668682-124668704 GTACCTACGAATGTGACCTCTGG + Intergenic
1104624416 12:130339476-130339498 GTCCCTCCGGCGCTGAGCTCAGG - Intronic
1110323830 13:74190974-74190996 GTTACTCTGCCAGTGACCTCTGG + Intergenic
1116794437 14:49374455-49374477 GTACCTCCCCAGGTGGCCTGGGG + Intergenic
1123628427 15:22243957-22243979 GTGTCCCCGCCTGTGACCTCAGG + Intergenic
1131981039 15:97995039-97995061 GAACCTCAGCTGGAGACCTCAGG + Intergenic
1138358806 16:56408644-56408666 TAATCTCCGCCTGTGACCTCAGG - Intronic
1151224420 17:72638168-72638190 GTCCCTCCCCCGGTGCTCTCAGG - Intergenic
1153121162 18:1729337-1729359 GTCCCTCCCCCTGTGCCCTCAGG + Intergenic
1157260736 18:46173970-46173992 GCAGCTGCGCCGGAGACCTCTGG - Intronic
1160725701 19:616939-616961 GCGCGTCCCCCGGTGACCTCGGG + Exonic
1161960867 19:7522502-7522524 GTGCCTCTGCCGGCGCCCTCTGG - Intergenic
1164973092 19:32549190-32549212 GAATCTCAGCCGGTGACTTCTGG - Intergenic
1168264786 19:55216846-55216868 GGACCTCAGTCGCTGACCTCAGG - Intergenic
925414125 2:3657479-3657501 CTCCCTGCGCAGGTGACCTCGGG + Intergenic
926356753 2:12047624-12047646 GCACCTCTGCAGGTGACCTATGG - Intergenic
935579765 2:104746421-104746443 GTAGCTTCGCCGCTGTCCTCAGG - Intergenic
1172389713 20:34558706-34558728 GTAACTCGCCCGGTGACGTCAGG - Intronic
1175466551 20:59193839-59193861 GTACCTCCTCAGGTTACCTCAGG + Exonic
1184168873 22:42747017-42747039 GAACCTCCACCGGTGACAACAGG + Intergenic
963904399 3:150762389-150762411 GTACCTCCGCCGGTGACCTCAGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
977617736 4:99104868-99104890 GTCCCTCCCCCTGTGCCCTCAGG + Intergenic
999143769 5:149379520-149379542 GCACCTCCGCCTGTGGCCTGCGG + Intronic
1006932940 6:37698423-37698445 GTCCCTCCGCCACTGTCCTCGGG - Intronic
1018060584 6:160086787-160086809 GTACCTCAGCCTGTGTCCTGTGG + Intronic
1026989442 7:74575315-74575337 ATACCTTGGCAGGTGACCTCAGG - Intronic
1028752367 7:94394969-94394991 ATACCTCCGCCGGTGACCCAGGG + Exonic
1043502891 8:80874109-80874131 CTGCCTCCGCCGGTGGCCGCAGG + Intronic
1044821309 8:96157855-96157877 GTGTCACCGGCGGTGACCTCAGG - Intronic
1049004412 8:139845675-139845697 GTACCTCTGCCGTTGCCCTGGGG - Intronic
1049850608 8:144828132-144828154 CTACCTGTGCCGGTGACCTGGGG + Intronic
1051193051 9:14534670-14534692 TTAGCTCTGCCGGTGACCCCCGG - Intergenic
1060045694 9:120338378-120338400 GAACCACTGCAGGTGACCTCAGG - Intergenic
1062521443 9:136959579-136959601 GTGCCTGCGACGGTGACCACAGG + Intergenic