ID: 963905164

View in Genome Browser
Species Human (GRCh38)
Location 3:150767566-150767588
Sequence CACCTGTGGCACCTTGACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963905164_963905167 0 Left 963905164 3:150767566-150767588 CCAAGGTCAAGGTGCCACAGGTG No data
Right 963905167 3:150767589-150767611 TCTAGCGATGGCTTGCTTCCTGG No data
963905164_963905168 11 Left 963905164 3:150767566-150767588 CCAAGGTCAAGGTGCCACAGGTG No data
Right 963905168 3:150767600-150767622 CTTGCTTCCTGGTTTGTAGATGG 0: 2
1: 4
2: 70
3: 415
4: 1339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963905164 Original CRISPR CACCTGTGGCACCTTGACCT TGG (reversed) Intergenic
No off target data available for this crispr