ID: 963905167

View in Genome Browser
Species Human (GRCh38)
Location 3:150767589-150767611
Sequence TCTAGCGATGGCTTGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963905164_963905167 0 Left 963905164 3:150767566-150767588 CCAAGGTCAAGGTGCCACAGGTG No data
Right 963905167 3:150767589-150767611 TCTAGCGATGGCTTGCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963905167 Original CRISPR TCTAGCGATGGCTTGCTTCC TGG Intergenic
No off target data available for this crispr