ID: 963905168

View in Genome Browser
Species Human (GRCh38)
Location 3:150767600-150767622
Sequence CTTGCTTCCTGGTTTGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1830
Summary {0: 2, 1: 4, 2: 70, 3: 415, 4: 1339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963905166_963905168 -3 Left 963905166 3:150767580-150767602 CCACAGGTGTCTAGCGATGGCTT No data
Right 963905168 3:150767600-150767622 CTTGCTTCCTGGTTTGTAGATGG 0: 2
1: 4
2: 70
3: 415
4: 1339
963905164_963905168 11 Left 963905164 3:150767566-150767588 CCAAGGTCAAGGTGCCACAGGTG No data
Right 963905168 3:150767600-150767622 CTTGCTTCCTGGTTTGTAGATGG 0: 2
1: 4
2: 70
3: 415
4: 1339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963905168 Original CRISPR CTTGCTTCCTGGTTTGTAGA TGG Intergenic
900530399 1:3150199-3150221 CTTGTTTCCTTGTCTGTAAAAGG + Intronic
900819918 1:4878780-4878802 CTTGCTGCTTGGCTTGCAGATGG + Intergenic
900839616 1:5037733-5037755 CTTTCTTCCTGGCTTGCGGATGG - Intergenic
900903849 1:5536682-5536704 CTTTCTTCCTGGCTTTCAGACGG - Intergenic
901293849 1:8145678-8145700 CTCTCTTCCTGGTGTGCAGATGG - Intergenic
901316208 1:8311129-8311151 CTCTCTTCCTAGTTTGTAGACGG - Intergenic
901745239 1:11368469-11368491 CTCTCTTCCTGGCTTGCAGACGG - Intergenic
901920435 1:12532468-12532490 CTTGCTCCTCGGCTTGTAGACGG - Intergenic
902039385 1:13481855-13481877 CTCTCTTCCTGGCTTGCAGATGG - Intronic
902082097 1:13828214-13828236 CTTGGTTCCTTGTTGGTACAAGG + Intergenic
902111041 1:14078606-14078628 CCAGCTTCCTGGTTCATAGACGG + Intergenic
902197542 1:14808952-14808974 CTTCCTTCCTGCTTTGGAAATGG - Intronic
902242227 1:15096669-15096691 CTCTCTTCCTGGCTTGCAGAAGG + Intronic
902253878 1:15174758-15174780 CTCTCTTCCTGGCTTGCAGATGG + Intronic
903422829 1:23231022-23231044 CTTGCTTTGTGGTTTTGAGAAGG - Intergenic
903737541 1:25539722-25539744 CCGGCTTCCTGGTTCATAGATGG + Intergenic
903810433 1:26032204-26032226 CTTGCCTCTGGGCTTGTAGAAGG - Intronic
903855241 1:26333645-26333667 CTTTCTTCCTGGCTTGCAGAAGG - Intronic
904178903 1:28651891-28651913 CTTGCTCCTCGATTTGTAGATGG - Intergenic
904273977 1:29368400-29368422 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
904345064 1:29862469-29862491 CCTTCTTCCTGGTTTTCAGATGG + Intergenic
904442820 1:30542829-30542851 TATACTTCCTGGGTTGTAGAGGG - Intergenic
905350185 1:37340150-37340172 CTCACCTCCTGGTTTCTAGATGG - Intergenic
905498471 1:38416390-38416412 CTCTCTTCCTGGTTTGTGGATGG + Intergenic
905527897 1:38653109-38653131 CTCGCTTCCAGGCTTGCAGATGG - Intergenic
905903192 1:41595870-41595892 CTGGCTTCCTTGCTTGCAGACGG + Intronic
905955014 1:41985440-41985462 CATACCTCCTGGTTTGCAGATGG + Intronic
906370156 1:45247186-45247208 CTTGGTTCCTGGTTCATAAATGG - Intronic
906948561 1:50316198-50316220 CTCTCTTTCTGGTTTGTAGATGG - Intergenic
907052640 1:51340056-51340078 CCTGCTTTCTGGCTTATAGATGG - Intronic
907534040 1:55132197-55132219 CTGGCCTCCTGGTTCATAGATGG - Intronic
907620896 1:55978498-55978520 CCTTCTTCCTGGCTTGTAGTTGG - Intergenic
907783857 1:57592807-57592829 CTCTCTTCCTGGCTTGTAGGTGG + Intronic
908077995 1:60542356-60542378 CTTTCTTCCTGGCTTGCAGGTGG + Intergenic
908267364 1:62392619-62392641 CTTGCTTCATGGTTCATAAATGG - Intergenic
908331728 1:63077420-63077442 CTTTCTTCCTGGCTTGCAGATGG - Intergenic
908358365 1:63344143-63344165 CTCTCTTCCTGGCTTGTAGAAGG - Intergenic
908366529 1:63429582-63429604 CTCTCTTCCTGGCTTGTAGAAGG + Intronic
908419802 1:63948808-63948830 CTCGCTTCCTGGTTCATACAGGG - Intronic
908530598 1:65030185-65030207 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
908810239 1:67974887-67974909 CCTACTTTCTGGTTCGTAGAGGG + Intergenic
908814559 1:68018368-68018390 CCTGCTTCCTGGTTCATAGATGG - Intergenic
908865108 1:68539514-68539536 CTTGCTTCCTGGTGCATAGATGG + Intergenic
908954942 1:69613213-69613235 CTTCCTTCCTGATTTGCAGATGG + Intronic
909038130 1:70618381-70618403 CCTGCTTCCTAGTTCATAGAAGG + Intergenic
909301697 1:74020844-74020866 CCTGCTTCCTGGTTCATAGATGG + Intergenic
909471508 1:76034016-76034038 CTCTCTTCCTGACTTGTAGATGG - Intergenic
909525735 1:76620532-76620554 CTCTCTTCCTGTCTTGTAGATGG + Intronic
909695286 1:78461650-78461672 TTTGATGCCTAGTTTGTAGAGGG + Intronic
909765348 1:79349133-79349155 CTCTCTTTCTGGTTTGTAAATGG + Intergenic
909952117 1:81733409-81733431 CTTTCTTCTTGGCTTGCAGATGG + Intronic
910062446 1:83110144-83110166 CTGGCTTCCTGGTTTGCAGATGG - Intergenic
910279933 1:85488350-85488372 CTCTCTTCCTGGTTTTCAGATGG + Intronic
910284808 1:85541849-85541871 CCTGCTTCCTGGTTCATAGATGG - Intronic
910318245 1:85913999-85914021 CCTGCTCCCTGGTTCATAGATGG + Intronic
910399075 1:86820656-86820678 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
910480678 1:87655201-87655223 CTGTCTTCCTGGCTTGCAGATGG - Intergenic
910780553 1:90927846-90927868 CTTCCTTCCTTCTTTGGAGATGG + Intronic
911254876 1:95621637-95621659 TTTGCTTTCTGGTTTATAGATGG - Intergenic
911291229 1:96058774-96058796 TCTGTTTCCTGGTTTATAGATGG - Intergenic
911339451 1:96619044-96619066 CTTGCTCCTTAGCTTGTAGATGG - Intergenic
911388824 1:97213019-97213041 CTTGCTTCCAGGTTAATAGATGG + Intronic
911598784 1:99825264-99825286 CTGACTTCCTGGCTTGCAGATGG - Intergenic
911712786 1:101094916-101094938 CTTGCTTCTTGGTTCGTATTTGG + Intergenic
911715222 1:101125001-101125023 CTTGCTTGGTTGTTTGTGGATGG - Intergenic
912242298 1:107923891-107923913 CCTGTTTCCTGATTTATAGATGG - Intronic
912941209 1:114046775-114046797 CTGTCTTCCTGGATTGCAGATGG - Intergenic
913168763 1:116213043-116213065 CTCTCTTCCTGGCTTGCAGAGGG - Intergenic
913663449 1:121025874-121025896 TTTGATGCCTGGTTTGTTGAAGG - Intergenic
914014840 1:143809143-143809165 TTTGATGCCTGGTTTGTTGAAGG - Intergenic
914162981 1:145152064-145152086 TTTGATGCCTGGTTTGTTGAAGG + Intergenic
914195053 1:145443241-145443263 CTCTCTTCCTGGCTTGCAGAAGG - Intergenic
914318038 1:146532334-146532356 CTCTCTCCCTGGCTTGTAGATGG - Intergenic
914476324 1:148025818-148025840 CTCTCTTCCTGGCTTGCAGAAGG - Intergenic
914496319 1:148201023-148201045 CTCTCTCCCTGGCTTGTAGATGG + Intergenic
914503900 1:148271973-148271995 CTCTCTTCCTGGCTTGCAGAAGG + Intergenic
914653461 1:149717699-149717721 TTTGATGCCTGGTTTGTTGAAGG - Intergenic
915042316 1:152979231-152979253 ATTGCCTCCTGGGCTGTAGAGGG - Intergenic
915071969 1:153277327-153277349 CTCTCTTTCTGGTTTGCAGATGG - Intergenic
915612820 1:157008467-157008489 CCCTCTTCCTGGCTTGTAGACGG - Intronic
915763928 1:158343830-158343852 TTTGATGCCTGGTTTGTTGACGG + Intergenic
916191821 1:162186695-162186717 CCTGCTTCTTGGTTTGCAAATGG - Intronic
916300771 1:163271450-163271472 CCTTCTTACTGGTTTGCAGATGG - Intronic
916304556 1:163314844-163314866 CTTGCTTTCTGGTTCATACATGG - Intronic
916313430 1:163422123-163422145 CCTTTTTCCTGGCTTGTAGATGG + Intergenic
916383798 1:164244232-164244254 CTCTCTTCCTGGCTTGAAGATGG - Intergenic
916689422 1:167176373-167176395 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
916727544 1:167536143-167536165 CTTTCTTCCTGGCTTGCAGACGG - Intronic
916977830 1:170100443-170100465 CTCTCTTCCTCGTTTGTAGATGG + Intergenic
917642123 1:176993053-176993075 TTCTCTTCCTGGTTTGCAGATGG - Intronic
917685958 1:177416301-177416323 CCTGCTTCCTGGTTTATAGACGG - Intergenic
917700936 1:177580425-177580447 CTTGCTTCCACCTTTGAAGATGG - Intergenic
917724574 1:177816448-177816470 CCTGTTGCCTGGTTTGTAGATGG - Intergenic
918153092 1:181815482-181815504 CCTGCTTCCTGGTTTGCAGGTGG - Intergenic
918200992 1:182266754-182266776 CCTGCTTCCTGCTGTGCAGATGG - Intergenic
918608162 1:186455182-186455204 CCTTCTTCCTGGCTTGCAGATGG + Intronic
918656699 1:187035643-187035665 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
918712991 1:187754661-187754683 CTCTCTTCTTGGCTTGTAGATGG + Intergenic
918732502 1:188015683-188015705 CCTGTTTCCTGGTTTGCAGACGG + Intergenic
918827372 1:189341526-189341548 CCCACTTCCTGGTTTATAGACGG - Intergenic
918841191 1:189541789-189541811 CCTGCTTCCTGGTCTGTAGAGGG - Intergenic
918873364 1:190006386-190006408 CTTACTTCCTGCTGTGTGGACGG - Intergenic
918917900 1:190669252-190669274 CTTGCTCCATAGCTTGTAGATGG - Intergenic
919144394 1:193615306-193615328 CTTGTTTCCTGGTTGGTGGATGG + Intergenic
919148157 1:193661029-193661051 CTTACTTCCAGGCTTGTTGAGGG + Intergenic
919783934 1:201245244-201245266 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
920126967 1:203700964-203700986 CTCGCTTCCTTGTTTGTCCATGG - Intronic
920308832 1:205036129-205036151 CTCCCTTCCTGGTGTGCAGATGG - Intergenic
920586476 1:207168010-207168032 CCTACTTCCTGGTTTGCAGATGG - Intergenic
920655449 1:207870899-207870921 TCTGCTTCCTGGTTTGCAGTTGG - Intergenic
920889640 1:209971559-209971581 TTTGCTGCCTAGTTTGTTGAGGG + Intronic
921126468 1:212182407-212182429 CCTGCTTCCTGGTTCATAGATGG + Intergenic
921132453 1:212231480-212231502 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
921421514 1:214954259-214954281 CTTTCTTCTTGGTTTGTAGATGG + Intergenic
921719074 1:218450460-218450482 CTCTTTTCTTGGTTTGTAGATGG + Intergenic
921803168 1:219425116-219425138 CTTGTTTCCTGGTTCATAAAGGG + Intergenic
921891829 1:220361327-220361349 CTCTCTTCTTGGTTTGTAGATGG - Intergenic
922514175 1:226194654-226194676 CCTGCTTCCTAGTTTATAGATGG + Intergenic
922568620 1:226618566-226618588 CTTGCTTCCTGGTTGTTGGGAGG + Intergenic
922930790 1:229387707-229387729 GTCACTTCCTGGTTTGCAGATGG + Intergenic
923394977 1:233552823-233552845 CCTGCTCCCTGGTTCATAGATGG - Intergenic
923463050 1:234223876-234223898 CTCTCTTCTTGGTTTGCAGATGG + Intronic
923637685 1:235717311-235717333 TTTGCTACCTAGTTAGTAGATGG + Intronic
923790439 1:237106819-237106841 CTCGCTTCCTGGTTCATAGGCGG + Intronic
924024481 1:239818141-239818163 CTCTCTTCCTGGATTGTAGATGG + Intronic
924209312 1:241748394-241748416 CCCGCCTCCTGGTTTATAGATGG + Intronic
924282620 1:242453237-242453259 CCTGCTTCCTGGTTCCTAGATGG - Intronic
924491474 1:244542212-244542234 CTTGCCTCCTGGTATGGGGAAGG - Intronic
924676604 1:246184769-246184791 CTCTCTTCCTGGCTTGCAGATGG - Intronic
924863519 1:247952533-247952555 CTTGCTTTCTGGTTCATAGATGG - Intronic
924867994 1:248006820-248006842 GTTGCTTTCTGGTTCATAGATGG - Intronic
1063089616 10:2850715-2850737 CCTGCTTCCTGGTTCACAGATGG + Intergenic
1063108176 10:3012040-3012062 CCTGCTTCCTGGTTCACAGATGG - Intergenic
1063542584 10:6949404-6949426 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
1063582837 10:7324763-7324785 CTCTCCTCCTGGTTTGTAGGTGG + Intronic
1063687025 10:8246749-8246771 CTTCCTCCCTGGCTTGCAGATGG + Intergenic
1063718284 10:8552533-8552555 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
1063825484 10:9892617-9892639 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1063883321 10:10552920-10552942 CTCCCTTCCTGGCTTATAGATGG + Intergenic
1063914171 10:10864548-10864570 CTCTCTTTCTGGTTTGCAGAAGG + Intergenic
1063932284 10:11041077-11041099 CTCTCTTCCTGGCTTGCAGAGGG + Intronic
1063992004 10:11576560-11576582 CCTGCTTTCTGGTTCATAGATGG - Intronic
1064014085 10:11759447-11759469 CCTGCCTCCTGGTTCGTAAACGG - Intronic
1064131300 10:12712530-12712552 CTCTCTTCCTGGTTTGCAGACGG + Intronic
1064277744 10:13922093-13922115 CTCTCTTCCTGGCTTGCAGACGG - Intronic
1064352222 10:14586608-14586630 CTCCCTTCGTGTTTTGTAGAAGG - Intronic
1064358483 10:14641551-14641573 CTCACTTCTTGGCTTGTAGATGG + Intronic
1064491766 10:15865370-15865392 CTCCCTTCCGGGCTTGTAGACGG - Intergenic
1064554843 10:16538014-16538036 CTCTCTTCCTGGTGTGTAGATGG - Intergenic
1064669458 10:17695949-17695971 CCCACTTTCTGGTTTGTAGAAGG + Intronic
1064695623 10:17962477-17962499 TTTGCTTTCTGGTTTGCAGCAGG + Intronic
1064804463 10:19114847-19114869 CTTTCTTCTTGGCTTATAGATGG + Intronic
1065476745 10:26146500-26146522 CTCTCTTCCTGGCTTGAAGATGG + Intronic
1065717111 10:28581897-28581919 CTTGCTTCCTGTTATTTAAAAGG + Intronic
1065792297 10:29271965-29271987 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1066133795 10:32422608-32422630 CCTGCTTCCTGGTTCATAGATGG + Intergenic
1066564992 10:36712316-36712338 CTGGCTTACTGGTTTATAAATGG - Intergenic
1067173398 10:43925603-43925625 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1067248119 10:44563409-44563431 CTTTCTTTCTGGCATGTAGATGG + Intergenic
1067460095 10:46451825-46451847 CTCTCTTCCTGGGTTGCAGATGG + Intergenic
1067627095 10:47932788-47932810 CTCTCTTCCTGGGTTGCAGATGG - Intergenic
1067782907 10:49221917-49221939 CCTGCTTCCTTGTTTGTAAATGG + Intergenic
1067977536 10:51042923-51042945 CCTACTTCCTGGTTCATAGATGG - Intronic
1068350654 10:55840117-55840139 CTCTCTCCCTGGTTTGTAGATGG - Intergenic
1068412054 10:56668981-56669003 CCTGCTTCCTGGTTTGCAAATGG - Intergenic
1068790809 10:61029232-61029254 CTTGATTCCTAGTTTATAGACGG + Intergenic
1068816512 10:61321251-61321273 TTGGCTTCCTGGTTTGTAGTTGG - Intergenic
1068906961 10:62337383-62337405 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1069043995 10:63723500-63723522 CCTGCATCCTGGTTTGCAGACGG - Intergenic
1069696924 10:70393396-70393418 CTGTCTTCCTGGTTTGTAGATGG + Intergenic
1069953443 10:72035328-72035350 CCTGTTTCCTGGTCTGTAGAAGG + Intergenic
1070028215 10:72651788-72651810 CTGTCTTCCTGGTTTGCAGATGG - Intergenic
1070057300 10:72947839-72947861 CCTTCTTCCTGGCTTGCAGACGG + Intronic
1070315786 10:75311104-75311126 CTTGCTCCTTGGCTTGCAGATGG - Intergenic
1070326204 10:75390911-75390933 CTCTCTTCCTGGTTTTTAGATGG + Intergenic
1070339576 10:75484780-75484802 CTCTTTTCCTGGATTGTAGACGG - Intronic
1070403058 10:76070409-76070431 CTCTCTTCCTGGCTTGTAGATGG + Intronic
1070530116 10:77329467-77329489 CCTGCTTTCTGGTTCATAGATGG - Intronic
1070578924 10:77704108-77704130 CCTGCTTGCTGGTTCATAGATGG - Intergenic
1070583578 10:77743513-77743535 CTTGCTTTCTGGCTCATAGATGG - Intergenic
1070955073 10:80458286-80458308 CTAGATCCCTGGTCTGTAGAAGG + Intronic
1071198588 10:83191136-83191158 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
1071261025 10:83919017-83919039 CTTGCTTCATGGTTCCTAGATGG - Intergenic
1071349071 10:84721212-84721234 CCTGCTTCCTGGTTTATTAACGG - Intergenic
1071471991 10:85989989-85990011 CTTGCTTCCTGGTTCACAGGCGG - Intronic
1071524823 10:86352493-86352515 CTGTCTTCCTGGCTTGCAGATGG + Intronic
1071833906 10:89399922-89399944 ATTTCTTCCTGGATTGCAGATGG - Intronic
1071842082 10:89483079-89483101 CTCCCTTCCTGGCTTGAAGATGG + Intronic
1071899144 10:90100350-90100372 CCTGCTTCCTGATTCATAGATGG + Intergenic
1071930413 10:90463301-90463323 CCTGCTCCCTGCTTGGTAGATGG - Intergenic
1072148630 10:92666750-92666772 CTCACTTCCTGGGTTGCAGATGG - Intergenic
1072548752 10:96460882-96460904 CCTGCTTCCTGGTTCATAGATGG - Intronic
1072707522 10:97691918-97691940 CTCTCTTCTTGGCTTGTAGATGG + Intergenic
1072764405 10:98083959-98083981 GTTGCTTCCTGGTTCACAGATGG + Intergenic
1072906754 10:99461209-99461231 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1073203424 10:101754653-101754675 CTTCCTTCCTCTTTTGTGGAAGG - Intergenic
1073258673 10:102172330-102172352 CTGTCTTCCTGGCTTGCAGATGG + Intergenic
1074190749 10:111133826-111133848 TTTGCTGCCTAGTTTGTTGAGGG + Intergenic
1074336550 10:112582149-112582171 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1074349496 10:112722153-112722175 CTGGATTACTGGTTTGTAAAAGG + Intronic
1074713870 10:116200640-116200662 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1074817486 10:117153606-117153628 CTTTCTTCTTGGCTTATAGATGG + Intergenic
1074999486 10:118784627-118784649 CTCTCTTCCTGGTCTGCAGATGG + Intergenic
1075113338 10:119605590-119605612 GCTGTTTTCTGGTTTGTAGATGG - Intergenic
1075142019 10:119846800-119846822 CCCGCTTCCTGGTTTACAGATGG - Intronic
1075200630 10:120400714-120400736 CTCTCTTTCTGGTTTGCAGATGG - Intergenic
1075264165 10:120986769-120986791 CCCTCTTCCTGGTTTGCAGATGG - Intergenic
1075400854 10:122160475-122160497 CTCTCCTCCTGGCTTGTAGATGG + Intronic
1075518180 10:123126312-123126334 CTGTCTTCCTGGTTTGCAGATGG - Intergenic
1075580734 10:123616191-123616213 CTTTCTTCCTGGTTCATGGATGG - Intergenic
1076089627 10:127670985-127671007 CTCTCTTCCTGGCTTGTAGATGG - Intergenic
1076412394 10:130261617-130261639 CTCTCTTCCTGGCTTGCAGAGGG + Intergenic
1076448759 10:130540284-130540306 CTTGCATTCTGGTTCATAGATGG + Intergenic
1076464637 10:130670553-130670575 CTTTCTTTCTGGCTTGTAGATGG - Intergenic
1076475367 10:130748104-130748126 CCTGCTTCCTGGGTTCGAGATGG - Intergenic
1076812120 10:132892321-132892343 TTTTCTTCCAGGTTTGTAGCAGG - Exonic
1076841886 10:133049920-133049942 CTCGCTTCCTGGTCTGCTGAGGG - Intergenic
1077339462 11:2019588-2019610 CTGGCTTGGTGGTTTGTAGAGGG - Intergenic
1078278634 11:9876590-9876612 CTTTCTTTCTGGGTTGCAGATGG - Intronic
1078397630 11:10995264-10995286 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1078484504 11:11709042-11709064 CTCCCTTCCTATTTTGTAGAAGG + Intergenic
1078711057 11:13791533-13791555 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1078828897 11:14960043-14960065 CTCTCTTTCTGGCTTGTAGATGG + Intronic
1079345618 11:19649510-19649532 CCTGCTTCCTGGTTCACAGATGG + Intronic
1079464916 11:20720685-20720707 CTCTCTCCCTGGCTTGTAGATGG + Intronic
1079615498 11:22487681-22487703 CTTTCTTCCTGGCTTGCAGTTGG - Intergenic
1079994024 11:27276239-27276261 TTCTCTTCCTGGTTTGCAGATGG - Intergenic
1080095755 11:28404432-28404454 CTTACTTCCTGGTTTATAGGTGG + Intergenic
1080218829 11:29876692-29876714 TTTGCTTGCTGCCTTGTAGAGGG - Intergenic
1080585245 11:33675825-33675847 CCCGCTTCCTGGTTCATAGATGG - Intergenic
1080621741 11:33992560-33992582 CATGCTTCCTGGTTTACAGGTGG + Intergenic
1080659177 11:34282110-34282132 CCTGCTTTCTGGTTCATAGATGG + Intronic
1080975701 11:37337641-37337663 CTCGCTTTCTGGTTCATAGAGGG + Intergenic
1081332152 11:41816912-41816934 CTTGGTTTCTGGTTTGGAAAAGG - Intergenic
1081847353 11:46250417-46250439 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1082114307 11:48311552-48311574 CCTGCTTCCTGGTTTATAGATGG + Intergenic
1084452366 11:69246995-69247017 CTCTCTTCCTGGCTTGGAGATGG + Intergenic
1084709834 11:70837023-70837045 CTCCCTTCCTGGCTTGCAGACGG - Intronic
1084739473 11:71129962-71129984 CTCTCTTCCTGGCTTGCAGACGG + Intronic
1084744564 11:71160544-71160566 ACTGCTTCCTGGCTTGCAGAGGG - Intronic
1084766704 11:71313946-71313968 CCTCCTTCCTGGCTTATAGATGG - Intergenic
1085074567 11:73579019-73579041 TCAGCTTCCTGGTTTGCAGATGG + Intronic
1085366601 11:75952423-75952445 CTTTCCTCCTAGTTTGTTGAGGG + Intronic
1085409980 11:76285125-76285147 CCTGCCTCCTGGTTTGCAGATGG - Intergenic
1085583601 11:77678827-77678849 CCTGCTTTCTGGTTCATAGATGG - Intronic
1085725536 11:78951608-78951630 CTCTCTTCGTGGCTTGTAGATGG + Intronic
1086509173 11:87537894-87537916 CTTGTTTCCTGATTGGCAGATGG + Intergenic
1087024256 11:93634264-93634286 CCTGCTTCTCGGTTTGTTGATGG + Intergenic
1087083927 11:94197763-94197785 CTCACTTCCTGGTTTGTGGAGGG + Intergenic
1087130731 11:94667478-94667500 CCTGCTTCCTGGTTCATAGACGG - Intergenic
1087375176 11:97330688-97330710 TCAGCTTCCTGGTTTGTAAATGG + Intergenic
1087417700 11:97878868-97878890 CTTTCTCTCTGGTTTGCAGATGG + Intergenic
1087478606 11:98670147-98670169 CTTTCTTCTTGGCTTATAGATGG + Intergenic
1087570474 11:99921032-99921054 CTTTCTTTCTGGTTTGCAGATGG - Intronic
1087675282 11:101154518-101154540 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1087962492 11:104369098-104369120 CTTGCTTTCTGGTTCATAGATGG - Intergenic
1088176034 11:107053912-107053934 CTCTCTTCCTGGCTTATAGATGG + Intergenic
1088353136 11:108912165-108912187 CCTGTTTACTGATTTGTAGATGG + Intronic
1088517511 11:110654625-110654647 CATGCTTTCTGGTTTGTTAAGGG - Intronic
1088710314 11:112502079-112502101 CTTGCTTTCTGGCTTGCAGCTGG + Intergenic
1088850223 11:113698113-113698135 CTCTTTTCCTGGATTGTAGATGG - Intronic
1088862410 11:113814066-113814088 ATTGCTTCGTGGTTCATAGAGGG - Intronic
1089377360 11:118004039-118004061 CTCTCTTCCTGGCTTGGAGACGG + Intergenic
1089487475 11:118858231-118858253 CTTTCTCCCTGGTTTGTAGATGG + Intergenic
1089646170 11:119880516-119880538 CTTGCTAACAGGTGTGTAGATGG + Intergenic
1090024510 11:123156211-123156233 CTATCTTCCTGGCTTGTGGATGG - Intronic
1090181505 11:124704192-124704214 CTCTCTTCCTGGCTTGCAGACGG - Intergenic
1090384829 11:126351502-126351524 CCTGCTTCCTGGTTCATACAAGG - Intergenic
1090601689 11:128379004-128379026 CTCTTTTCCTGGCTTGTAGATGG + Intergenic
1090737873 11:129627160-129627182 CTTGCTTTGTGGTTAGTACATGG + Intergenic
1091114276 11:132998802-132998824 CCTACTTCCTGGTTCATAGATGG - Intronic
1091187154 11:133657119-133657141 GCTGCTTCCTGGTTTGCAGATGG - Intergenic
1091313527 11:134594325-134594347 CCTGCCTCCTGGTTTGCAGATGG - Intergenic
1091316055 11:134614840-134614862 TCTACTTCCTGGTTTATAGATGG - Intergenic
1091341875 11:134822294-134822316 CTTCCTTCCTGGTATATTGATGG - Intergenic
1202822447 11_KI270721v1_random:74777-74799 CTGGCTTGGTGGTTTGTAGAGGG - Intergenic
1091934416 12:4423797-4423819 CTCTCTTCCTGGCTTGTAGAAGG - Intergenic
1091977703 12:4838740-4838762 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1092466637 12:8739237-8739259 CCCACTTCCTGGTTTGCAGATGG + Intronic
1092661156 12:10739720-10739742 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1092661168 12:10739787-10739809 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1092829239 12:12427756-12427778 CCTGCTCCCTGGTTTGCAGATGG + Intronic
1093132188 12:15404940-15404962 CTGTCTTCCTGATTTGAAGATGG + Intronic
1093271168 12:17063992-17064014 CTTGCTCTCTGTTTTATAGAAGG + Intergenic
1093388887 12:18593040-18593062 CTTTCTCCTTGGTTTGTAGATGG + Intronic
1093926022 12:24909240-24909262 CATGCTTCCTGGTTGGTATTGGG + Intronic
1094153191 12:27309512-27309534 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1094166101 12:27445847-27445869 CTCTCTTTCTGGCTTGTAGAAGG + Intergenic
1094212064 12:27903328-27903350 CTTACTTCTTGGTTCATAGATGG + Intergenic
1094410204 12:30160320-30160342 CTTGTTTCCTGGTTTGTAGATGG + Intergenic
1094598603 12:31888301-31888323 CTTGCCTCCTGGTTCACAGATGG + Intergenic
1095444394 12:42269785-42269807 CCTGCTTTCCGGTTTGCAGATGG - Intronic
1095906413 12:47382719-47382741 CTTTCTTCTTGGCTTGTAGGTGG + Intergenic
1095933485 12:47652598-47652620 CCCTCTTCCTGGTTTGCAGATGG + Intergenic
1096382948 12:51174039-51174061 TTAGCTTCCTCGTTTGTAAACGG + Intergenic
1097019467 12:56009451-56009473 CTTGCTTTATGGTTTGCAGGAGG + Intronic
1097136536 12:56861630-56861652 CTCTCTTCCTTGCTTGTAGATGG + Intergenic
1097315112 12:58163641-58163663 CTCTCTTCCTGGATTGTTGATGG - Intergenic
1097510409 12:60531644-60531666 CTCGCTTCTTGGTTTCTAGCTGG + Intergenic
1097833029 12:64245569-64245591 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1097867658 12:64572394-64572416 CTTTCCTCCTGGCTTGCAGAAGG - Intergenic
1097901730 12:64880458-64880480 CCCTCTTCCTGGTTTGCAGATGG + Intronic
1098111145 12:67123136-67123158 CTTACTTTCTGGTTCATAGATGG + Intergenic
1098316418 12:69198159-69198181 CCTGCTTCCTGGTTCCTAGATGG - Intergenic
1098494136 12:71115336-71115358 CTTGTTTTCTGGTTTCTAGGTGG + Intronic
1098587304 12:72169477-72169499 CTTTCTTCCTGGCTGGTAGATGG + Intronic
1098677724 12:73311938-73311960 CTTGATGCCTGGTTTCTTGAGGG + Intergenic
1098680982 12:73354569-73354591 CCTTCTTCCTGGTTTGCAGGTGG - Intergenic
1098840345 12:75470294-75470316 CCATCTTCCTGGCTTGTAGATGG - Intergenic
1099096613 12:78382176-78382198 CTTTCTCCTTGGATTGTAGATGG + Intergenic
1099243160 12:80162596-80162618 CTTTCTGCTTGGCTTGTAGATGG + Intergenic
1099490354 12:83281573-83281595 CTTGCTTCTCGGCTTGCAGATGG - Intergenic
1099500224 12:83404952-83404974 CTCTCTTCCTGGCTTGTAGATGG + Intergenic
1099708153 12:86183685-86183707 CTCTTTTCCTGGCTTGTAGAGGG + Intronic
1099709327 12:86200948-86200970 CTCTCTTCCTGGCTTGTAGACGG - Intronic
1099948888 12:89277784-89277806 TTCTCTTCCTGGATTGTAGATGG - Intergenic
1100029435 12:90168062-90168084 CTCTCTTCCTGGCTTGTAGGTGG - Intergenic
1100229453 12:92592661-92592683 CCTGTTTCCTGGTCCGTAGATGG + Intergenic
1100252404 12:92841007-92841029 ATTGCTTTCTGGTTCATAGATGG - Intronic
1100337633 12:93646994-93647016 CTCCCTTCCTGGCTTGCAGATGG - Intergenic
1100599361 12:96099676-96099698 GTTGCTTCCTGTTTTGTAGATGG + Intergenic
1100642580 12:96496465-96496487 CTCCTCTCCTGGTTTGTAGAAGG + Intronic
1100677348 12:96881846-96881868 CCTGTTTCCTGGTTCATAGATGG + Intergenic
1100922146 12:99500193-99500215 CTCTCTTCCTGGCTTGTTGAAGG - Intronic
1100944756 12:99768915-99768937 CCTGCTTCCTGGTTTGCAGAGGG - Intronic
1101071037 12:101076318-101076340 GTTGCTTTCTGGTTCTTAGATGG - Intronic
1101131392 12:101694606-101694628 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1101161032 12:101976646-101976668 CTCTATTCCTGGTTTGCAGATGG - Intronic
1101539854 12:105654941-105654963 CCTGCTTCCTGGTTCATAAATGG - Intergenic
1101551866 12:105770872-105770894 CTCCCTTCTTGGTTTGTAGATGG + Intergenic
1101676910 12:106925626-106925648 CTTTCTCCTTGGTTTGTGGATGG - Intergenic
1101743732 12:107522055-107522077 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1101983775 12:109429934-109429956 CCAGCTTCCTTGTTTGTAGATGG + Intronic
1102325483 12:111978706-111978728 CCCACTTCCTGGTTTGCAGATGG - Intronic
1102559555 12:113752562-113752584 CTTGTTTCCTTGTTCATAGATGG - Intergenic
1102663048 12:114546347-114546369 CTCCCTGCTTGGTTTGTAGATGG - Intergenic
1102821443 12:115912462-115912484 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1103074759 12:117973111-117973133 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1103156713 12:118691601-118691623 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1103532653 12:121613040-121613062 CGAGCTACCTGGCTTGTAGACGG + Intergenic
1103942586 12:124509071-124509093 CTTGCTCCCTGTGTTGGAGATGG - Intronic
1103980728 12:124735325-124735347 CTTGCTCCCTGGTTTGCCAAGGG - Intergenic
1104054097 12:125216223-125216245 CTCCCTTCCTGGCTTGCAGATGG + Intronic
1104071140 12:125346534-125346556 TTCACTTCCTGGTTTGGAGAGGG + Intronic
1104128782 12:125872832-125872854 CCTGCTTCCTGGCTTACAGATGG - Intergenic
1104179152 12:126361250-126361272 CTCTCTTCCTGGCTTGTGGATGG + Intergenic
1104313640 12:127676952-127676974 CTGGCTTCTTGGCTTGTAGACGG - Intergenic
1104316600 12:127709087-127709109 CTTACTTCCTGTATTGCAGAAGG - Intergenic
1104353685 12:128066770-128066792 CTCTCTTCCTGGCTTATAGATGG - Intergenic
1104618582 12:130292157-130292179 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1105414835 13:20201711-20201733 CTTTCTTCCTGGCTTGCAGATGG + Intergenic
1105722717 13:23132920-23132942 CCTCCTTCCTGGTTTGCTGATGG - Intergenic
1105817400 13:24049812-24049834 CCCTCTTCCTGGTTTGTAAAGGG - Intronic
1105827447 13:24135024-24135046 TTTTCTTTCTGGCTTGTAGATGG - Intronic
1105832572 13:24177400-24177422 CCTGCTTTCTGGTTTATAAATGG + Intronic
1106034727 13:26033365-26033387 CCCTCTTCCTGGTTTGTAGATGG - Intergenic
1106051996 13:26200032-26200054 CTTACTTTCTGGTTCATAGATGG - Intronic
1106078734 13:26483334-26483356 TCTGCTTCCTTGTTTGTAAAAGG + Intergenic
1106102312 13:26705719-26705741 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1106116191 13:26819864-26819886 CTCGATTCCTGGTTTGCAGACGG - Intergenic
1106567645 13:30900242-30900264 CTCTCTCCCTGGTTTGTAGATGG + Intergenic
1106593113 13:31114807-31114829 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
1106610008 13:31269823-31269845 CCTGCTTCCTGGTTCATGGATGG - Intronic
1106766037 13:32915000-32915022 CTTGCTTTCTGGTTCATAGATGG + Intergenic
1106820281 13:33456772-33456794 CCTGCTTTCTGGTTCATAGATGG - Intergenic
1106851218 13:33794776-33794798 CTCGCTTCCTGGCTTACAGATGG - Intergenic
1107062313 13:36172899-36172921 ATACCTTCCTGGTTTCTAGACGG + Intronic
1107469591 13:40679816-40679838 CTTGCTCCTTGGTTTGCTGACGG - Intergenic
1107529822 13:41272696-41272718 CTTGCTTCTAGGATGGTAGAAGG - Intergenic
1107623066 13:42253344-42253366 TTTGCTTCCTGGTTCCTGGATGG - Intronic
1107748848 13:43542862-43542884 CTCGCTTCCTGGTTCATAGACGG + Intronic
1107834792 13:44404608-44404630 CTTTCTGTCTGGTTTCTAGATGG - Intergenic
1107881627 13:44837120-44837142 ATTGCTTTCTGGTTCTTAGATGG + Intergenic
1107907117 13:45071508-45071530 CTTGCTTCCTGATCTGCAGATGG + Intergenic
1108049644 13:46420273-46420295 CTCTCTTCCTGGTTTGCAGATGG + Intronic
1108098496 13:46929905-46929927 CCCACTTCCTGGTTTGCAGATGG - Intergenic
1108238916 13:48441178-48441200 CCTGTTTCCTGGTTCATAGATGG + Intronic
1108284010 13:48887606-48887628 CTCTCCTCCTGGCTTGTAGATGG + Intergenic
1108714856 13:53068982-53069004 CTGGCTTCCTGGGCTGTAAAAGG + Intergenic
1109000212 13:56791868-56791890 GTCCCTTCCTGGTTTGCAGAGGG + Intergenic
1109009458 13:56921974-56921996 CCTTCTTCCTGGCTTGCAGATGG + Intergenic
1109093477 13:58079588-58079610 GTTGGTTTCTGGTTTGTAAAAGG - Intergenic
1109197487 13:59394708-59394730 CTTGTTTCCTGGTTTGGAGATGG + Intergenic
1109198355 13:59404150-59404172 TTTTCTTCCTGGCTTATAGATGG - Intergenic
1109883221 13:68509394-68509416 CTTTCTTCCTAGTATGTAGATGG - Intergenic
1109964717 13:69676817-69676839 CTTTTTTCCTAGTTTCTAGAAGG - Intergenic
1110186432 13:72680752-72680774 TCTGCTTTCTGGTCTGTAGATGG + Intergenic
1110495964 13:76168251-76168273 CTTGTTTCCTGGTTTGCAGGTGG + Intergenic
1110685991 13:78374523-78374545 CTTCCTTCCTGGCTTATAGAAGG - Intergenic
1110781203 13:79467003-79467025 CTCTCTTCCTGGCTTGTAGATGG + Intergenic
1111182445 13:84686782-84686804 CTTGCTCCTTGGCTTGCAGAGGG + Intergenic
1111561286 13:89951603-89951625 CCTCTTTCCTGGTTTGCAGATGG - Intergenic
1111658305 13:91178846-91178868 CCACCTTCCTGGTTTGTGGAGGG + Intergenic
1111709043 13:91788202-91788224 CCTTCTTCCTGGTTTGCAGAAGG + Intronic
1111948883 13:94694027-94694049 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1112094598 13:96118338-96118360 CTTCCTTTTTGGCTTGTAGATGG - Intronic
1112118099 13:96379420-96379442 CCTGCTTCCTGGTTCATAGATGG - Intronic
1112122126 13:96424608-96424630 CCCACTTCCTGGTTCGTAGATGG + Intronic
1112169143 13:96951467-96951489 CTCTCTTCCTAGTTTGTAGATGG - Intergenic
1112311042 13:98317791-98317813 CTCTCTTCCTGGTTTGCAGAGGG + Intronic
1112396709 13:99040194-99040216 CTTTCTTGCTGGTTTGAAGATGG - Intronic
1112485580 13:99816689-99816711 CTTGCTTCCTGGTTCATAGATGG - Intronic
1112550128 13:100411696-100411718 CCCACTTCCTGGTTTGCAGATGG + Intronic
1112589845 13:100752828-100752850 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1112659396 13:101490253-101490275 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1112698887 13:101981355-101981377 CCTGTTTCCTGGTTCGTAGATGG - Intronic
1112841501 13:103584854-103584876 CCCGCTTCCTGGTTCATAGATGG + Intergenic
1113031622 13:105999674-105999696 TCTGCTTCCTGGTTTGAAAATGG + Intergenic
1113121263 13:106926012-106926034 TCTACTTCCTGGTTTGTAGATGG + Intergenic
1113139459 13:107130883-107130905 CTTTCTTCTTGGCTTGTAGGGGG + Intergenic
1113318543 13:109209207-109209229 CCTGCTTCCTGGATTGCAGATGG + Intergenic
1113338082 13:109395804-109395826 CCCGCTTCCTGGTTCCTAGAGGG - Intergenic
1113345110 13:109469613-109469635 CTGGCTTCCTGGTATACAGATGG - Intergenic
1113405514 13:110035486-110035508 CTCTCTTCCTGGCTTGTAGATGG - Intergenic
1113528420 13:111000823-111000845 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1113697302 13:112355352-112355374 AGGGCTTCCTGGTTTGTGGACGG + Intergenic
1114381238 14:22206599-22206621 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1114870913 14:26657432-26657454 TCTGCTTTCTGGTTTATAGATGG - Intergenic
1114940573 14:27605243-27605265 TTTGCTTCCTGGCTTGCAAAGGG + Intergenic
1115049220 14:29035963-29035985 CTCTCTCCTTGGTTTGTAGATGG - Intergenic
1115797108 14:36950470-36950492 CTTTCTTCCTGGCTTGCAGATGG - Intronic
1116142103 14:41010590-41010612 CCTGCTTCCTGTCTTCTAGAGGG + Intergenic
1116222182 14:42102286-42102308 CTCTCTTCTTGGTTTGCAGATGG + Intergenic
1116321859 14:43478366-43478388 CTGTCTTCCTAGCTTGTAGATGG + Intergenic
1116348046 14:43821764-43821786 CTTTCTCCTTGGCTTGTAGATGG - Intergenic
1116585364 14:46696815-46696837 CCTCCTTCCTGGTTCATAGATGG + Intergenic
1116619615 14:47182516-47182538 CTCTCTTCCTGGTTTGCAGATGG - Intronic
1116781635 14:49243627-49243649 CCTGCTTCCTTGTTCATAGATGG - Intergenic
1116797358 14:49406380-49406402 CTCTCTCCCTGGTTTGCAGATGG - Intergenic
1116865817 14:50030721-50030743 CTTTCTTCCTGGCTTGCACATGG - Intergenic
1117083430 14:52175325-52175347 CCTGCTTCCTGATTTGCAGAAGG + Intergenic
1117549838 14:56823984-56824006 CCTGCTTTCTGGTTTATAGAGGG - Intergenic
1117580992 14:57151526-57151548 CTCTCTTCCTGGCTTGCAGAGGG - Intergenic
1117671502 14:58111585-58111607 CTCTCTTCCTGGTTTACAGATGG + Intronic
1117964777 14:61195723-61195745 GTTGCTTCCTGGCTTGTAGATGG + Intronic
1118097609 14:62556082-62556104 TCTGCTTCCTGGTTCATAGATGG - Intergenic
1118450702 14:65898809-65898831 GTTGCTTTCTGGTTCGCAGATGG - Intergenic
1118454573 14:65932703-65932725 CGTACTTCCTGGCTTGCAGAAGG - Intergenic
1119119387 14:72059813-72059835 CTCCCTTCCTGGCTTGCAGATGG - Intronic
1119129484 14:72158230-72158252 CTTCCTCCTTGGCTTGTAGATGG + Intronic
1119724167 14:76912037-76912059 CTCCCTTCCTGGCTTGTGGATGG - Intergenic
1119863591 14:77954999-77955021 CCCATTTCCTGGTTTGTAGATGG + Intergenic
1119944093 14:78673641-78673663 CCTGCTTCTTGGTCTGCAGATGG + Intronic
1119966058 14:78916874-78916896 CTTTCTTCTTGGCTTTTAGATGG + Intronic
1120087651 14:80293292-80293314 CCTGCTTCCTGGTTCATAGATGG + Intronic
1120092001 14:80342752-80342774 CTCTTTTCCTGGTTTGCAGAGGG - Intronic
1120093172 14:80357640-80357662 CTGTCTTCCTGGCTTGCAGATGG - Intronic
1120205673 14:81584712-81584734 CTTGCCTCCTGGTTACCAGATGG - Intergenic
1120415716 14:84215869-84215891 CCTGCTTCCTGGTTTGTAGATGG - Intergenic
1120493653 14:85207191-85207213 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
1120671187 14:87364703-87364725 CCTGTTTCCTGGTTTATAGAGGG + Intergenic
1120710827 14:87791257-87791279 CTCACTTCCTGGTTCATAGATGG - Intergenic
1121069679 14:91006550-91006572 CCCACTTCCTGGTTTGCAGATGG - Intronic
1121142103 14:91552261-91552283 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1121214204 14:92234624-92234646 CTGTCTTCCTGGCTTGCAGATGG - Intergenic
1121370918 14:93357602-93357624 CTTGCTTCTTAGCTTGCAGATGG + Intronic
1121566969 14:94917239-94917261 CTCACTTCCTAGATTGTAGATGG - Intergenic
1121821739 14:96974204-96974226 CTCTCTTCCAGGCTTGTAGATGG - Intergenic
1121855468 14:97265580-97265602 CTCTCTCCCTGGCTTGTAGATGG + Intergenic
1121896739 14:97655732-97655754 CCTGTTTCCTGGTTCATAGATGG - Intergenic
1122134449 14:99624828-99624850 CTTGCTTCCGGCCTTGGAGAGGG - Intergenic
1122303790 14:100748528-100748550 TTTCCATCCTGGTTTATAGATGG + Intergenic
1122676892 14:103423048-103423070 CCTTCTTCCTGGCTTGCAGATGG - Intronic
1123101482 14:105804869-105804891 CTGTCTTCCTGGCTTGAAGATGG + Intergenic
1123175512 14:106414030-106414052 TTTTCTTCCAGGTCTGTAGATGG + Intergenic
1123186890 14:106527733-106527755 TTTTCTTCCAGGTCTGTAGATGG + Intergenic
1202940986 14_KI270725v1_random:145032-145054 CTGTCTTCCTGGTTTACAGATGG + Intergenic
1123773520 15:23554044-23554066 CTTGATTCCTGGTTTGCAAATGG - Intergenic
1123833048 15:24161459-24161481 CTTGCTTCCTTGTTTGGTGAAGG - Intergenic
1124396623 15:29307787-29307809 CTTGCTTCCTGTCTTGCAGACGG - Intronic
1124463205 15:29912096-29912118 CCCGCTTCCTGCTTTGTAGATGG + Intronic
1124984594 15:34594502-34594524 CCTTCTTCCTGGTTTGCAGAAGG + Intergenic
1125423761 15:39529894-39529916 CTTGCTTCTTAGCTTGCAGATGG - Intergenic
1125637942 15:41204899-41204921 CTTCTTTCCTGGTATGTAGCGGG - Intronic
1125782554 15:42282871-42282893 CTCTCTTCTTGGTTTGTAGATGG + Intronic
1126159862 15:45600476-45600498 CTCTCTTCCTAGTTTGTTGATGG + Intronic
1126164054 15:45638883-45638905 CTCTCTCCCTGGTTTGCAGATGG - Intronic
1126283233 15:46980806-46980828 CTTGCTTCCCAGCTTGCAGATGG + Intergenic
1126292482 15:47098213-47098235 CTGTCTTCCTGGTTTACAGATGG - Intergenic
1126360705 15:47842841-47842863 CCTGCTTCTTGGTTCCTAGATGG - Intergenic
1126402884 15:48292662-48292684 CCCTCTTCCTGGTATGTAGATGG + Intronic
1126468056 15:48978799-48978821 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1126613926 15:50557311-50557333 CTTGCTGCCTGGTTTGTGATGGG - Exonic
1126642235 15:50839965-50839987 CACTCTTCCTGGTTTGTAGACGG + Intergenic
1126644646 15:50862731-50862753 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1126672901 15:51132560-51132582 CTCTCTTCCTGGTTTACAGAGGG - Intergenic
1126918416 15:53492129-53492151 CCTGCTTCCTGGTTCATAGATGG + Intergenic
1127172723 15:56320407-56320429 CTCTCTTCCTGGCTTGCAGAGGG + Intronic
1127375962 15:58384515-58384537 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1127492233 15:59476038-59476060 CCTGCTGCCTGAATTGTAGATGG + Intronic
1127521085 15:59743622-59743644 TTCACTTCCTGGTTTGCAGATGG - Intergenic
1127691354 15:61400352-61400374 CTCTCTTCCTGGTTTATGGAGGG - Intergenic
1128220124 15:65963131-65963153 CTTGCTTCCTGTCTTGGAGAGGG + Intronic
1128405464 15:67333018-67333040 CCTGTTTCCTGGTTCATAGATGG + Intronic
1128419299 15:67476306-67476328 CCTGCTTCCTGGCTTGTAAATGG + Intronic
1128551967 15:68603716-68603738 CTCTCTTCCTGGTTTGCAGACGG - Intronic
1129167079 15:73784709-73784731 CTTGCACCCTGGTCTGCAGAGGG + Intergenic
1129589557 15:76903548-76903570 CCTGCTTTCTGGTTAATAGATGG - Intronic
1130162862 15:81419019-81419041 CTTTCCTCCTGGCTGGTAGATGG - Intergenic
1130180356 15:81620921-81620943 CCCGCTTCCTGGTTTATAGATGG - Intergenic
1130394070 15:83486839-83486861 CCCGCTTCCTGGCTTGCAGATGG + Intronic
1130713499 15:86308405-86308427 CTCTCTTCCTGGCTTGTAGATGG - Intronic
1131095566 15:89652506-89652528 CTTGCTGCCTGTTCTGTGGAAGG - Intronic
1131365448 15:91835149-91835171 CTTGCTTTCTGGTTTCAAGATGG - Intergenic
1131372356 15:91893446-91893468 CCTGCTTTCTGGTTGATAGATGG + Intronic
1131443328 15:92475310-92475332 CTTGTTTCTTGGCTTGCAGATGG + Intronic
1131468374 15:92673778-92673800 CTCGCTCCTTGGTTTGCAGATGG + Intronic
1131514634 15:93068893-93068915 TTTGATGTCTGGTTTGTAGATGG - Intronic
1131652584 15:94417187-94417209 TCTGCCTCCTGGTTTTTAGAGGG + Intronic
1131679508 15:94706593-94706615 CCTGCTTCCTGGCTTGCAGATGG - Intergenic
1131704434 15:94977341-94977363 CTCTCTTCCTGGCTTGTGGATGG - Intergenic
1131740865 15:95389799-95389821 CTTGCTGTCTGATTTATAGATGG - Intergenic
1131779506 15:95841345-95841367 CATGCTTCATGATTTGAAGAAGG - Intergenic
1131894469 15:97011312-97011334 CTCACTTCCTGGTTCATAGATGG + Intergenic
1132007824 15:98245888-98245910 TTTGATGCCTAGTTTGTAGAGGG + Intergenic
1133364171 16:5197868-5197890 CTGGCTTCCTGGTTCACAGATGG + Intergenic
1133397142 16:5457064-5457086 CTCGCTTCCTGGTTTGTGGATGG + Intergenic
1133436531 16:5784819-5784841 CTTACCTCCTGGTTCATAGATGG - Intergenic
1133933348 16:10250017-10250039 ATTCCTTCCTGGGTTGGAGATGG - Intergenic
1134027137 16:10963119-10963141 CTCTCTTCCTGGCTTGCAGACGG + Intronic
1134233956 16:12451039-12451061 CTTTCTCCCTTGCTTGTAGAAGG - Intronic
1134297243 16:12957813-12957835 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1134311680 16:13080897-13080919 CTGGCTTCCTGGTTTGCAGATGG + Intronic
1134347782 16:13407251-13407273 TCTGCTTCCTGATTTGTAGATGG + Intergenic
1134476916 16:14581970-14581992 CCCACTTCCTGGTTTGCAGATGG - Intronic
1134559308 16:15194217-15194239 CCTGCTTCCTGGTTCTTACATGG - Intergenic
1134693352 16:16205357-16205379 CTTGATTTATGGTTTGTAAAGGG + Intronic
1134812894 16:17182321-17182343 CTCTCTTCCTGGCTTGCAGAAGG + Intronic
1134919846 16:18105830-18105852 CCTGCTTCCTGGTTCTTACATGG - Intergenic
1134978500 16:18589344-18589366 CTTGATTTATGGTTCGTAGAGGG - Intergenic
1135063065 16:19287257-19287279 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1135087380 16:19486295-19486317 CTCTCTCCCTGGTTTATAGACGG + Intronic
1135214313 16:20551487-20551509 CTCTCTTCCTGGCTTGTTGATGG - Intronic
1135345953 16:21688637-21688659 CTCGCTTTCTGGTTTATAGGTGG + Intronic
1135631495 16:24039117-24039139 CTCACTTCCTGGCTTGCAGACGG - Intronic
1135843285 16:25895675-25895697 CCTGCTTCCTGGTTTGCAGATGG + Intronic
1137370716 16:47903478-47903500 CTTGCTTGCTGGTTTGGACGTGG - Intergenic
1137382393 16:48011481-48011503 CCTGCTTCCTGGCTTGTAGATGG + Intergenic
1137721262 16:50628879-50628901 CTCGCTTCCTGGCTTGCAGACGG + Intronic
1137730282 16:50684448-50684470 TTTGATTCCTGGTTTGCAGATGG + Intergenic
1137978032 16:53047478-53047500 CTCCCTTCCTGGCTTGTAGATGG + Intergenic
1138081185 16:54092902-54092924 GCTGCTTCCTGGTGTGAAGAAGG - Intronic
1138317167 16:56080343-56080365 CTCACTTCCTGGTTGATAGATGG + Intergenic
1138437725 16:57014830-57014852 TGCGCTTCCTGGTTTGCAGACGG + Intronic
1138493526 16:57392680-57392702 CTTGCTCCTTGGCTTGCAGATGG + Intergenic
1138716929 16:59034639-59034661 CTCCCTTCCTGGTTTGCAGGTGG + Intergenic
1138903591 16:61303391-61303413 CTCTCTTCCTGGCTGGTAGATGG - Intergenic
1138965310 16:62077435-62077457 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1139019146 16:62725671-62725693 GTTTCTTCCTGCTTTGTAGCAGG + Intergenic
1139192791 16:64884175-64884197 CTCTCTTCCTGGTTTATTGATGG + Intergenic
1139279149 16:65754832-65754854 CCCGCTTCTTGGTTTGCAGAAGG - Intergenic
1139387680 16:66584460-66584482 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1140186059 16:72773463-72773485 CTCTCTTCTTGGCTTGTAGATGG + Intergenic
1140302132 16:73768241-73768263 CTTGCTTTCTGGTTTCCAGCTGG - Intergenic
1140991634 16:80218779-80218801 CCTTCTTCATGGCTTGTAGATGG - Intergenic
1141065652 16:80911665-80911687 CTCTTTTCCTGGTTTGTAGATGG - Intergenic
1141224866 16:82105269-82105291 CCTACTTCTTGGTTTGCAGACGG - Intergenic
1141396773 16:83711984-83712006 CTCTCTTCTTGGCTTGTAGATGG + Intronic
1141931880 16:87210690-87210712 CTATCTTCCTGACTTGTAGATGG + Intronic
1142475758 17:188516-188538 CCTGTTTCCTGGTCTGTATATGG + Intergenic
1143441009 17:6973959-6973981 GTTGCTTTCTGGTTTATAGTGGG - Intronic
1143910625 17:10245872-10245894 CCTTCTTCCTGGCTTGCAGATGG + Intergenic
1144238592 17:13287134-13287156 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1144457016 17:15427042-15427064 CCTGCTTTCTGGTTCATAGATGG - Intergenic
1144822284 17:18083735-18083757 CTCTCTTCCTGTTTTGCAGAGGG - Intergenic
1145837521 17:27965823-27965845 CCTGCTTCCTGGTTCACAGATGG + Intergenic
1145894658 17:28447492-28447514 CTCTCTTCCTGGCTTGAAGATGG - Intergenic
1145923830 17:28631276-28631298 CTGTCTTCCTGGCTTGCAGATGG - Intronic
1146341811 17:32026071-32026093 TTTTCTTCCTGATTTATAGAAGG + Intronic
1146350993 17:32093567-32093589 TTTTCTTCCTGATTTATAGAAGG - Intergenic
1146551626 17:33785228-33785250 CTCTCTTCTTGGCTTGTAGATGG - Intronic
1146625344 17:34431047-34431069 TTTGGTTCCTGGCTTGCAGACGG - Intergenic
1146741613 17:35288945-35288967 CTGTCTTTCTGGTTAGTAGATGG - Intergenic
1147445353 17:40471956-40471978 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
1147462118 17:40579807-40579829 CCCTCTTCCTGGTTTGCAGATGG + Intergenic
1148019755 17:44545779-44545801 CTTCCTTCCTGGCTTGTAGATGG - Intergenic
1148571062 17:48669503-48669525 CCTGCTTCCTGGGTCGTAGATGG - Intergenic
1149381739 17:56101095-56101117 TTCACTTCCTGGATTGTAGAGGG - Intergenic
1149628736 17:58101730-58101752 CTTGCTTCTTGGTTCATGGATGG + Intergenic
1150650931 17:67009710-67009732 GTGGCTTCCTGGTTTATAGACGG + Intronic
1150900891 17:69275926-69275948 CTGTCTTCCTGGCTTGCAGAAGG - Intronic
1150967079 17:69983420-69983442 CTTCCTTCCTGCTTTGCATATGG - Intergenic
1151145447 17:72036297-72036319 CCTACTTCCTGGTTTGTAGGTGG + Intergenic
1151412102 17:73937762-73937784 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1151521053 17:74629856-74629878 CTGTCTTCCTGGCTTATAGATGG - Intergenic
1151725487 17:75881470-75881492 GCTGCTTCCTGGGTTGTAGATGG + Intronic
1151870607 17:76834014-76834036 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1152040787 17:77901297-77901319 CTCTCTTCCTGGCTTGCAGACGG - Intergenic
1152694962 17:81739434-81739456 CTTTCTCCCTGGCTTGTAGATGG + Intergenic
1152983862 18:304699-304721 CCTGCTTCCTAGTTCATAGATGG + Intergenic
1153087488 18:1304536-1304558 TTTGCTTCCTGATGTGCAGACGG + Intergenic
1153128867 18:1831636-1831658 CTGGCTTCCTGGGATGCAGATGG - Intergenic
1153408827 18:4770670-4770692 CCTGTTTTCTGGTTTATAGAGGG + Intergenic
1153424791 18:4950610-4950632 CTTGCTTCCTTGTTCATAGATGG - Intergenic
1153435253 18:5062039-5062061 CTCTCTTCCTGGCTTATAGATGG + Intergenic
1153509114 18:5833176-5833198 CCCTCTTCCTGGTTTGCAGATGG - Intergenic
1153720067 18:7892782-7892804 TTCTCTTCCTGGTTTGCAGATGG + Intronic
1153967887 18:10198107-10198129 CTGGCTTTCTGGTTCATAGATGG + Intergenic
1154213429 18:12398464-12398486 CCGGCTTCCTGGTTCTTAGATGG - Intergenic
1154336182 18:13466793-13466815 CCTGTTTCCTGGTTCATAGATGG + Intronic
1154380288 18:13843508-13843530 ACTGCTTCCTGGTTCATAGACGG + Intergenic
1155079765 18:22397385-22397407 CTTGCTTCCTGGTTCATAGATGG + Intergenic
1155128214 18:22901770-22901792 GCTTCTTCTTGGTTTGTAGATGG - Intronic
1155233429 18:23796041-23796063 CCTGCTTTCTGGCTTGTAGATGG - Intronic
1155343951 18:24840137-24840159 CTTGCTTTCTGGTTCACAGATGG - Intergenic
1155468653 18:26167720-26167742 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1155699815 18:28730211-28730233 CCTGCTTCCTGATTTATAGATGG - Intergenic
1155760471 18:29558928-29558950 CCTGCTTCCTGGTTTGCAGATGG - Intergenic
1156102663 18:33616734-33616756 CTTTCTTCCTGGCTTGTAGCTGG + Intronic
1156233164 18:35174571-35174593 CTCTCTTTCTGGTTTGTAGATGG - Intergenic
1156234685 18:35190815-35190837 GCTGCTTCCTGGTTCATAGATGG - Intergenic
1156257579 18:35412310-35412332 CTTCCCTCCTGTTTTGTTGAAGG + Intergenic
1156435196 18:37119475-37119497 CTCTCTTCCTGGCTTGTAGATGG + Intronic
1156461611 18:37324436-37324458 CTCTCTTCCTGGCTTGAAGATGG - Intronic
1156525967 18:37767700-37767722 CCTGCTTCCTGGTTCATAGATGG + Intergenic
1156684714 18:39630919-39630941 ATTCCTTCCTGGTTTGTTGTTGG - Intergenic
1156807923 18:41209267-41209289 CTCTCTTCCCGGTTTGCAGATGG - Intergenic
1156978553 18:43257109-43257131 CTCGCTCCTTGGTTTGTAGATGG - Intergenic
1157013976 18:43687196-43687218 CTCTCTTCTTGGTTTGTAGGAGG - Intergenic
1157216692 18:45789634-45789656 CTCTCTTCTTGGTTTGCAGATGG - Intergenic
1157383003 18:47236651-47236673 CTCTCTTCCTGGTTCATAGATGG - Intronic
1157423326 18:47564016-47564038 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1157524189 18:48366649-48366671 TATGTTTCCTGTTTTGTAGATGG - Intronic
1157630166 18:49087084-49087106 ACTGCTTCCTGGTTTATAGATGG - Intronic
1157772807 18:50364598-50364620 CCTGATTCCTGGTTGATAGATGG + Intergenic
1157884090 18:51349656-51349678 CTCCCTTCTTGGCTTGTAGATGG + Intergenic
1158031825 18:52975237-52975259 CTTTCTTCTTGGCTTGCAGATGG + Intronic
1158094477 18:53755224-53755246 CTTTCTTCCTGGCATGCAGATGG - Intergenic
1158203163 18:54962042-54962064 CCTGCTTCCTGGTTTGCAGATGG - Intergenic
1158360124 18:56663035-56663057 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1158399224 18:57105788-57105810 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1158473571 18:57760052-57760074 CCTTCTTGCTGGTATGTAGAGGG - Intronic
1158516964 18:58138690-58138712 CCTGCTTCCTGGTCTGCAGATGG + Intronic
1158743911 18:60175513-60175535 CCTGCTTTCTGGTTCATAGATGG + Intergenic
1158902984 18:61983757-61983779 CCTGCTTCGTGGTTCATAGACGG + Intergenic
1159101611 18:63964657-63964679 CTCTATTCCTGGTTTGCAGAAGG + Intronic
1159477712 18:68944468-68944490 CCTGCTTCCTGGTTGGCAGATGG + Intronic
1159516321 18:69463127-69463149 CCTGCTTCCCGGTTCATAGATGG + Intronic
1159534932 18:69703997-69704019 CTTTCTTCCTGGTTTGGAAATGG - Intronic
1159595378 18:70378095-70378117 CCTGCTTCCTGTTTCATAGACGG + Intergenic
1159611922 18:70535374-70535396 CTTTCTTCCTGGCGTGCAGAGGG + Intergenic
1160047371 18:75399668-75399690 CTTGCTGCCTGGATTTTAAAGGG + Intergenic
1160327596 18:77965425-77965447 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
1160327605 18:77965478-77965500 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
1160327612 18:77965531-77965553 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
1160327621 18:77965584-77965606 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
1160327630 18:77965637-77965659 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1160960967 19:1720647-1720669 CCTTCTGCCTGTTTTGTAGAAGG + Intergenic
1161462395 19:4406069-4406091 CCAGCTTCCTGGTCTGAAGAAGG - Intronic
1161486814 19:4540256-4540278 CTTGCTTCCTGATTTTTGGGGGG + Exonic
1161617786 19:5281832-5281854 CTTGCTTGCTGGATTGGAGGGGG - Intronic
1161638005 19:5401418-5401440 CTTTCTCCTTGGTTTGTAGATGG - Intergenic
1161760785 19:6170255-6170277 CTTGATGCCTAGTTTGTTGAGGG + Intronic
1161792387 19:6368239-6368261 CTCTCTTCCTGGCTTGCAGACGG + Intronic
1162010617 19:7811744-7811766 CCTGCTTCCTGATTCATAGATGG - Intergenic
1162300777 19:9843643-9843665 CCCACTTCCTGGCTTGTAGACGG + Intronic
1162396935 19:10422711-10422733 CTTGCTTCCTGGTGGGTAGAAGG - Intronic
1162636408 19:11971220-11971242 CCCGCTTCCTGGTTTGCAGATGG + Intronic
1162643283 19:12030110-12030132 CCTGCTTCCTGGTTTGCAGATGG - Intronic
1162673706 19:12282113-12282135 CCTGCTACCTGGTTTGAAGATGG - Intronic
1162679559 19:12330330-12330352 CCTGCTTCCAGGTTTAAAGATGG - Intronic
1163054724 19:14709733-14709755 CTCCCTTCCTGGCTTGCAGATGG - Intronic
1163112323 19:15169282-15169304 CTCTCTTCCTGGTGTGCAGATGG - Intronic
1163172395 19:15541328-15541350 CTTGCTCCCTGGCTTGCAGAAGG + Intronic
1163296995 19:16418823-16418845 CTCACTGCCTAGTTTGTAGACGG - Intronic
1165143465 19:33716891-33716913 CTTTCTCCTGGGTTTGTAGATGG + Intronic
1165344802 19:35238262-35238284 CTTTCTTCTTGGTGTGCAGATGG - Intergenic
1165451142 19:35884005-35884027 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
1165546140 19:36537988-36538010 CTGTCTTCCTGACTTGTAGATGG + Intronic
1165728657 19:38130304-38130326 CTGGCTTCCTGATTTCTGGAGGG - Intronic
1166119728 19:40678544-40678566 CTCTTTTCCTGGTTTGCAGATGG - Intronic
1166568050 19:43777077-43777099 CTTGCTTGCTTGTTTCGAGACGG - Intronic
1166753824 19:45178667-45178689 CTTGCTTCCTGATTGGTAGCCGG + Intronic
1167226193 19:48242291-48242313 CCTGCTTCCTTGTTCATAGACGG - Intronic
1167228066 19:48262988-48263010 CCTGCTTCCTTGTTCATAGACGG + Intronic
1167451758 19:49574660-49574682 CCCTCTTCCTGGTTTGCAGATGG + Intronic
1168315871 19:55484567-55484589 CTTGCGTCCTGGGTCGCAGATGG + Intergenic
1168474564 19:56666485-56666507 CTCACTTCCTGGCTTGCAGACGG - Intronic
1168474608 19:56666851-56666873 CTCTCTTCCTGGTTTACAGATGG - Intronic
1168475886 19:56674853-56674875 CTCTCTCCCTGGTTTGCAGATGG - Intergenic
1168521603 19:57055562-57055584 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1168580639 19:57553087-57553109 CTCTCTTCCTGGCTTGCAGATGG - Intronic
925264725 2:2559063-2559085 CCTACTTCCTGGCTTGGAGATGG - Intergenic
925456981 2:4024341-4024363 CACGCTTCCTGGTTTGTGCAAGG - Intergenic
925674390 2:6344949-6344971 CCTCCTTCTTGTTTTGTAGATGG - Intergenic
925690024 2:6512213-6512235 CTTTCTTCCTGGTTTGCACATGG - Intergenic
925693208 2:6546809-6546831 CCTGCTTTCTGGTTTATAGATGG - Intergenic
925771727 2:7288862-7288884 CTCTCTTCGTGGCTTGTAGATGG + Intergenic
925822867 2:7817778-7817800 CTCGCTTCCTGGCTTGTAGATGG + Intergenic
925833792 2:7923077-7923099 CCTGCTTCCTGGTTCATAGATGG + Intergenic
925842679 2:8007102-8007124 TCTGCTTCCTGGTTTGAAGATGG - Intergenic
926041976 2:9680787-9680809 TTGGCTTCCTGGTTTGTAAAAGG - Intergenic
926115592 2:10210894-10210916 CTCTCTTCTTGGCTTGTAGATGG - Exonic
926195551 2:10761644-10761666 CTCTCTGCCTGGCTTGTAGACGG + Intronic
926596326 2:14793128-14793150 CTTTCTTCCTGGCTTTCAGATGG - Intergenic
926727682 2:16011191-16011213 CTCTCCTCCTGGTTTGCAGATGG - Intergenic
926798364 2:16637460-16637482 CTGGCTTCCTGGCTTGCAGATGG - Intronic
926805064 2:16700756-16700778 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
926809467 2:16743610-16743632 CTTTCTTCTTGGCTTATAGATGG - Intergenic
926924723 2:17976010-17976032 CCCTCTTCCTGGTTTGCAGATGG - Intronic
926936609 2:18092196-18092218 CCCTCTTCCTGGTTTATAGAAGG + Intronic
927244171 2:20943449-20943471 CTCTCTTCCTGGTTTGCAGGTGG - Intergenic
927259991 2:21078612-21078634 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
927390156 2:22585911-22585933 CCTGCTTCCTGGTTTGCAGATGG + Intergenic
927432433 2:23038285-23038307 CTTCCTTCTTGGCTTGTAGATGG - Intergenic
927442202 2:23127150-23127172 CCTGCTTCTGGGTTTGCAGATGG + Intergenic
927814574 2:26203403-26203425 CATGCTGCCTGTTTTGCAGAGGG - Intronic
928066734 2:28172958-28172980 CTCTCTTCCTGGCTTGCAGATGG + Intronic
928188620 2:29139687-29139709 CTTTCTTCCTGGTTCTTGGAAGG + Intronic
928243336 2:29605637-29605659 CCTTCTTCCTGGCTCGTAGACGG - Intronic
928246421 2:29632610-29632632 CTCTCTTCCTGGCTTGCAGATGG - Intronic
928323934 2:30305092-30305114 CTGGCTGCCTAGTTTGCAGATGG + Intronic
928474226 2:31609058-31609080 CTTTCTTCTTGGGTTGCAGATGG - Intergenic
928528073 2:32162634-32162656 CTTTCTTCCTGGCTTGCAGATGG + Intergenic
928842516 2:35627307-35627329 CCTACTTCCTGGTTCATAGAAGG - Intergenic
929217073 2:39425585-39425607 CTCTCTTTCTGGCTTGTAGATGG - Intronic
929316084 2:40480442-40480464 CCTGCTTTCTGGTTTGTAGAGGG - Intronic
929985838 2:46731323-46731345 CCTGCTTCCTGGTTCAGAGATGG - Intronic
930250600 2:49030195-49030217 CTGGCTTACTGGCTTGTAGGGGG - Intronic
930312865 2:49763862-49763884 CCTGCTTCCTGGTTCATATATGG - Intergenic
930490549 2:52064584-52064606 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
930602878 2:53461659-53461681 CTTGCTTCCTGATTCATAGAAGG - Intergenic
930827062 2:55705455-55705477 CTCTCTTCCTGGCTTGTAGATGG - Intergenic
930948498 2:57106777-57106799 CTTTTTCCCTGGTTTCTAGATGG - Intergenic
931110413 2:59104763-59104785 TATTCTTCCTGGTTTGCAGATGG + Intergenic
931139855 2:59445520-59445542 CCTGCTGCCTGGTTTGTAACAGG + Intergenic
931446321 2:62330214-62330236 TCTGCTTCCTGGTTCATAGATGG + Intergenic
931603710 2:64030578-64030600 CTCTCTTCCTGGCTTGTAGATGG + Intergenic
931634880 2:64332144-64332166 CCTGCCTCCTGGTTCATAGATGG - Intergenic
931883426 2:66590393-66590415 CTTGCTTCCTGGCTTGCAGTTGG - Intergenic
932020286 2:68077748-68077770 CTCTCTTCCTGGCTTGCAGATGG + Intronic
932039890 2:68288042-68288064 CTTGCTGGCTGGTTTGCAGCCGG + Intronic
932572107 2:72943524-72943546 CTTCCTTCCTGGTCTGCAAATGG + Exonic
932634808 2:73378871-73378893 CCCTCTTCCTGGCTTGTAGAGGG + Intergenic
932837683 2:75052286-75052308 CCTGCTTCCTGGTTCATGGATGG - Intronic
932855712 2:75232168-75232190 CCTACTTCCTGGTTCATAGATGG + Intergenic
932890628 2:75593623-75593645 CTGTCTTCCTGATTTGCAGATGG - Intergenic
933073328 2:77890203-77890225 CCTTCTTCCTGGTTTGTAAATGG - Intergenic
933196110 2:79391897-79391919 CTCTCTTCCTGGCTTGCAGATGG + Intronic
933588829 2:84209069-84209091 CTTGCTCCTTGGCTTGCAGATGG + Intergenic
933949188 2:87313770-87313792 CTCCCTTTCTGGTTTGCAGATGG + Intergenic
934944689 2:98530962-98530984 CCAGCTTCCTGGTTTGCAGATGG + Intronic
935179585 2:100677539-100677561 CCTGATTCCTGGTTCATAGACGG + Intergenic
935280362 2:101512128-101512150 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
935281582 2:101522408-101522430 ACTGCTTCCTGGCTTGCAGATGG + Intergenic
935382481 2:102466590-102466612 CTCTCTTCCTGACTTGTAGATGG - Intergenic
935500633 2:103834233-103834255 CTTGTATCCTGGGTTGTAGAGGG + Intergenic
935581949 2:104763567-104763589 CTTTCTTCCTGGTTTGCAGATGG - Intergenic
935607031 2:104981728-104981750 CCTCCTTCCTGATTTATAGATGG + Intergenic
935660019 2:105458642-105458664 CTTGTTTCCTGGTTCATAGATGG + Intergenic
935685308 2:105677806-105677828 CTTTCTTCCTGGCTCATAGATGG - Intergenic
935716449 2:105943476-105943498 TTCGCTTCCTGGTTCATAGATGG + Intergenic
935730743 2:106063255-106063277 CCTGCTTCCTGCTTCCTAGATGG - Intronic
935802928 2:106716561-106716583 CCTGCTTCCTGGCTTGCAGATGG - Intergenic
935897219 2:107750459-107750481 CTTGCCTTCTGGTTTCTAGGTGG - Intergenic
936087261 2:109477738-109477760 CTGGCTTCCTGGTTCATAGACGG + Intronic
936238312 2:110765648-110765670 CTTGCTTTCTGGTTCATAGATGG + Intronic
936291832 2:111231663-111231685 CTGGCTTCCTGGTTCACAGATGG + Intergenic
936300111 2:111298456-111298478 CCTATTTCCTGGTTTATAGATGG - Intergenic
936331009 2:111547827-111547849 CTCCCTTTCTGGTTTGCAGATGG - Intergenic
936777078 2:115986649-115986671 CTCTCTTCCTGGCTTGTAGATGG + Intergenic
936892903 2:117392942-117392964 CTCTCTTCCTGGCTTTTAGAAGG + Intergenic
937018305 2:118627298-118627320 CTTTCTTCCTGGCTTATAGATGG - Intergenic
937332959 2:121043578-121043600 CTCCCTTCCTGGCTTGCAGATGG - Intergenic
937339519 2:121082265-121082287 CCTGCTTCCTGGTTCACAGACGG + Intergenic
937393971 2:121518389-121518411 CTCTCTTCCTGGCTTGTAGATGG - Intronic
937442395 2:121927749-121927771 CCTGCCTTCTGGTTTGCAGAAGG + Intergenic
937442626 2:121929874-121929896 CTTGGTGCCTGGCTTGTAGGAGG + Intergenic
937509581 2:122578956-122578978 CTCTCTTCCTGGCTTGTAGATGG - Intergenic
937527328 2:122787434-122787456 CTCTCTTCCTGGTTTGTAGATGG - Intergenic
937783779 2:125870845-125870867 CCTGCTTCCTGGTTCATAGGAGG + Intergenic
937946525 2:127343523-127343545 CCTGATTGCTGATTTGTAGAAGG - Intronic
937972571 2:127561916-127561938 CTCTCTTCCTGGCTGGTAGATGG + Intronic
938079376 2:128361490-128361512 CCTGCTTCCTGGTTTGCTGGTGG - Intergenic
938197492 2:129342132-129342154 CTTTCTTCCTGGCTTGCAGATGG - Intergenic
938629305 2:133148673-133148695 CTCTCTTCCTGGTTTACAGATGG + Intronic
939114999 2:138050383-138050405 TTTGCTTTCTGGTTCATAGATGG + Intergenic
939342647 2:140918782-140918804 CACTCTTCCTGGTTTGCAGATGG - Intronic
939368221 2:141263611-141263633 CTTTCTTTCTGTTTTCTAGAAGG - Intronic
939446919 2:142321999-142322021 CTGTCTTCCTGCCTTGTAGAGGG + Intergenic
939607305 2:144268515-144268537 CTTGCTTCCTGGTTAGCAGATGG - Intronic
940127161 2:150339236-150339258 CCTGTTTCCTGGTTCATAGATGG - Intergenic
940159126 2:150692770-150692792 CTCGCTTCCGGGCTTGCAGATGG - Intergenic
940258335 2:151755858-151755880 CTCTCTTCATGGTTTGCAGATGG - Intergenic
940740516 2:157502545-157502567 CCCTCTTCCTGGTTTGCAGATGG + Intergenic
940778311 2:157907136-157907158 CTCCCTTCCTGGCTTATAGATGG + Intronic
940794294 2:158060814-158060836 CTCTCTTCCTGACTTGTAGATGG - Intronic
941262382 2:163313984-163314006 CCCTCTTCCTGGTTTATAGATGG - Intergenic
941555313 2:166972181-166972203 CACTCTTCCTGGTTTGCAGAAGG - Intronic
941815603 2:169792591-169792613 CCTGCTTCCTGGTTTGCAGATGG - Intronic
942181455 2:173384756-173384778 CTTCCTTCTTGGCTTGTCGATGG + Intergenic
942201223 2:173573337-173573359 CCTGCTTCCTGGTTTGCAGATGG - Intergenic
942222160 2:173780754-173780776 CCCACTTCCTGGTATGTAGATGG - Intergenic
942594838 2:177583131-177583153 CTGTCTTCCTGCTTTGCAGATGG + Intergenic
942650191 2:178158353-178158375 CACACTTCCTGGTTTGCAGATGG + Intergenic
942832137 2:180250213-180250235 CTTGCTTTCTGGCTTCTAGGTGG + Intergenic
942855656 2:180543999-180544021 CTTACTTCCTGGTTCATAGATGG - Intergenic
943186142 2:184609614-184609636 CCTGCTTCCTGGTTTGCATGTGG + Intronic
943242190 2:185399530-185399552 CTTGGTCCTTGGCTTGTAGATGG - Intergenic
943264313 2:185708005-185708027 CTTGATGCCTAGTTTGTTGAGGG - Intergenic
943313864 2:186361112-186361134 CCTGCTTCCTGGTTCATAGATGG - Intergenic
943954297 2:194166986-194167008 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
944427355 2:199597171-199597193 CTCCCTTCCTGGCTTGTAGATGG - Intergenic
944854304 2:203751765-203751787 CCTGTTTCCTGTTTTGCAGATGG + Intergenic
944913984 2:204338798-204338820 CTTTCATCCTGGCTTCTAGAAGG - Intergenic
944965492 2:204927388-204927410 CCTGCTTTCTGGTTCATAGATGG - Intronic
945448958 2:209971778-209971800 ATTGTTTCCTGGCTTGAAGAAGG + Intronic
945524755 2:210874429-210874451 CCTGCTTCCTGGGTCATAGATGG + Intergenic
945552307 2:211235556-211235578 CTTGCTGGATGGTTTGCAGATGG + Intergenic
945664624 2:212725418-212725440 CCTGCTTCCTGGTTCATAGATGG + Intergenic
945837884 2:214853967-214853989 TTTGCTTCCTGGTTTGCAAATGG - Intergenic
945936823 2:215910969-215910991 CTATCTTCCTGGTATGGAGAGGG + Intergenic
946132211 2:217615363-217615385 CTTCCTTCATGGTTTCAAGAGGG - Intronic
946270266 2:218586420-218586442 CTCTCTTCCTGGCTTGTAGATGG - Intronic
946298333 2:218804929-218804951 CTGTCTTCCTGGCTTGTAGTTGG + Intronic
946501817 2:220257237-220257259 CTTTCTTCCTGGCTTGCAGATGG + Intergenic
946637706 2:221747896-221747918 CTTGTTTTCTGGCTTATAGATGG - Intergenic
946667751 2:222068557-222068579 CTCTCTTCCTGGTTTGCAGGTGG + Intergenic
946782065 2:223202112-223202134 CCTACTTCCTGGTTCATAGATGG + Intergenic
946866558 2:224046149-224046171 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
947080453 2:226390045-226390067 CTTGGTTCCTTGATTGCAGAAGG - Intergenic
947153703 2:227139145-227139167 CCTGCTTCCTGGTGTGCAGATGG - Intronic
947235307 2:227935338-227935360 CTTGCTCCCTGGCTGGCAGATGG - Intergenic
948106415 2:235417721-235417743 CTTGCGTCCTGGCTTGGTGATGG - Intergenic
948146730 2:235713840-235713862 CCTGCTTGCTGGTTCGTAGGTGG + Intronic
948281540 2:236751055-236751077 CCTGCTTTCCGGTTTATAGATGG + Intergenic
948439959 2:237980381-237980403 CTCTCTTCCTGGCTTGCAGATGG + Intronic
948668366 2:239550644-239550666 CCTGCTTCCTGGTTCACAGATGG + Intergenic
948726669 2:239938450-239938472 GTTGCTTCCTGGTTTGTCAGAGG + Intronic
949067152 2:241999049-241999071 CTTTCTTCCTGGGTTGTCGATGG + Intergenic
1168864135 20:1070256-1070278 CTTCCTTCCTGGCTTACAGAGGG - Intergenic
1168884152 20:1233614-1233636 CCTGCTTCCTGATTCATAGATGG + Intronic
1168895096 20:1318882-1318904 CTCCCTTCCTGGCTTGCAGATGG - Intronic
1168934968 20:1657119-1657141 CTTTCTCCTTGGCTTGTAGAAGG - Intronic
1168938104 20:1685482-1685504 CTTTCTTACTGGCTCGTAGATGG - Intergenic
1168993668 20:2116230-2116252 CTTTTTTCCTGACTTGTAGAAGG - Intronic
1169076274 20:2761553-2761575 CTCTCTTCCTGGTTTGCAGACGG - Intergenic
1169078942 20:2782781-2782803 CTCTCTTCTTGGCTTGTAGATGG + Intergenic
1169296680 20:4406012-4406034 CCTGCTTTTTGGTTTGCAGAAGG + Intergenic
1169300650 20:4439337-4439359 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1169366643 20:4997976-4997998 CTTTCTTCCTGGCTTGTAGGTGG - Intronic
1169408508 20:5347002-5347024 CCTGCTTCCTGGTTTGCAGATGG + Intergenic
1169474686 20:5920475-5920497 CCCACTTCCTGGCTTGTAGATGG + Intronic
1169769035 20:9181560-9181582 CCCTCTTTCTGGTTTGTAGATGG + Intronic
1169990221 20:11494553-11494575 CCTGTTTCCTGGTTCATAGATGG - Intergenic
1170497846 20:16944171-16944193 CCTACTTCCTGGTTTGCACATGG - Intergenic
1170712687 20:18806654-18806676 CCCGCTTCCTGGCTGGTAGATGG + Intergenic
1170742224 20:19068182-19068204 CTCTCTTCCTGGTTTGCAGGTGG + Intergenic
1170882901 20:20313237-20313259 CTCTCTTTCTAGTTTGTAGATGG - Intronic
1171197209 20:23209032-23209054 TCTGCTTCCTAGTTTGCAGATGG - Intergenic
1172452931 20:35041046-35041068 CTTTCTTCCTGGCTTGTAGAAGG - Intronic
1172487571 20:35307545-35307567 CTTGCTTCCTGGGGTGAAGGTGG + Intronic
1172715623 20:36961308-36961330 CTCTCTTCCTGATTTGCAGAAGG - Intergenic
1172769909 20:37375872-37375894 CTCTCTTCCTGGTTTGCAAACGG + Intronic
1172911959 20:38416167-38416189 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1173420307 20:42895255-42895277 CTTGCTTCCTGGCTGGCAGATGG + Intronic
1173480386 20:43393926-43393948 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1173543004 20:43868709-43868731 CTCACTTCCTGGCTTGCAGATGG - Intergenic
1174064786 20:47856571-47856593 CTGTCTTCTTGGCTTGTAGATGG + Intergenic
1174134121 20:48367320-48367342 CTTGGTTCCTCATGTGTAGAAGG + Intergenic
1174296757 20:49550890-49550912 TTTTTTTCCTGCTTTGTAGATGG + Intronic
1174326755 20:49785334-49785356 CATGGTTCATGGTTTGTACAAGG - Intergenic
1174697989 20:52579599-52579621 CTCCCTTCCTGGTTTGCAGATGG + Intergenic
1174847426 20:53956326-53956348 CTCTCTTCCTGGTTTGTAAATGG - Intronic
1175297272 20:57917420-57917442 CTATCTTCCTGGCTTGCAGACGG + Intergenic
1175447149 20:59031031-59031053 CCTGCTTCCTGTTTGGTAGATGG + Intronic
1175588807 20:60170388-60170410 CTCTCTTCCTGGCTTGTGGACGG - Intergenic
1175595092 20:60224691-60224713 CCGGCTTCCTGGTTCCTAGACGG - Intergenic
1176582174 21:8541911-8541933 CTGTCTTCCTGGTTTACAGATGG - Intergenic
1176937678 21:14885332-14885354 CCCTCTTCCTGGTTTGCAGAAGG - Intergenic
1176997735 21:15576832-15576854 CTTGCTCCCTAACTTGTAGACGG + Intergenic
1177094075 21:16809426-16809448 CTTGCTTTCTGGTTCATAGACGG - Intergenic
1177103380 21:16922926-16922948 CTTTCTTCCTGGCTTGTAGATGG - Intergenic
1177203618 21:17985911-17985933 CCTACTTTCTGGTTTGAAGATGG + Intronic
1177220468 21:18185794-18185816 CTTGCTTCCTGGTTTGTAGATGG + Intronic
1177378085 21:20299682-20299704 CCTACTTCTTGGTTCGTAGATGG - Intergenic
1177423324 21:20890502-20890524 CCTGCTTTCTGATTTATAGATGG - Intergenic
1177438262 21:21084088-21084110 CTCACTTCCTGGTTTGTAGAAGG + Intronic
1177708279 21:24737484-24737506 TTTGCTTCCCGGTTTATAGATGG - Intergenic
1177735411 21:25082919-25082941 CTCTCTTCCTGGTTCATAGACGG + Intergenic
1177774583 21:25553792-25553814 CTTTCTTCCTGACTTGCAGATGG - Intergenic
1177804622 21:25862279-25862301 CATGCTTCCTGGTTCACAGATGG + Intergenic
1177871644 21:26580133-26580155 CTTGATCCCTAGTTTGTTGAGGG + Intergenic
1177949181 21:27512341-27512363 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1178014807 21:28331973-28331995 CTCTCTTTCTGGTTTGTAGATGG - Intergenic
1178168223 21:30007429-30007451 CTTGCTTCCTGCCTCATAGATGG + Intergenic
1178173771 21:30073648-30073670 CTCGCTTCTTGGTTCATAGAAGG + Intergenic
1178374074 21:32051919-32051941 CCTGCTTCCTTGTTCATAGATGG + Intergenic
1178458288 21:32776553-32776575 TCTGCTTCCTGGTTCATAGATGG + Intergenic
1178462332 21:32814345-32814367 TCTGCTTCCTGGTTCATAGATGG + Intergenic
1178512057 21:33213777-33213799 CTCTCTTCCTGGCTTGTGGATGG + Intergenic
1178711930 21:34924847-34924869 CCTGCTTCCTGGTTTGCATATGG + Intronic
1178846044 21:36175023-36175045 CTCGCTGCCTGGCTTGGAGATGG + Intronic
1178969750 21:37162861-37162883 CCTGCTTTCTGGTTCATAGATGG + Intronic
1179188643 21:39105056-39105078 CTCACTTCCTGGTTTGCAGGTGG + Intergenic
1179368809 21:40784764-40784786 CCTGCTTCCTGGTTCGTAGATGG - Intronic
1179503283 21:41823118-41823140 CTCACTTCCTGGTTCGTAGACGG - Intronic
1179604341 21:42503813-42503835 CTGGCTTTCCTGTTTGTAGAGGG - Intronic
1179877840 21:44280369-44280391 CCTGTTTCCTGGTTCCTAGATGG + Intergenic
1180265009 22:10518959-10518981 CTGTCTTCCTGGTTTACAGATGG - Intergenic
1181262711 22:21610132-21610154 CCGGCTTCATGGTTTATAGATGG + Intronic
1181303636 22:21901372-21901394 CCTGTTTCCTGGTTTGTAGACGG + Intergenic
1181411999 22:22730660-22730682 CTTCCTTCCTGGTTCATAGACGG - Intergenic
1182108802 22:27708179-27708201 CTGGCTTCCTGGTTCAGAGATGG + Intergenic
1182678910 22:32062982-32063004 CTCTCTTCCTGGCTTGTAGACGG + Intronic
1182782494 22:32879471-32879493 CCTGCTTTCTGGTTTGTAGATGG + Intronic
1182940032 22:34268011-34268033 CTCTCTTCCTGGCTTGTAGATGG - Intergenic
1183004339 22:34888630-34888652 CTTTCTTCCTGGCTCATAGATGG + Intergenic
1183006707 22:34909037-34909059 CTTGCTCCTTGGCTTGTAGATGG + Intergenic
1183011489 22:34950427-34950449 CCCTCTTCCTAGTTTGTAGATGG - Intergenic
1183337992 22:37261682-37261704 CCTGCTTTCTGGTTCATAGATGG - Intergenic
1183346733 22:37312241-37312263 CTTGCTTCCTTATCTGTAAAGGG + Intronic
1183497992 22:38161299-38161321 TTCACTTCCTGGTTTGCAGATGG + Intronic
1183646951 22:39132518-39132540 CTTGTTTTCTGGTTTGTACAAGG - Exonic
1183897310 22:40979705-40979727 CTCTCTTCCTGGCTTGTAGACGG + Intergenic
1183941635 22:41298947-41298969 CCGCCTTCCTGGTTTATAGATGG + Intergenic
1184006079 22:41710210-41710232 CTCTCTTCCTGGCTTGCAGACGG - Intronic
1184495813 22:44840776-44840798 CCTGCTTCCTGGTTCATAGATGG + Intronic
1184538933 22:45107013-45107035 CTCCCTTCCTGGTTTGCAGATGG - Intergenic
1184970144 22:48013854-48013876 CTTGCTTCCTGGTTCACAGACGG - Intergenic
1184989640 22:48158150-48158172 CCTGCTGTCTGGTTTGGAGAGGG + Intergenic
1185201817 22:49511528-49511550 CCCGCTTCCTGGTTCATAGATGG - Intronic
1185307865 22:50131978-50132000 ACTGCTTCCTGGTTCGTAGGCGG + Intronic
949130144 3:490111-490133 GATGCTTCCTGGTTTGCAAATGG + Intergenic
949338715 3:3005632-3005654 CCTGCCTCCTGGTTTGGAAATGG + Intronic
949586381 3:5442536-5442558 CTCTCTTCCTGGTTTGTAGATGG - Intergenic
949691481 3:6644809-6644831 TCTGCTTCCTGGCTTGCAGATGG - Intergenic
949873110 3:8606217-8606239 CCTGCTTCCTGGTTTGCAGATGG + Intergenic
949931537 3:9082421-9082443 CTTGCTTCCTGGTTCATAGAGGG - Intronic
950327570 3:12126253-12126275 CTTGCTTCTTGGTTTGCCAATGG - Intronic
950394490 3:12723419-12723441 CTCTCTTCCTGGCCTGTAGATGG - Intergenic
950688457 3:14636205-14636227 CTTGCTTCCCGGTTTGCAGATGG - Intergenic
950703076 3:14763341-14763363 GCTGCTTCCTGGTTCATAGATGG + Intronic
950778524 3:15371533-15371555 CTCCCTTCCTGGCTTGCAGATGG + Intergenic
950860324 3:16142084-16142106 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
950884799 3:16353803-16353825 CTCTCTTCCTGGCTTGCAGATGG - Intronic
951430491 3:22601403-22601425 CTGTTTTCCTGGTTTGTAGGGGG - Intergenic
951752705 3:26055132-26055154 CTTGCTCTCTGGTTTATAGATGG + Intergenic
951942198 3:28091881-28091903 CCCACTTCCTGGTTTGTAGATGG - Intergenic
951966955 3:28398171-28398193 ACTGCTTCCTGGTTTTCAGATGG + Intronic
952029288 3:29121223-29121245 CTCTCTTCCTGGTTTATAGAGGG + Intergenic
952042191 3:29274383-29274405 CTTGCCTCCGGGTTTGCAGAAGG + Intergenic
952079579 3:29741805-29741827 CTTTCTTCTTGGCTTGTAAATGG + Intronic
952378528 3:32786624-32786646 CTCTCTTCCTGGCTTATAGATGG + Intergenic
952540892 3:34366614-34366636 CTGTCTTCTTGGATTGTAGATGG - Intergenic
952582624 3:34852600-34852622 CTCTCTTCCTGGCTTGTAGATGG + Intergenic
952590604 3:34948938-34948960 CTTTCTTCCAGGATTGCAGATGG + Intergenic
952706997 3:36389305-36389327 CCTGTTTCCTGGTTTATAGATGG + Intronic
952760043 3:36905477-36905499 CTGTCTTCCTGGCTTGTAGATGG - Intronic
952863126 3:37831364-37831386 CCCGCTTTCTGGTTTATAGATGG + Intergenic
952944548 3:38469038-38469060 CTTGGTTCCTTGTTTCTAGGCGG + Intronic
953010130 3:39017206-39017228 CTCACTTTCTGGTTTGCAGAAGG - Intergenic
953024575 3:39137467-39137489 CTTCCTACCTGGTGTGTAGAAGG + Exonic
953190764 3:40685412-40685434 CTTTCTCCTTGGCTTGTAGAAGG + Intergenic
953242341 3:41160696-41160718 CCTGCTTCCTGGTTCATAGATGG - Intergenic
953367899 3:42362538-42362560 CTTGCTTTCTGTTTCATAGATGG + Intergenic
953463155 3:43097433-43097455 TTCTCTTCCTGGCTTGTAGATGG + Intronic
953616402 3:44494294-44494316 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
955017396 3:55085588-55085610 CTCTCTTCCTGGTTTGCACATGG + Intergenic
955351716 3:58198333-58198355 CTCTCTCCTTGGTTTGTAGACGG - Intronic
955912782 3:63874941-63874963 CTTGTTTCCTGTTTCATAGAAGG + Intronic
955943919 3:64172877-64172899 TTTTCTTCCTGGCTTGCAGATGG - Intronic
955952679 3:64257977-64257999 TTTGCTTTCTGGTTCATAGATGG - Intronic
956296688 3:67722606-67722628 CTTTCTTCCTGGTTTGCAGATGG - Intergenic
956379191 3:68647883-68647905 CCCTCTTCCTGGTTTGCAGATGG - Intergenic
956381394 3:68668067-68668089 CTCTGTTCCTGGTTTGCAGATGG + Intergenic
956382561 3:68680704-68680726 CTTTCTTCCCAGCTTGTAGATGG + Intergenic
956470301 3:69559504-69559526 CTTGCTTCCTGGTTCATAGATGG - Intergenic
956720782 3:72115583-72115605 CTCTCTTCCTGGCTTGTAGGCGG + Intergenic
956791539 3:72683890-72683912 CTTGCTTCATGGTTGCAAGATGG + Intergenic
956820098 3:72946557-72946579 CCTGCTTCCTGATTCATAGATGG + Intronic
956931304 3:74046414-74046436 CTCTCTTCTGGGTTTGTAGATGG - Intergenic
956991852 3:74775646-74775668 CCCTCTTCCTGGTTTGCAGATGG - Intergenic
957184495 3:76924414-76924436 CCTGCTTCCTGGTTCACAGATGG - Intronic
957377161 3:79372664-79372686 CATTCTTCCTGGCTTGTGGATGG - Intronic
957428313 3:80069271-80069293 TTGGCTTCCTGGTTTAGAGAAGG + Intergenic
957499007 3:81028831-81028853 CTTTCTCCTTGGTTTGTAGATGG + Intergenic
957629329 3:82698288-82698310 CTCTCTTCCTGGTTTTTAGTTGG + Intergenic
957973743 3:87416951-87416973 CTTTCTTCCTAGTTTATAGATGG - Intergenic
958063930 3:88518905-88518927 TTTGATGCCTGGTTTGTTGAGGG + Intergenic
958140816 3:89559916-89559938 CTTGCTCCACAGTTTGTAGACGG + Intergenic
958167106 3:89890162-89890184 CTTGTTTCCTGGTTTGCAGATGG + Intergenic
958485163 3:94696311-94696333 TGTGCTTTCTGGTTTGTAAAAGG - Intergenic
958547616 3:95574593-95574615 CTTGCTTCCTGGATTTGAGCTGG + Intergenic
958573827 3:95921694-95921716 CTTCCTTCCTTGCTTGTATATGG - Intergenic
958740974 3:98071087-98071109 CTCTCTTCCTGGCTTGCAGACGG - Intergenic
958812268 3:98874821-98874843 CTCTCTTCCTGGCTTGTAGATGG - Intronic
958953048 3:100436961-100436983 CTCTCTTCCTGGCTTGCAGATGG - Intronic
959127110 3:102302966-102302988 CCTGCTTCCTGGTTCGCAGGAGG - Intronic
959338671 3:105099316-105099338 TTTTCTTCGTGGTTTGCAGATGG - Intergenic
959517906 3:107290480-107290502 TCTGCTTCCTGGTTCATAGATGG - Intergenic
959677262 3:109050376-109050398 CTTGCTTCCTGGTTCTTAGATGG + Intronic
959916178 3:111819054-111819076 CACTCTTCCTGGCTTGTAGATGG + Intronic
960143422 3:114173161-114173183 CCTGCTTTCTGGTTCATAGATGG - Intronic
960447658 3:117767177-117767199 GCTGCTTCATGGTTTGTAGATGG - Intergenic
960558860 3:119059788-119059810 ATTGCTTCCTGGTTGCTAGAGGG - Intronic
960904741 3:122589177-122589199 CTCTCATCCTGGTTTGTCGATGG + Intronic
961067396 3:123887595-123887617 CCCTCTTTCTGGTTTGTAGACGG + Intergenic
961198791 3:125027313-125027335 CTTTCTTCCTGCTTTGGAGATGG - Exonic
961262084 3:125610065-125610087 CTCTCTCCTTGGTTTGTAGATGG + Intergenic
961769086 3:129235425-129235447 CCTGTTTCCTGGTTTGTAGATGG + Intergenic
961958984 3:130834154-130834176 CTCTCTCCCTGGCTTGTAGATGG + Intergenic
962073846 3:132059569-132059591 CTCTTTCCCTGGTTTGTAGATGG + Intronic
962107583 3:132408072-132408094 CTCTCTTTCTGGTTGGTAGATGG - Intergenic
962477606 3:135770100-135770122 CGCTCTTCCTGGTTTGCAGATGG + Intergenic
962620995 3:137178756-137178778 CTTACTTTCTGTTTTGAAGATGG + Intergenic
963269688 3:143273487-143273509 CTGTCTTCCTGGCTTGCAGATGG - Intronic
963293650 3:143520383-143520405 CTCTCTTCCTGGTTTGCAGGTGG - Intronic
963357849 3:144232638-144232660 CTCTCTTCCTGGCTTGCAGAAGG - Intergenic
963478694 3:145839940-145839962 TTCTCTTCCTGGTTTGCAGATGG + Intergenic
963905168 3:150767600-150767622 CTTGCTTCCTGGTTTGTAGATGG + Intergenic
963987907 3:151618203-151618225 CTCTCTTCCTGGTTTGCTGATGG - Intergenic
964015861 3:151945631-151945653 CTTGTTTCCTGGCTCATAGATGG - Intergenic
964190579 3:153995881-153995903 CTTTCTTCTTGGCTTGCAGAAGG + Intergenic
964209975 3:154215668-154215690 CTGGTTTCCCGGTTTGCAGATGG + Intronic
964253459 3:154747501-154747523 CTTTCTTCCTGGATTGCAGATGG - Intergenic
964261122 3:154838328-154838350 CTTTCTTCCTGTTTTGTGCATGG + Intergenic
964458856 3:156898477-156898499 CCTGCTTCCTGGTTCACAGATGG - Intronic
964767281 3:160191157-160191179 CCTTCTTTCTGGTTTGCAGATGG - Intergenic
964802402 3:160570078-160570100 CTCACTTCCTGGTTTGGAGATGG + Intergenic
965210657 3:165782788-165782810 CCTGCTTTCTGGTTCATAGATGG + Intronic
965303119 3:167028985-167029007 CTTTCTTCCTGGTTTGCAGATGG + Intergenic
965308610 3:167100002-167100024 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
965327942 3:167331034-167331056 TTTACTTCCTGGCTTTTAGATGG - Intronic
965367613 3:167820136-167820158 CTCCCTTCTTGGTGTGTAGATGG + Intronic
965417566 3:168415916-168415938 CACTCTTCCTGGTTTGCAGAAGG + Intergenic
965475584 3:169150868-169150890 TTTTCTTCCTGGTTTGAAAAGGG + Intronic
965756422 3:172032312-172032334 CCTGACTCCTGGTTTGCAGATGG - Intergenic
965767144 3:172142893-172142915 CCTGCTTTCTGGTTCATAGATGG + Intronic
965780148 3:172277367-172277389 CTGTCTTCCTGATTTATAGATGG + Intronic
965824945 3:172720797-172720819 CTTTCTTTCTCCTTTGTAGATGG - Intergenic
965928205 3:174009102-174009124 CCTGCTTCCTGGTTCATAGATGG + Intronic
965936818 3:174124107-174124129 CTCTCTTTCTGGCTTGTAGATGG - Intronic
965995471 3:174876935-174876957 CTCTCTTCCTGGCTTGCAGATGG + Intronic
966042753 3:175511485-175511507 ATTTCTTCCTGGCTTGCAGATGG - Intronic
966183625 3:177208999-177209021 CCTACTTCCTGGTTAATAGATGG + Intergenic
966313496 3:178620515-178620537 CTTGCTCCCTGGTTCATAGACGG + Intronic
966507802 3:180726660-180726682 CTCTCTTCCTGCTTTGCAGACGG + Intronic
966660173 3:182405708-182405730 CTCTCTCCCTGGTTTGTAGATGG - Intergenic
966774531 3:183532282-183532304 CTCCCTTCCTGGCTTGCAGACGG - Intronic
966822508 3:183936221-183936243 CCGTCTTCCTGGTTTGCAGATGG - Intronic
967186916 3:186951889-186951911 CTTGCTTCCTAATTTATGGATGG + Intronic
967259368 3:187626807-187626829 CCTGCTTCCTGGTTCACAGATGG - Intergenic
967508044 3:190276218-190276240 CTAGCTTTCTGGTTCGTAGATGG + Intergenic
967579750 3:191138006-191138028 CACTCTTCCTGGTTTGTAGATGG + Intergenic
967715080 3:192753331-192753353 CTTTCTTCCTGACTTGCAGATGG - Intronic
967742542 3:193018995-193019017 CTTGCTCCTTGGCTTGCAGACGG + Intergenic
967769539 3:193319511-193319533 CTTTCTTTCTGGTTTGCAGATGG - Intronic
967787011 3:193508125-193508147 CTCTCTTCCTGGCTTGAAGAAGG - Intronic
967820784 3:193836967-193836989 CTTCCTTCCCGGCTTGTAGCCGG + Intergenic
967992388 3:195141040-195141062 CCTACTTCCTGGTTTGCAGATGG - Intronic
968046462 3:195626409-195626431 CTCTCTTCCTGGCTTGTGGAGGG + Intergenic
968308191 3:197663682-197663704 CTCTCTTCCTGGCTTGTGGAGGG - Intergenic
968947420 4:3672664-3672686 CTCCCTTCCTGATTTGCAGACGG + Intergenic
969081363 4:4621140-4621162 CTCACTTCCTGGTTTATAGATGG + Intergenic
969101409 4:4771575-4771597 CTCTCTTCCTGGCTTATAGATGG + Intergenic
969256717 4:6007437-6007459 CCTGCTTCCTGGTTCACAGATGG - Intergenic
969345747 4:6568757-6568779 CTCGCTTCTTGGCTTGTAGATGG - Intergenic
969356606 4:6631243-6631265 CTGTCTTCCTGGTTTGCAAATGG + Intergenic
969391805 4:6896310-6896332 CTCACTTCCTGGTTCCTAGATGG - Intergenic
969467183 4:7364637-7364659 CTTGCATTCTGTTTTGTGGAGGG - Intronic
969547121 4:7837440-7837462 CCTGCTTCCTGGTTCACAGATGG - Intronic
969999444 4:11349860-11349882 CTGTCTCCCTGGCTTGTAGATGG + Intergenic
970075093 4:12209260-12209282 CTTGCTTTCTGCTTCATAGATGG + Intergenic
970145081 4:13027574-13027596 CTCCCTTCTTGGCTTGTAGATGG + Intergenic
970225747 4:13855257-13855279 CATACTTCCTGATTGGTAGATGG - Intergenic
970376470 4:15462671-15462693 TTCCCTTCCTGGCTTGTAGATGG - Intergenic
970429353 4:15974587-15974609 CTAGTGTCCTGGTTTGCAGAAGG + Intronic
970725274 4:19036559-19036581 CTTTCTTCCTGGCTTGCAGATGG - Intergenic
970968433 4:21953815-21953837 CTCTCTTCCTGGCTTGCAGACGG - Intergenic
971118033 4:23670410-23670432 CCTGCTTCCTGGTTCATAGATGG + Intergenic
971232762 4:24813207-24813229 CCTTCTTCCTGTTTTGCAGATGG - Intronic
971246692 4:24935622-24935644 CTTGCTCTCTGGTTCATAGATGG - Intronic
971357150 4:25905499-25905521 CCTGCTTCCTGTTTTCCAGATGG - Intronic
971361102 4:25939431-25939453 CTTTCTCCTTGGCTTGTAGATGG - Intergenic
971376533 4:26060096-26060118 CCCGCTTCCTGGTTTGCAGATGG - Intergenic
971490174 4:27203699-27203721 CTAACTTCCTGGTTCATAGATGG - Intergenic
971584553 4:28388584-28388606 CTTTCTTTGTGGTTTGTAGATGG - Intronic
971711063 4:30113200-30113222 CTCTCTTCCTGGTTTGCAAATGG + Intergenic
971821068 4:31555961-31555983 CCCACTTCCTGGTTTTTAGAGGG - Intergenic
971852693 4:32003743-32003765 CTTGTTTCCTGGGCTGCAGATGG - Intergenic
972098758 4:35384001-35384023 CTTTCTTCTTGGTTTGCAGATGG - Intergenic
972239699 4:37177272-37177294 CCTGCTTGCTGGTTCATAGAGGG + Intergenic
972249419 4:37284192-37284214 CTCGCTTTCTGGTTCGTAGGTGG + Intronic
972271378 4:37513425-37513447 TTCTCTTCCTGGCTTGTAGATGG + Intronic
972342824 4:38167387-38167409 CTGGCTTCTTGGTTCATAGATGG + Intergenic
972573366 4:40330277-40330299 CTTTCTTCTTGGCTTGCAGATGG - Intergenic
972742305 4:41899061-41899083 CTCTCTTCCTAGTTTGCAGATGG - Intergenic
972790142 4:42363916-42363938 CCCTCTTCCTGGTTTGCAGATGG - Intergenic
972861896 4:43179483-43179505 CTGTCTTCTTGGTTTGCAGATGG + Intergenic
973090730 4:46132992-46133014 CACTCTTCCTGGTTTGCAGATGG - Intergenic
973571883 4:52248687-52248709 CCTGATGCCTGGTTTGTGGAAGG + Intergenic
973746101 4:53965017-53965039 CCTCCTTCATGGTTTGCAGATGG - Intronic
973842900 4:54880533-54880555 CTCTCTTCCTGGTTTGCAAATGG + Intergenic
973855064 4:55002966-55002988 CCTTCTTCCTGATTTGTAGGTGG - Intergenic
973860045 4:55054634-55054656 CTCTCTTCTTGGCTTGTAGATGG - Intergenic
974032064 4:56784925-56784947 CCCACTTCTTGGTTTGTAGATGG - Intergenic
974095735 4:57361908-57361930 CTTTCTTCCTGTCTTATAGATGG + Intergenic
974115938 4:57579075-57579097 CTTGCTTCATGGTTTCCAGATGG + Intergenic
974478719 4:62418064-62418086 CTTGCTCCTCAGTTTGTAGATGG - Intergenic
974610251 4:64207477-64207499 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
974747722 4:66098090-66098112 CATGTCTCCTGGTTTGCAGATGG + Intergenic
975131045 4:70833355-70833377 CTTGTTTCCTGCTTTGTTGTTGG - Intronic
975169190 4:71213827-71213849 CTTCCTTTCTGGCTTGCAGAAGG - Intronic
975176787 4:71298763-71298785 TGTGCTTCCTAGTTTGGAGAAGG + Intronic
975181602 4:71352033-71352055 CTTGCTTCTGTTTTTGTAGATGG - Intronic
975213200 4:71724669-71724691 CTCACTTCCTGGTTCATAGATGG + Intergenic
975225606 4:71867756-71867778 CTTTCTTCCTGGTTTACAGATGG - Intergenic
975281400 4:72567540-72567562 CCTGCACCTTGGTTTGTAGAAGG + Intronic
975312553 4:72918765-72918787 CTCTCTTCCTGGCTTATAGAAGG - Intergenic
975412718 4:74073543-74073565 CTCCCTTCCTGGCTTGCAGATGG + Intergenic
975610401 4:76197059-76197081 CTGTCTTCTTGGCTTGTAGAGGG - Intronic
975934523 4:79562250-79562272 CTTGCTCCTCAGTTTGTAGATGG + Intergenic
975981756 4:80169149-80169171 CTTTCTTCCTGAGTTGCAGATGG - Intergenic
976008930 4:80463600-80463622 CCTTCTTCCTGGCTTGTAGATGG + Intronic
976072227 4:81254501-81254523 CTCTCTTTCTGGCTTGTAGATGG - Intergenic
976305644 4:83556936-83556958 CCAGCTTCCTGGTTTGTACAGGG + Intronic
976308772 4:83588991-83589013 CTTTCTTTCTCATTTGTAGAAGG + Intronic
976336677 4:83895840-83895862 CCCTCTTCCTGGTTTGCAGATGG + Intergenic
976639585 4:87323908-87323930 CTGGCTTCCTGGTTGATAGATGG + Intergenic
976920861 4:90441395-90441417 CTGTCTTCCTGGCTTGTAGATGG + Intronic
976950203 4:90819084-90819106 CTGTCTTCCTGGCTTGCAGATGG + Intronic
976961552 4:90982198-90982220 CTCTTTTCCTGGTTTGCAGATGG + Intronic
977034099 4:91927405-91927427 CCTGCCTCCTGGTTGGTAGATGG + Intergenic
977141918 4:93384075-93384097 CTTGCTCTCTGCTTCGTAGACGG + Intronic
977280367 4:95032197-95032219 CCTGCCTCCTGGTTTGCAGCTGG + Intronic
977335928 4:95699473-95699495 CCCACTTCCTGGTTTATAGAAGG - Intergenic
977870452 4:102083999-102084021 CTTTCTTCTTGGCTTGTAGATGG - Intergenic
977960490 4:103079277-103079299 CCCACTTCCTGGTTTGCAGATGG - Intronic
978005744 4:103613793-103613815 CTTCCTTCCTGGCTTGTAGGTGG + Intronic
978029323 4:103919716-103919738 CCTGCTTCCTGGTTCATAGATGG - Intergenic
978520674 4:109612170-109612192 CTCTCTTCCTGGCTTGCAGATGG + Intronic
979217775 4:118186416-118186438 CTTGCTCCTTGGCTTGCAGACGG - Intronic
979252740 4:118582334-118582356 CTGTCTTCCTGGCTTGCAGATGG + Intergenic
979532539 4:121784517-121784539 CTTGCCTCCTGGCTTGCAGATGG - Intergenic
979616505 4:122748593-122748615 CTTACTCCTTGGCTTGTAGATGG + Intergenic
979758380 4:124370130-124370152 CTTGATGCCTAGTTTGTTGAAGG + Intergenic
979987169 4:127329458-127329480 CTTTCTTCCTGGCTTGCAGATGG - Intergenic
980206718 4:129729165-129729187 TCTGCTTTCTGGTTTGTAGATGG - Intergenic
980735356 4:136878794-136878816 CTTTCTCCTTGGCTTGTAGACGG - Intergenic
980797600 4:137704614-137704636 CCTGCTTCCTGCTTCATAGATGG - Intergenic
980811647 4:137890473-137890495 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
980982208 4:139664504-139664526 CCCTCTTCCTGGTTTGCAGAAGG - Intergenic
981016210 4:139977123-139977145 CCTGTTTCCTGGTTCATAGATGG - Intronic
981039572 4:140210853-140210875 CTCTCTTCCTGGTTTGCAGAGGG - Intergenic
981171721 4:141632930-141632952 CTTGCTCCTTAGTTTGCAGACGG + Intergenic
981402687 4:144332441-144332463 CCTGTTTCCTGGTTCATAGATGG + Intergenic
981402803 4:144334389-144334411 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
981498897 4:145425287-145425309 CTCTCTATCTGGTTTGTAGATGG - Intergenic
982113465 4:152077131-152077153 CCTGTTTCCTGGTTCATAGAAGG - Intergenic
982327196 4:154140514-154140536 CTCACTTCCTGGTTCGCAGATGG - Intergenic
982508329 4:156248980-156249002 CTTGCTTTCTGGTTCGTTGATGG + Intergenic
982775958 4:159441594-159441616 CTCTCTTCTTGGCTTGTAGATGG + Intergenic
982788271 4:159560785-159560807 CTAGGTCCCTGGTTTGCAGATGG - Intergenic
983162028 4:164428191-164428213 CTCTCTTCCTGGTTTGTAAGTGG + Intergenic
983367251 4:166808500-166808522 CTCCTTTCCTGGTTTGCAGATGG - Intronic
983415206 4:167443520-167443542 CTTGCTCCCTAGCTTGCAGATGG + Intergenic
983427559 4:167606696-167606718 CTCACTTCCTGGTTTGCAGGTGG + Intergenic
983432952 4:167674432-167674454 CCTGCTTCCTGGTTCATAGAAGG + Intergenic
983488266 4:168357452-168357474 CTTGCTTCTTGGTCTGCAGATGG + Exonic
983795310 4:171854700-171854722 CTGGCTTCCTGGTTCCCAGAAGG + Intronic
983960171 4:173742854-173742876 CTCTCTCCTTGGTTTGTAGATGG - Intergenic
984166297 4:176306659-176306681 CTCTCTTCCTGGTTTGTGGAGGG - Intergenic
984363257 4:178765343-178765365 CCTGCTTCCTGGTTTGCAAATGG + Intergenic
984396976 4:179214415-179214437 CTCTCTTCCTGATTTGCAGAGGG + Intergenic
984441817 4:179780517-179780539 CTTTCTTCCTGGTTTTCAGGTGG + Intergenic
984489029 4:180408871-180408893 CTTGCTTTCTGGTTCATAGATGG - Intergenic
984709968 4:182876619-182876641 CTCTCTTCCTGGCTTGTGGACGG - Intergenic
985074123 4:186195734-186195756 CTTGGTTCCTGGTTTATGGCGGG + Intronic
985175115 4:187192418-187192440 CTTTCTTCCTGGCTCGCAGACGG - Intergenic
985715053 5:1452457-1452479 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
986059822 5:4177545-4177567 TCTGCTTTCTGGTTTGCAGATGG + Intergenic
986104068 5:4643231-4643253 CCTTCTCCCTGGTTTGGAGATGG + Intergenic
986127325 5:4895219-4895241 CTTGCTCCCTGGCTTGCAAACGG - Intergenic
986230854 5:5863788-5863810 CTTGCTTTCTGGTTCATAGACGG - Intergenic
986241888 5:5967632-5967654 GCTGCTTCCTGGTTTGCAGAGGG + Intergenic
986309875 5:6544051-6544073 CCCTCTTCCTGGCTTGTAGATGG - Intergenic
986340382 5:6784158-6784180 CTGGTTCCCTGGCTTGTAGATGG + Intergenic
986482690 5:8204722-8204744 CCAACTTCCTGGTTTGCAGATGG + Intergenic
986567401 5:9128420-9128442 CTTCCTTCCTGCTTTGGACATGG + Intronic
986759057 5:10863476-10863498 CCTGTTTCCTGGTTTGTAGACGG + Intergenic
986768781 5:10952628-10952650 CCTGCTTCCTGGTTCATAGATGG - Intergenic
986880357 5:12162238-12162260 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
986976280 5:13398065-13398087 CTCTCTCCCTGGCTTGTAGATGG - Intergenic
987107684 5:14656602-14656624 CTTTCTTCCTGGTTTTCAGATGG + Intergenic
987145838 5:14990691-14990713 CTTGTTTCCTGGTTCGTAGATGG + Intergenic
987244388 5:16033775-16033797 CTTTCTCCTTGGTTTGTAGATGG - Intergenic
987277536 5:16377468-16377490 CTTGCTTCCTTGTTCACAGATGG + Intergenic
987331184 5:16859268-16859290 GTTGCTTTCTGGTTCATAGATGG + Intronic
987387334 5:17342536-17342558 CTTGTTTCCTGATTTCTAGATGG + Intergenic
987553207 5:19410577-19410599 TTTACTACCTGGTTTGTTGAGGG + Intergenic
987567876 5:19616835-19616857 GTCTCTTCCTGGTTTGCAGATGG + Intronic
987613126 5:20234535-20234557 CCTGCTTTCTGGTTTACAGATGG - Intronic
987905852 5:24075978-24076000 TATGCTTCCTTGTATGTAGATGG - Intronic
988105013 5:26733636-26733658 CCTGCTTCCTGGCTTGCAGAAGG - Intergenic
988179027 5:27765875-27765897 CTTTCTTCCTGGTCTGCAAATGG + Intergenic
988339786 5:29956010-29956032 CTCTCTTCCTGGCTTGTAGACGG + Intergenic
988516243 5:31907265-31907287 CTCTCTTCCTGGGTTGTAGATGG + Intronic
988536418 5:32072949-32072971 CTAGCTTCATTCTTTGTAGAAGG + Intronic
988792842 5:34624371-34624393 CTCTCTTCCTGGTTTGCAGAGGG - Intergenic
988798955 5:34678583-34678605 CTTTCTTCGTGGCCTGTAGATGG - Intronic
988877358 5:35461660-35461682 CCCTCTTCCTGGTTTGTAGATGG - Intergenic
988958690 5:36347505-36347527 CCTGCTTCCTGGCTTGCAGATGG + Intergenic
989004626 5:36796682-36796704 GTTTCTTCCTGGCTTGTAGATGG + Intergenic
989207722 5:38827989-38828011 CCTACATCCTGGTTTATAGATGG - Intergenic
989398840 5:40987441-40987463 CCTGCTTCCTAGTTTGCAGATGG + Intergenic
989494355 5:42094270-42094292 CCTGTTTCCTGGTTCATAGATGG + Intergenic
989720984 5:44527850-44527872 CTCCCCTCCTGGTTTGCAGATGG + Intergenic
989974263 5:50564344-50564366 CTGTCTTCCTGGCTTGCAGAAGG + Intergenic
990182324 5:53174660-53174682 CTCTCTTCTTGGCTTGTAGATGG - Intergenic
990203679 5:53406171-53406193 TTCTCTTCCTGGTTTGCAGATGG - Intergenic
991364583 5:65854972-65854994 CCTTCTTCCTGGCTTGCAGATGG - Intronic
991402792 5:66272075-66272097 CTTTTTTTCTGGTTTGTAGATGG + Intergenic
991953702 5:71971692-71971714 CCTGCTTTCTGGTTCATAGATGG + Intergenic
992200252 5:74376476-74376498 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
992271002 5:75062818-75062840 CTCTCTCCCTGGTTTGTAGATGG + Intergenic
992484903 5:77185350-77185372 CTCTCTTCTTGGCTTGTAGACGG + Intergenic
992519811 5:77539023-77539045 CTCTCTTCCTGGTTTGCAGGTGG + Intronic
992668703 5:79037070-79037092 CTCTCTTCCTGGGTTGCAGATGG - Intronic
992923782 5:81558381-81558403 CACACTTCCTGGTTTGCAGATGG + Intronic
992957760 5:81927841-81927863 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
993012099 5:82494446-82494468 CCTGCGTCCTGGCTTGCAGATGG + Intergenic
993197973 5:84774853-84774875 CTAGTTTCCTGATTTGTAAAAGG + Intergenic
993298175 5:86170950-86170972 CTCTCCTCCTGGTTTGCAGATGG + Intergenic
993482326 5:88439044-88439066 CCTGCTTCCTGCTTCATAGATGG + Intergenic
993526475 5:88971796-88971818 CCTTCTTCCTGGTTTGGAGATGG - Intergenic
993557299 5:89356407-89356429 CTCCCTTCCTGGCTTGTAGATGG + Intergenic
993631375 5:90289957-90289979 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
993687339 5:90955100-90955122 CCCACTTCCTGGTTTGCAGACGG - Intronic
994381638 5:99078811-99078833 CCCTCTTCCTGGCTTGTAGATGG + Intergenic
994550277 5:101225759-101225781 CTCTCTTCTTGGCTTGTAGATGG - Intergenic
994552056 5:101247512-101247534 TGTGTTTCCTGGTTTGCAGATGG - Intergenic
994920837 5:106040835-106040857 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
994957010 5:106545381-106545403 CTTTTTTCCAGGTCTGTAGAAGG + Intergenic
995127208 5:108590181-108590203 CTTGCTTCTTAGCTTGCAGATGG + Intergenic
995341299 5:111063620-111063642 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
995349821 5:111162282-111162304 CTTGCTCCTTAGCTTGTAGATGG - Intergenic
995512842 5:112925319-112925341 CTTTCTTCTTGGCTTGTAGATGG - Intergenic
995568106 5:113452511-113452533 CCTGCTTCCTGGTTCATAGATGG - Intronic
995602421 5:113812375-113812397 CTCACTTCCTGGTTCCTAGATGG + Intergenic
995832990 5:116374158-116374180 CTTGCTTCTTAGCTTGCAGATGG + Intronic
995991374 5:118243938-118243960 CCCTCTTCCTGGCTTGTAGATGG - Intergenic
996214025 5:120845912-120845934 CCTGCTTCATGTTTTATAGATGG - Intergenic
996253727 5:121371904-121371926 CTTTCTTCCTGGCTTGTAGAAGG - Intergenic
996261587 5:121477403-121477425 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
996263270 5:121500907-121500929 CTCGCTCTCTGGCTTGTAGATGG - Intergenic
996269388 5:121584733-121584755 CATGCTTCCTGGTTTGCTGATGG + Intergenic
996269519 5:121585792-121585814 CCTGTCTCCTGGTTTGCAGATGG + Intergenic
996482866 5:123994906-123994928 CTTGATTAATGGTTTATAGATGG + Intergenic
996516284 5:124373076-124373098 CCTGCTTTCTGGTTCATAGATGG + Intergenic
996722634 5:126644910-126644932 CCTTCTTCCTGGCTTGCAGATGG - Intergenic
996759412 5:126972286-126972308 CTCACTTCCTGGTTTTTAGGGGG - Intronic
996826218 5:127684046-127684068 CTTTCTTCCTGGCTTGCAGATGG + Intergenic
997069180 5:130599306-130599328 CTCTCCTCCTGGTTTGTAGATGG + Intergenic
997229998 5:132235407-132235429 CTGTCTTCCTGGCTTGTAGATGG - Intronic
997455623 5:134015395-134015417 CTTGCTCTCTGGTTCATAGATGG - Intergenic
997584591 5:135036826-135036848 CTTGATGCCTGCTGTGTAGAAGG + Intronic
998441987 5:142170378-142170400 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
998464368 5:142331564-142331586 CATGCTGCCTGGTATCTAGAAGG - Intergenic
998585530 5:143422649-143422671 CCTGCTTCCTGGTTTACAAATGG - Intronic
998910683 5:146956801-146956823 CTCTCTTCCTGGTTTGCAGATGG + Intronic
999012461 5:148057688-148057710 CTTCCTTCTTGGTTTGTAATGGG + Intronic
999019810 5:148152991-148153013 CTGTCTTCCTGGCTTGCAGATGG + Intergenic
999297237 5:150467338-150467360 CTGGCTTCCCCATTTGTAGATGG - Intergenic
999633186 5:153592837-153592859 CCTGCTTCCTAGTTTACAGATGG + Intronic
999801298 5:155040092-155040114 CTTGCTTTCTGGTTTGCAGATGG + Intergenic
999840335 5:155418293-155418315 CTCTCTTCCTGGTGTGTAGGTGG + Intergenic
999841873 5:155436508-155436530 CTCACTTCCTGGTTCATAGATGG - Intergenic
1000178060 5:158777763-158777785 TCTGCTTCCTGGTTTGAACAGGG + Intronic
1000536254 5:162481967-162481989 TCTGCTTCTTGGTTTGTAAAGGG - Intergenic
1000631731 5:163598085-163598107 CCTGCTTCCTGGTTTGCAGATGG + Intergenic
1000786326 5:165548950-165548972 CCTACTTCCTGGTTCATAGATGG + Intergenic
1000920997 5:167137015-167137037 CTTTCTTCCTGGCTTGAAGTTGG + Intergenic
1001195117 5:169666137-169666159 GCCGCTTCTTGGTTTGTAGATGG + Intronic
1001433718 5:171683266-171683288 CATCCTTCCTGTTTTGCAGATGG - Intergenic
1001456873 5:171869483-171869505 CAGGCTTCCTGATTTGTAGGTGG - Intronic
1001541645 5:172543782-172543804 CTCCCTTCCTGGCTTGCAGACGG + Intergenic
1001659120 5:173377370-173377392 CCTGCTTTCTGGTTCATAGATGG - Intergenic
1001785020 5:174404615-174404637 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1001830782 5:174787650-174787672 CCTTCTTCCTGGTTTGCAGATGG + Intergenic
1001886810 5:175299625-175299647 CCTGCTTCATGGTTTATAGGTGG - Intergenic
1001890985 5:175338348-175338370 CATGCTTCCTGGTTTGTAGGTGG - Intergenic
1001966465 5:175913412-175913434 CTTGCTTTCTGGTTCCCAGATGG + Intergenic
1002250482 5:177925792-177925814 CTTGCTTTCTGGTTCCCAGATGG - Intergenic
1002583288 5:180223804-180223826 CTCTCTTCCTGGCTTGTGGACGG + Intergenic
1002830830 6:818942-818964 CCTGCTGCCTGGGTTGTAGCAGG + Intergenic
1002993841 6:2264337-2264359 CTTACTTTCTGGCTTGCAGATGG - Intergenic
1003056218 6:2823244-2823266 CCTGCTTACTGGTTCCTAGATGG - Intergenic
1003385687 6:5665411-5665433 AATGCTTCCTGTTTTGAAGATGG - Intronic
1003687607 6:8320140-8320162 CCGGCTTCCTGGTTTATAGATGG + Intergenic
1003768861 6:9274397-9274419 CTTTCTTCCTGGCTTGCAGATGG + Intergenic
1004135451 6:12961824-12961846 CTTGCTCCTTGGCTTGTAGATGG + Intronic
1004233300 6:13851836-13851858 CCTGCTTCCTGGTTGATAGATGG - Intergenic
1004237714 6:13889296-13889318 CTCTCTCCCTGGCTTGTAGATGG + Intergenic
1004258949 6:14090713-14090735 CCTTCTTCCAGGTTTATAGATGG + Intergenic
1004288927 6:14348948-14348970 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1004305692 6:14500104-14500126 CTTGCTTGCTGGTTTGCAGAAGG - Intergenic
1004325757 6:14672743-14672765 CTCACTTCCTGGTTTGGAGAGGG - Intergenic
1004564920 6:16787328-16787350 CTCTCTTCCTGGCTTGTAGAGGG - Intergenic
1004741387 6:18464611-18464633 CTCTCTTCCTGGTTTGAAGATGG + Intronic
1004792186 6:19038830-19038852 CCTGCTTCCAGGTTTGCAGATGG + Intergenic
1004792990 6:19049830-19049852 CTTTCTTCCTGACTTCTAGAGGG - Intergenic
1004981374 6:21028468-21028490 CTCTGTTCCTGGTTTGCAGATGG + Intronic
1005027069 6:21473485-21473507 CTCTCTTCTTGGTTTGTAGATGG + Intergenic
1005518218 6:26574584-26574606 CTCACTTCCTGGCTTGCAGATGG - Intergenic
1005679924 6:28196788-28196810 CTTGCTCCTTGGTATGAAGAAGG + Intergenic
1005684731 6:28242941-28242963 AATGCTTTCTGGTTTGTAAAAGG + Intergenic
1006315337 6:33288224-33288246 CTTGCTTTCAGGTTTCTGGAAGG - Exonic
1006956145 6:37874138-37874160 CCTTCTTCTTGGTTTGTAGATGG + Intronic
1007251576 6:40498886-40498908 CATGCTTCCTGGAATGTAGCAGG - Intronic
1007319484 6:41016977-41016999 TCTGCTTCCTCGTCTGTAGAAGG - Intergenic
1007645839 6:43380275-43380297 CTTGAATGCTGGTTTTTAGAAGG + Intergenic
1007964090 6:45987667-45987689 CCTTCTTCCTGGTGTGCAGATGG + Intronic
1008283043 6:49618941-49618963 CTCCCTTTCTGGTTGGTAGATGG + Intronic
1008417864 6:51264264-51264286 CTTGCTTTCTGGCTCATAGATGG - Intergenic
1008596269 6:53044830-53044852 CTGTCTTCCTGGCTTTTAGATGG - Intronic
1008974115 6:57403932-57403954 CCTGCTTCCTGGTTTGCAGATGG + Intronic
1009163002 6:60305455-60305477 CCTGCTTCCTGGTTTGCAGATGG + Intergenic
1009331708 6:62430459-62430481 CCTTCTTCCTGGTTTGTACAGGG + Intergenic
1009642912 6:66361566-66361588 CTCTTTTCCTGGATTGTAGATGG + Intergenic
1009648283 6:66438301-66438323 TTTGCTTCCTGGTGAGGAGATGG + Intergenic
1009704200 6:67223862-67223884 ATTGATTCCTAGTTTGTTGAGGG - Intergenic
1009759509 6:67985559-67985581 CCTGCTTTCTGGTTCATAGATGG - Intergenic
1009808837 6:68635597-68635619 TTTGCTTCTTGGTTTGTTGGGGG + Exonic
1009966659 6:70585448-70585470 CTTTCTTCCTGGCTTACAGATGG - Intronic
1010092907 6:72006051-72006073 CTTGCTTCCTGGTTTACCGATGG + Intronic
1010580027 6:77584799-77584821 CCTTCTTCCTGGCTTCTAGATGG + Intergenic
1010751573 6:79621434-79621456 CTTCTTTCCTGGTTCATAGATGG - Intergenic
1010761034 6:79723672-79723694 CCTGCTTCCTACTTTGTAGATGG + Intergenic
1010946805 6:81984250-81984272 CTCTCTTCTTGGTTTGCAGATGG - Intergenic
1011038726 6:83006545-83006567 CTGTCTTCCTGGCTTGTAAATGG - Intronic
1011079789 6:83477005-83477027 CTTTCTTTCTGGTTTGTGGATGG - Intergenic
1011081156 6:83491392-83491414 CTCTCTTCCTGGCTTGTACACGG + Intergenic
1011206492 6:84904822-84904844 CTCTCTTCTTGGCTTGTAGATGG + Intergenic
1011520059 6:88195029-88195051 CCCACTTCCTGGTTTCTAGAGGG - Intergenic
1011521913 6:88216928-88216950 CTGTCTTCTTGGTTTGCAGATGG + Intergenic
1011659829 6:89584867-89584889 CTCTCTTCCTAGTTTGTAGATGG + Intronic
1011686186 6:89825616-89825638 CTCCCTTCCTGGCTTGTAGATGG - Intergenic
1011724299 6:90193410-90193432 CTTGCTCCTTGGCTTGTAGAAGG - Intronic
1011847507 6:91584687-91584709 CCTGTTTCCTGGTTTGCAGGTGG + Intergenic
1011893641 6:92197396-92197418 CCTGCCTCCTGATTTGCAGATGG - Intergenic
1011984763 6:93429671-93429693 CTCATTTCCTGGTTTGCAGATGG - Intergenic
1011991083 6:93518660-93518682 CCTGTTTCCTGGTTCATAGATGG + Intergenic
1012106403 6:95165484-95165506 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1012371172 6:98509132-98509154 CTTTCTCCTTGGCTTGTAGATGG + Intergenic
1012465287 6:99510644-99510666 CCTTCTTCCTGGTTTATAGATGG - Intronic
1012735113 6:102928912-102928934 CTTGCTTTCTGTTTCATAGATGG + Intergenic
1013212315 6:107998140-107998162 CCCTCTTCCTGGTTTGCAGATGG + Intergenic
1013320386 6:108982293-108982315 CCCTCTTCCTGGTTTGCAGAGGG + Intergenic
1013355174 6:109340063-109340085 CATGCTTCCTGGCTTGCAGGTGG + Intergenic
1013594118 6:111645610-111645632 CCTGCTTCCTGGTTCAGAGATGG - Intergenic
1013731373 6:113172057-113172079 CTCTCTTCCTGGCATGTAGACGG - Intergenic
1013786705 6:113789408-113789430 CCTGCTTTCAGGTTCGTAGATGG + Intergenic
1013819617 6:114138871-114138893 CTTGCTTCCTAGTTCACAGAAGG + Intronic
1013969119 6:115994839-115994861 CTTTCTTCCTGGTTTGCAGATGG - Intronic
1013989063 6:116232059-116232081 CTCTCTTCTTGGTTTGTAGATGG + Intronic
1013995852 6:116306859-116306881 CTCCCTTTCTGGCTTGTAGATGG - Intronic
1014008139 6:116444748-116444770 CTCACTTCCTGGTTTACAGATGG - Intergenic
1014164765 6:118211089-118211111 CTCTCTTCTTGGCTTGTAGATGG - Intronic
1014279458 6:119424780-119424802 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1014294243 6:119599085-119599107 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1014381095 6:120743332-120743354 CTAGCTTCCTGGTTTATAGATGG - Intergenic
1014635517 6:123842322-123842344 CTCTCTTCCTGGCTTGTAGATGG + Intronic
1014642156 6:123925977-123925999 CTTACTTTCTGGTTCATAGATGG + Intronic
1014878841 6:126696208-126696230 CTCTCTTCCTGGCTTGCAGAAGG - Intergenic
1015022048 6:128488029-128488051 CTTGCTTCTCAGCTTGTAGACGG - Intronic
1015069137 6:129068433-129068455 TCTGCTTCCTGGTTCATAGATGG + Intronic
1015145116 6:129976828-129976850 CTTGCTTCTCAGCTTGTAGAAGG - Intergenic
1015542255 6:134326786-134326808 CTTTCTTCCTGGCTTGTATTTGG + Intergenic
1015634599 6:135263282-135263304 CCTGCTTCCTGGTTCCTAGACGG + Intergenic
1015719713 6:136228476-136228498 CCTGCTTCCTGGTTCATAGAAGG - Intergenic
1015873102 6:137796669-137796691 CTCTCTTCCTGGATTGCAGATGG - Intergenic
1015891450 6:137973706-137973728 CCTGCATCCTGGTTTGCAGATGG + Intergenic
1016028333 6:139311892-139311914 CTCTCTTCCTGGTTTGCAAATGG + Intergenic
1016083686 6:139886074-139886096 CTTTCTTCCTGACTTGCAGATGG + Intergenic
1016133922 6:140513953-140513975 CTTGTTTCCTGGTTCATAGATGG - Intergenic
1016299208 6:142611239-142611261 CCTTCTTCCTGGTTTGTAGATGG + Intergenic
1016301304 6:142634907-142634929 CCTTCTTCCTGGTGTGCAGATGG + Intergenic
1016382907 6:143503399-143503421 ATTGCTTCCTGGTATGTTCAAGG - Intronic
1016388035 6:143548138-143548160 CCTGCTTCCTGGTTCATAGATGG + Intronic
1016398434 6:143651959-143651981 CTTTCTTCTGGGTTTGTAGGTGG - Intronic
1016476641 6:144434437-144434459 CTGGCTCCCAGGTTTGTAGCTGG + Intronic
1016573142 6:145537191-145537213 CTAGTTTCCTGGGTTGTATATGG + Intronic
1016623932 6:146144133-146144155 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1016652146 6:146474549-146474571 CTCTCTTCCTAGCTTGTAGATGG + Intergenic
1016682999 6:146852141-146852163 CCTGCTTTCTGGTTTTCAGATGG + Intergenic
1016753445 6:147657692-147657714 CCTGCTTGCTGGTTCATAGACGG + Intronic
1016763591 6:147767651-147767673 CTTTCTCCCTGGCTTGCAGATGG - Intergenic
1016870231 6:148808878-148808900 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1017023909 6:150164976-150164998 CCAGCTTCCTGGTTTGCAGATGG - Intronic
1017026109 6:150182414-150182436 CCTACTTTCTGGTTTGCAGATGG + Intronic
1017084899 6:150704840-150704862 CTTTCTTCCTGGCTTACAGACGG + Intronic
1017278897 6:152602360-152602382 CTCTCTCCCTGGTTTGTAGATGG - Intronic
1017448054 6:154527108-154527130 CTTCCTCCTTGGCTTGTAGATGG - Intergenic
1017595654 6:156025940-156025962 CCTGCTTTCTGGTTCATAGATGG - Intergenic
1017617142 6:156257700-156257722 CCCCCTTTCTGGTTTGTAGATGG - Intergenic
1017743901 6:157429861-157429883 CTGGCTTGCTGGTTTGGAGCTGG - Intronic
1018038403 6:159901043-159901065 CTTTCCTCCTGGTTTGCAGAAGG + Intergenic
1018428491 6:163704370-163704392 CTCACTTCCTGGTTTGCAGATGG - Intergenic
1018645688 6:165945636-165945658 TTCTCTTCCTGGTTTGTAGATGG - Intronic
1018692033 6:166354279-166354301 GCTGCTTCCTGGTTTGCAGAAGG - Intergenic
1018780739 6:167063036-167063058 CTTGCTCCTCGGTTTGCAGATGG - Intergenic
1019635748 7:2074782-2074804 CCTGCTTGCTGGTTTGCTGATGG - Intronic
1020397001 7:7727811-7727833 CTTGCTCCTCAGTTTGTAGATGG + Intronic
1020458018 7:8396314-8396336 CTTTCTTTCTGATTTGTGGATGG + Intergenic
1020527551 7:9281776-9281798 CACCCCTCCTGGTTTGTAGATGG - Intergenic
1020768254 7:12353230-12353252 CTCTCTTCCTGGCTTGAAGACGG + Intronic
1021050990 7:15984641-15984663 CTCCCTTCTTGGTTTGCAGACGG - Intergenic
1021208811 7:17818120-17818142 CTCGCTTCTTGGCTTGTAGATGG - Intronic
1021376320 7:19911700-19911722 CATAATTCCTGGTTTATAGATGG + Intergenic
1021523265 7:21557451-21557473 GCTGCTTCATGGTTTGTAGACGG + Intronic
1021560082 7:21960921-21960943 CTCTCTTCCTGGCTTGTAGATGG - Intergenic
1021694963 7:23267586-23267608 CTCACTTCCTGGTTCATAGATGG + Intronic
1021830510 7:24603099-24603121 CTCACTTCCTGGTTTACAGAGGG - Intronic
1021893919 7:25215343-25215365 CTATCTTCCTGGCTTGCAGATGG - Intergenic
1022002380 7:26238128-26238150 CTGGCTTCCTGGTTCATGGATGG - Intergenic
1022198122 7:28089321-28089343 CCCTCTTCCTGGTTTGCAGATGG - Intronic
1022352510 7:29579234-29579256 CTCTCTTCCTGGTTTGAAGATGG + Intergenic
1022385923 7:29899056-29899078 CTCTCTTCCTGGCTTGCAGAGGG + Intronic
1022391467 7:29947898-29947920 CCTGCTTGCTGGTTTGCAGACGG - Intronic
1022539097 7:31119666-31119688 CTTGCTGTCTGGTTCATAGATGG + Intergenic
1022617855 7:31951014-31951036 CTCTCTTCTTGGCTTGTAGATGG + Intronic
1022809587 7:33855826-33855848 CTCTCTCCCTGGCTTGTAGATGG - Intergenic
1023134626 7:37038802-37038824 CCTTCTTCCTGGCTTGCAGATGG + Intronic
1023747535 7:43335487-43335509 CTCTCTTCCTGGTTTGCAGATGG - Intronic
1024027407 7:45424422-45424444 CTTGTTTCCTGGCTTTCAGATGG + Intergenic
1024098675 7:46006762-46006784 CTCTCTCCCTGTTTTGTAGATGG - Intergenic
1024182941 7:46915961-46915983 CTCCCTTCCTGGTTTGAAAATGG + Intergenic
1024204405 7:47144324-47144346 CTCTGTTCTTGGTTTGTAGATGG - Intergenic
1024210296 7:47197519-47197541 CTCACTTCCTGGCTTGTAGACGG - Intergenic
1024259057 7:47560296-47560318 CCTGTTTCCTGGTTCATAGATGG - Intronic
1024267782 7:47619910-47619932 CCTGCTTTCTGGTTCATAGATGG - Intergenic
1024403687 7:48952941-48952963 CATGCTTCCTGGCTTATTGAGGG - Intergenic
1024425981 7:49226993-49227015 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1024481994 7:49873301-49873323 CCTGCTTCCTGGTTCATGGATGG + Intronic
1024747498 7:52425198-52425220 CTCTCTTCTTGGTTTGCAGATGG - Intergenic
1024844510 7:53626128-53626150 TTTTCTTCCTGGTTTGTATCTGG - Intergenic
1024875255 7:54014898-54014920 CTGTCTTCCTGGCTTGCAGATGG + Intergenic
1024886337 7:54147040-54147062 CTCTCTTCCTGGTTTGCAGACGG + Intergenic
1025070038 7:55890008-55890030 CTCTCTTCCTGGCTTGCAGAAGG + Intronic
1025288352 7:57687081-57687103 CTATCTTCCTGGTTTACAGATGG + Intergenic
1026365450 7:69644007-69644029 CTCTCTTCCTGGCTTGTAGATGG - Intronic
1026534925 7:71231620-71231642 CTCTCTTCCTGGTTTGCAGTTGG + Intronic
1026546013 7:71322810-71322832 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1026654273 7:72243249-72243271 CTCTCTTCCTGGTTTGCAGATGG - Intronic
1026760087 7:73120150-73120172 CCCACTTCCTGGTTTGTGGATGG - Intergenic
1026823114 7:73562990-73563012 CTTGCTTCTTAGTTTGCAGATGG + Intergenic
1027036429 7:74928962-74928984 CCCACTTCCTGGTTTGTGGATGG - Intergenic
1027087134 7:75272504-75272526 CCCACTTCCTGGTTTGTGGATGG + Intergenic
1027371701 7:77512908-77512930 CTTTCTTCCTGGCTTGTAGATGG - Intergenic
1027432409 7:78127993-78128015 CTTGCCACTTGGTTTGTAGTTGG - Intronic
1027468980 7:78550081-78550103 TCTGCTTTTTGGTTTGTAGACGG - Intronic
1027756102 7:82213986-82214008 CATGCTTTCTGGTTCATAGATGG + Intronic
1027860425 7:83571539-83571561 CTTGCTGCCTGGTTTGTTGAGGG - Intronic
1027981385 7:85227458-85227480 CCTGTTTCCTGGTTCATAGATGG - Intergenic
1028042564 7:86073298-86073320 CTCTCTTCCTTGTTTGCAGATGG - Intergenic
1028310245 7:89323139-89323161 AATTCTTCCTGGTTTGCAGATGG - Intronic
1028369775 7:90077983-90078005 CTGTCTTCCTGGCTTGCAGATGG - Intergenic
1029096535 7:98089448-98089470 CTTTCTCCTTGGCTTGTAGATGG - Intergenic
1029151442 7:98483396-98483418 CTTGCTTTCCGGCTTGCAGATGG + Intergenic
1029152671 7:98491974-98491996 CCCTCTTCCTGGCTTGTAGATGG - Intergenic
1029393440 7:100290485-100290507 CCCACTTCCTGGTTTGTGGATGG + Intergenic
1029598055 7:101548208-101548230 CTGGCTCCCAGGTTTGGAGAGGG - Intronic
1029601571 7:101566594-101566616 CTCTCTTTCTGGTTTGCAGATGG + Intergenic
1029892900 7:103950083-103950105 CCTGTTTCCTGGTTTATAGATGG + Intronic
1029923456 7:104290864-104290886 TTTGCTTCCTGCTTTGCAGATGG - Intergenic
1030175710 7:106650990-106651012 CTGTCTTCCTGGTTTGCAGATGG + Intergenic
1030190944 7:106809459-106809481 CCTGCTTCCTGGTTCACAGATGG + Intergenic
1030214685 7:107032273-107032295 CTCTCTTCCTGGCTTGTAGATGG - Intergenic
1030217499 7:107060575-107060597 TTTTCTTACTGATTTGTAGAAGG + Intronic
1030362368 7:108608299-108608321 CTCTCTTCCTAGCTTGTAGACGG - Intergenic
1030405498 7:109106991-109107013 CTGGCTTTCAGGTTTTTAGATGG - Intergenic
1030542293 7:110845917-110845939 CCTGTTTCCTGGTTTATAGTTGG - Intronic
1030658908 7:112198282-112198304 CCTTCTTCCTGGTTTGCAGGTGG - Intronic
1030688253 7:112508151-112508173 CCCCTTTCCTGGTTTGTAGATGG + Intergenic
1030791240 7:113731676-113731698 CCTGTTTCCTGGTTCATAGACGG + Intergenic
1030859262 7:114604165-114604187 TCTACTTCCTGGTTTGCAGATGG + Intronic
1030896214 7:115063500-115063522 TTTGATTCCTGGCTTGTAAATGG + Intergenic
1031053612 7:116970472-116970494 CTTGCTTCCTGGTTTGCAGATGG + Intronic
1031061983 7:117062054-117062076 CTTTCTTTCTGGCTTGCAGAAGG + Intronic
1031196702 7:118624213-118624235 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
1031294744 7:119987129-119987151 TTTGATGCCTGGTTTGTTGAGGG - Intergenic
1031523257 7:122792413-122792435 CGTGCTTCCTGGTTTATAGGTGG - Intronic
1031559484 7:123220935-123220957 CTACCTTCCTGGTTTTTAGATGG - Intergenic
1031582348 7:123492090-123492112 TTTGTTTCCTGGTTCATAGATGG - Intronic
1031630992 7:124042611-124042633 CCCATTTCCTGGTTTGTAGATGG + Intergenic
1031642169 7:124178643-124178665 CCTGATTCCTGGTTTGCAGATGG - Intergenic
1031914448 7:127549792-127549814 CTCTCTTCCTGGTTTAGAGATGG + Intergenic
1032531079 7:132620928-132620950 CCTGCTTCTTGGTTTGCAGATGG + Intronic
1032762454 7:134956529-134956551 CTCTCTTCATGGTTTGCAGATGG - Intronic
1032861099 7:135880181-135880203 CCTTCTTCCTGGGTTGTAGGTGG + Intergenic
1032881310 7:136093392-136093414 CCTGTCTCCTGGTTTGTAGAGGG + Intergenic
1032908513 7:136401802-136401824 CTGTCTTCCTGGTTTGTAGATGG - Intergenic
1033025103 7:137764635-137764657 CTTTCCTCCTGGTTTGTCTAGGG + Intronic
1033048435 7:137982947-137982969 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1033429358 7:141274820-141274842 CTTGGTCCCTGCTTTTTAGAAGG - Intronic
1033481261 7:141743303-141743325 CTGTCTTCCTGGCTTGCAGATGG + Intronic
1033579599 7:142720092-142720114 CTCGCTCCTTGGCTTGTAGATGG - Intergenic
1033594333 7:142845290-142845312 CTCGCTTCCTGGTTCACAGATGG - Intergenic
1033734956 7:144213279-144213301 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1033748100 7:144337690-144337712 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1033771371 7:144556300-144556322 CCTGCTTGCTGGTTTACAGATGG + Intronic
1033853777 7:145531789-145531811 CTCTCTTCCTGGCTTGCAGAAGG - Intergenic
1033944944 7:146705355-146705377 TTTGTTTCCTGGTTCATAGATGG + Intronic
1033968062 7:147002706-147002728 CTTGCTTTCTGGCTGATAGATGG + Intronic
1034198427 7:149265464-149265486 CTCTTTTCCTGGTTTGCAGACGG + Intronic
1034319806 7:150169471-150169493 CTTTCTTCCTGGCTTATAGGCGG - Intergenic
1034568417 7:151934391-151934413 CTTGCCTCCTTGTCTGTATATGG + Intergenic
1034675839 7:152891935-152891957 CTCTCTTCTTGGCTTGTAGATGG - Intergenic
1034772945 7:153797755-153797777 CTTTCTTCCTGGCTTATAGGCGG + Intergenic
1034838701 7:154375641-154375663 CTCACTTCCTGGCTTGTGGATGG - Intronic
1034839022 7:154378537-154378559 CTCCCTTCCTGGTTTGCAGATGG + Intronic
1035088748 7:156286300-156286322 CTCTCTTCCTGGTGTGCAGACGG - Intergenic
1035701353 8:1641199-1641221 CGTGCCTCCCGGTTTGCAGAAGG + Intronic
1035818595 8:2566945-2566967 CTGGCTTCCTGGTTCACAGATGG - Intergenic
1035920969 8:3675675-3675697 CCCGTTTCCTGGTTTGCAGATGG - Intronic
1036065809 8:5380261-5380283 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
1036145117 8:6247837-6247859 CTCTCTTCCTGGCTTGTAGACGG - Intergenic
1036167716 8:6452733-6452755 CTTTCTTCCTGGCTTGAAGGAGG - Intronic
1036180657 8:6581841-6581863 CCTGTTTCCTGGTTCATAGATGG + Intronic
1036511095 8:9401122-9401144 CTCTCTTCCTGGCTTGCAGAAGG + Intergenic
1036566865 8:9945308-9945330 CCTGCTTCCTGGTTCACAGATGG + Intergenic
1036756118 8:11472171-11472193 CTTTCTTGCTGGTTTGTTTAAGG + Intronic
1036828059 8:11994465-11994487 CTTGCTTTCAAGCTTGTAGATGG - Intronic
1037156972 8:15713621-15713643 CTTTCCTCTTGGATTGTAGATGG + Intronic
1037681051 8:21097895-21097917 CTTTCTTCCTGGCTTATAGATGG + Intergenic
1038059990 8:23902170-23902192 CTGTCTTCCTGGCTTGCAGACGG - Intergenic
1038276677 8:26127172-26127194 CTTGCTCCCTGGTTTGCAGATGG + Intergenic
1038280886 8:26163402-26163424 CTTTCTTCTTGGCTTGCAGATGG + Intergenic
1038343218 8:26707060-26707082 CCCACTTCCTGGCTTGTAGATGG + Intergenic
1038373716 8:27016833-27016855 CTCTCTTCCTGGTTTGCAAATGG + Intergenic
1038431323 8:27502597-27502619 CTCTCTTCTTGGTTTGCAGATGG + Intronic
1038670840 8:29581623-29581645 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1038680430 8:29662469-29662491 CCTGCCTTCTGATTTGTAGATGG + Intergenic
1038714431 8:29979230-29979252 CCTGCTTCCTGGTGTGTAGTGGG + Intergenic
1038732146 8:30137253-30137275 CTTGATTTCTGTTTTCTAGATGG + Exonic
1038845647 8:31226976-31226998 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1038937855 8:32272225-32272247 CTTTCTTCTTGGCTTGCAGATGG + Intronic
1038987710 8:32830779-32830801 CCTACTTCCTGGTTTGCAGTTGG - Intergenic
1039700230 8:39954559-39954581 CTTGCTCCTTGGCTTGTAGATGG + Intronic
1039742258 8:40393669-40393691 CTCTCTTCCTGGCTTGTGGATGG + Intergenic
1039825192 8:41167336-41167358 CTCTCTTCTTGGTTTGCAGACGG - Intergenic
1040036608 8:42876513-42876535 TTGGCTTCATGGTTTGTAGATGG - Intronic
1040483299 8:47846470-47846492 TTTGATGCCTGGTTTGTTGAGGG - Intronic
1040698564 8:50033602-50033624 CTTTCTTCTTGGATTGTAGATGG + Intronic
1041156629 8:54993749-54993771 CTCTCTTCCTGGCTTGTAGAGGG + Intergenic
1041158439 8:55011916-55011938 CTCACTTCCTGGCTTGCAGACGG - Intergenic
1041369960 8:57149158-57149180 CTCTCTTCCTGGCTTGCAGAGGG + Intergenic
1041578879 8:59433718-59433740 TTGTCTTCCTGGCTTGTAGATGG + Intergenic
1041630964 8:60086528-60086550 CCTGCTTCCTGGTTCGCAGAAGG + Intergenic
1041718275 8:60951650-60951672 CCTGCTTCCTGGTTCATAGATGG + Intergenic
1041740520 8:61152204-61152226 CTCACTTCCTGGTTTGCAGATGG + Intronic
1041742812 8:61175345-61175367 CTTGTTCCCTGGTTCATAGATGG - Intronic
1041777988 8:61545285-61545307 CCTGCTTCCTGGTTTGTAGATGG - Intronic
1041914434 8:63125834-63125856 CTTGCGTCTGAGTTTGTAGATGG - Intergenic
1041979813 8:63844683-63844705 CCTGCTTCCTGGTTCATAGATGG - Intergenic
1042045940 8:64651735-64651757 GCTGCTTCCTGGTTCATAGATGG - Intronic
1042191176 8:66188849-66188871 CCTTCTTCCTAGTTTGCAGATGG - Intergenic
1042351192 8:67779363-67779385 CCTGCTGCCTGGTGTGTAGGTGG + Intergenic
1042541888 8:69915683-69915705 CCTGCTTCCTGAATTGCAGAAGG - Intergenic
1043141244 8:76592973-76592995 TTTTCTTCCTGGCTTGCAGATGG + Intergenic
1043243248 8:77963930-77963952 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
1043256329 8:78142548-78142570 CTTGCTTGCTTGTTTTGAGATGG + Intergenic
1043312937 8:78885460-78885482 CTCTCTTCTTGGTTTGTAGATGG + Intergenic
1043322429 8:79006092-79006114 CTTGCTTTCTGGTTCATAAATGG + Intergenic
1043591410 8:81837538-81837560 CCTACTTTCTGGTTTATAGATGG + Intronic
1043628648 8:82297231-82297253 CCTGCTTCCTGGTTCACAGATGG + Intergenic
1043810822 8:84737836-84737858 CATGCTTCCTGGCTCATAGAGGG - Intronic
1043957933 8:86384028-86384050 CTCTCTTCTTGGCTTGTAGATGG + Intronic
1044078102 8:87847981-87848003 CTCTCTTCCTCGCTTGTAGATGG + Intergenic
1044084088 8:87921933-87921955 CTTTCTTTCTGGGTTGCAGATGG - Intergenic
1044369963 8:91398926-91398948 CTCTCTTCTTGGGTTGTAGATGG + Intergenic
1044370153 8:91400720-91400742 CTCTCTTCCTGGCTAGTAGAAGG + Intergenic
1044462391 8:92460496-92460518 CTTGATTCCTGGGTTAGAGAAGG - Intergenic
1044613423 8:94116423-94116445 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1044676672 8:94736088-94736110 CTTGCTTCCTGGTTTATAGCAGG + Intronic
1044768314 8:95601341-95601363 TTTGATTCCTAGTTTGTTGAGGG - Intergenic
1045407625 8:101882422-101882444 CCTATTTCCTGGTTCGTAGATGG - Intronic
1045750767 8:105481385-105481407 CTCCCTTCCTGGCTTGCAGATGG + Intronic
1045932620 8:107644709-107644731 CTTGCTTCGTGGTATTTAAATGG + Intergenic
1045943411 8:107765931-107765953 CTTGCTGCTTGGCTTGCAGATGG - Intergenic
1046040506 8:108897672-108897694 CTTGCTCTCTGGTTCATAGATGG + Intergenic
1046120704 8:109842706-109842728 CTTTCTTCCTGGCTTTCAGATGG - Intergenic
1046510824 8:115200284-115200306 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1046537479 8:115533792-115533814 CTTTCTTCCTGGCTTGCAGATGG + Intronic
1046615958 8:116477583-116477605 CTTACTTTCTGGTTTGCAGATGG - Intergenic
1046646077 8:116787093-116787115 CTTGCTTCCTAGTTTATAGATGG - Intronic
1046674186 8:117090521-117090543 CTTGCTTCCTTGTTCCTAGGTGG + Intronic
1046724158 8:117656165-117656187 CTTTCTCCTTGGTTTGGAGATGG + Intergenic
1046944746 8:119963975-119963997 CCTGCTTCTTGGTTTGCAGGTGG + Intronic
1046944750 8:119964015-119964037 CCTGCTTCTTGGTTTGCAGATGG + Intronic
1047002779 8:120589621-120589643 CCCCCTTCCTGGTTTGTAGATGG + Intronic
1047063251 8:121251219-121251241 CCTTCTTCCTGGTTCATAGATGG - Intergenic
1047350813 8:124071799-124071821 CTCTCTTGCTGGTTTGTGGATGG + Intronic
1047451391 8:124968172-124968194 CTGTCTTCCTGGTTTGCAGATGG + Intergenic
1047463983 8:125094755-125094777 CTTTCTTCTTGGCTTGTAGATGG + Intronic
1047522413 8:125605264-125605286 CTCTCTTCCTGGCTTGTGGATGG + Intergenic
1047574732 8:126140324-126140346 CTCTCTTCCTGGCTTATAGATGG + Intergenic
1047807157 8:128372440-128372462 CTCTCTTCCTGGCTCGTAGACGG + Intergenic
1048031573 8:130638222-130638244 CACCCTTCCTGGCTTGTAGAAGG - Intergenic
1048033212 8:130652476-130652498 CTTACTTCCTGGTAGGAAGAAGG + Intergenic
1048084332 8:131160712-131160734 CTTGCTCCTCAGTTTGTAGATGG - Intergenic
1048137905 8:131764098-131764120 CTTTCTTCCTGGCTTGTACATGG - Intergenic
1048140928 8:131793544-131793566 CTTCCTCCTTGGTTTGCAGATGG + Intergenic
1048184982 8:132231615-132231637 CTCTCTTCCTGGTTTGTAAATGG - Intronic
1048237521 8:132706088-132706110 CTCACTTCCTGGTTTGCAGATGG - Intronic
1048388783 8:133940170-133940192 CTTGCTTCCAGTCTTATAGATGG + Intergenic
1048434153 8:134400244-134400266 CCTGCTTCCTGGTTCATGGATGG - Intergenic
1048526596 8:135208531-135208553 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1048533105 8:135268616-135268638 CTCTCTTCCTGGATTGTAGATGG - Intergenic
1048700226 8:137080080-137080102 CCTGCGTCCTGGTTCATAGATGG + Intergenic
1048804276 8:138225336-138225358 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1048884387 8:138897963-138897985 CTTGCTTTCTGATTCATAGAGGG + Intronic
1048946002 8:139447912-139447934 CTCTCTTCCTAGATTGTAGATGG + Intergenic
1049805625 8:144537469-144537491 CTTGCTTGCTGGGTTCTTGATGG - Intronic
1049840862 8:144770788-144770810 TTCGCTTCCTGGCTTGCAGATGG - Intergenic
1049995126 9:1027151-1027173 CTTGATTCCTGGTTTCTGGGGGG - Intergenic
1050016795 9:1242143-1242165 CATGGTACCTGGTATGTAGAAGG - Intergenic
1050022014 9:1294104-1294126 CTCTCTTCTTGGTTTGTTGATGG - Intergenic
1050093654 9:2041389-2041411 CCTGCTTCCTGATTCATAGATGG + Intronic
1050494298 9:6224384-6224406 ATTGCATCCTGTTTTGAAGATGG + Intronic
1050916260 9:11137743-11137765 CTTTCTTCCTGGCTTGTAGATGG - Intergenic
1050986930 9:12093983-12094005 CCCTCTTCCTGGTGTGTAGATGG - Intergenic
1051043389 9:12842928-12842950 AATGCTTCCTGGTTGGTAGGTGG - Intergenic
1051258511 9:15238080-15238102 TTTGATGCCTGGTTTGTTGAAGG - Intronic
1051358372 9:16260534-16260556 CCTGCTTCTTGGTTTGCAGCTGG - Intronic
1051463481 9:17350683-17350705 CTCTCTTCCTGGCTTGTAGATGG + Intronic
1051472366 9:17459699-17459721 CTCTCTCCTTGGTTTGTAGATGG + Intronic
1051520430 9:17981174-17981196 CATTCTTCCTGGTTTTCAGAGGG - Intergenic
1051739637 9:20238981-20239003 CTCTCTTCCTGGCTTATAGATGG - Intergenic
1051753950 9:20375035-20375057 CTCTCTTCCTGGCTTGCAGATGG - Intronic
1051861216 9:21627269-21627291 CCTGCTTCCAGGTTCATAGATGG - Intergenic
1051921431 9:22271057-22271079 CCTGCTTCCTGGTTGATAGATGG + Intergenic
1051951834 9:22644537-22644559 CTGGCTTCCTGGTTTGCAGATGG + Intergenic
1052090766 9:24324121-24324143 CTTGCTTTCTATTTTGTTGAAGG - Intergenic
1052138693 9:24949375-24949397 CTCTCTTCCTGGCTTGTAGATGG + Intergenic
1052165883 9:25327326-25327348 CTTTCTCCCTGGCTTGCAGATGG + Intergenic
1052202446 9:25799288-25799310 CTCTTTTCCTGGTTTGTAGATGG + Intergenic
1052341760 9:27370575-27370597 CTTGCTTCCTGTTTCACAGATGG - Intronic
1052441988 9:28509695-28509717 CTTTCTTCCTAGCTTGTAGAAGG - Intronic
1052551738 9:29959372-29959394 CTCTCTTCCTGGCTTGTGGATGG - Intergenic
1053085179 9:35213363-35213385 CATACTTCCTGGCTTGCAGATGG - Intronic
1053089718 9:35263845-35263867 CTTTCTTCCTGGCTTACAGATGG - Intronic
1053205819 9:36185802-36185824 CTCTCTTCTTGGTTTGCAGATGG - Intergenic
1053207016 9:36194969-36194991 ATTGCTTCTTGTTTTGTATATGG + Intronic
1053611929 9:39722692-39722714 ATCTCTTCCTGGCTTGTAGATGG - Intergenic
1054086327 9:60748463-60748485 ATCTCTTCCTGGCTTGTAGATGG + Intergenic
1054121816 9:61216331-61216353 CCTGCTTTCTGGTTCATAGATGG + Intergenic
1054241592 9:62619701-62619723 ATCTCTTCCTGGCTTGTAGATGG + Intergenic
1054555718 9:66654224-66654246 ATCTCTTCCTGGCTTGTAGATGG + Intergenic
1054702229 9:68424366-68424388 CTGGCTTCCTGGTTTATACATGG + Intronic
1054704531 9:68449052-68449074 CCTGCTTCCTGGTTCATAGATGG + Intronic
1055095815 9:72412968-72412990 CATGCCTCCTGGCTTGCAGATGG - Intergenic
1055332191 9:75196265-75196287 CTTTTTTCCTGGTTTACAGATGG + Intergenic
1055370565 9:75593809-75593831 CATGCTTGCTGGGTTGTAGATGG - Intergenic
1055578240 9:77681167-77681189 CTCTCTCCCTGGTTTGCAGAAGG - Intergenic
1055633931 9:78255522-78255544 CCTGCTTTCTGGTTCATAGATGG + Intronic
1055706385 9:79009746-79009768 CTTCCTCCCTGGATTGTAGATGG - Intergenic
1055880172 9:80991470-80991492 CTCTCTTCCTGGCTTGTAGATGG + Intergenic
1056298553 9:85218559-85218581 CCCTCTTCCTGGCTTGTAGATGG - Intergenic
1056320682 9:85432031-85432053 CTCACTTCCTGCTTTTTAGAGGG - Intergenic
1056720085 9:89064008-89064030 CCCTCTTCCTGGTTTGCAGACGG + Intronic
1056737346 9:89220980-89221002 CTCGCTCCTTGGCTTGTAGATGG - Intergenic
1056804054 9:89714201-89714223 CCCGCTTCCTGGTTCATAGATGG + Intergenic
1056939370 9:90941881-90941903 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1057013091 9:91624564-91624586 CCTTCTTCCTAGTTTGCAGAAGG - Intronic
1057040849 9:91846412-91846434 CTCTCTTCTTGGCTTGTAGATGG - Intronic
1057287924 9:93775266-93775288 CTCTCTTCCTTGCTTGTAGATGG - Intergenic
1057352977 9:94316021-94316043 CTCTCTTCCTGGCTTGCAGACGG + Intergenic
1057654769 9:96941570-96941592 CTCTCTTCCTGGCTTGCAGACGG - Intronic
1058032231 9:100213006-100213028 CCTGCTTCCTGGTTCATAGATGG + Intronic
1058116746 9:101092946-101092968 CCCTCTTCCTGGTTTGCAGATGG - Intronic
1058166030 9:101620243-101620265 CCTGCTTTCTGGTTCATAGATGG + Intronic
1058304873 9:103427456-103427478 CTGTCTTCCTGATTTGCAGATGG + Intergenic
1058415621 9:104785628-104785650 CCTGCTTTCAGGTTTGGAGATGG - Exonic
1058651452 9:107178870-107178892 CTGGCTTCCTGGTTTCTGGTGGG + Intergenic
1058724815 9:107792359-107792381 CCCTCTTCCTGGTTTGTACATGG - Intergenic
1058740397 9:107936908-107936930 CCTGCTTCCTCGTTTATAGATGG - Intergenic
1058886434 9:109324875-109324897 CCTGTTTCCTGGTTCATAGATGG - Intergenic
1058930555 9:109714844-109714866 CTTGCTTCATGGCTAGGAGATGG - Intronic
1058940334 9:109807480-109807502 CCTGTTTCCTGGTTCATAGATGG + Intronic
1059034604 9:110740338-110740360 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1059496998 9:114718262-114718284 CTCCCTTCCTGGCTTGCAGATGG - Intergenic
1059564699 9:115372098-115372120 CCTGCTTCCTGGTTCATAGATGG + Intronic
1059618562 9:115977722-115977744 CTCGCTTCCTGGTTTTCAGATGG - Intergenic
1059771466 9:117430581-117430603 CTCTCTCCCTGGTTTGTAGGTGG + Intergenic
1059829962 9:118084558-118084580 CTTGCTTCCCAGCTTGCAGACGG - Intergenic
1059882864 9:118711147-118711169 CCTTCTTCCTGGCTTGCAGATGG + Intergenic
1060003144 9:119976650-119976672 CTTTCTCCTTGGTTTATAGATGG + Intergenic
1060231969 9:121831959-121831981 CTCTCTTCCTGGTTTGCAGACGG + Intronic
1060241622 9:121908731-121908753 CTCTCTTCCTGGCTTGTAGATGG + Intronic
1060331421 9:122674453-122674475 CTTGTTTCTTGGTTTTCAGAGGG - Intergenic
1060496314 9:124121807-124121829 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1060758871 9:126232271-126232293 CTCTCTTCCTGGCTTGTGGATGG - Intergenic
1061277061 9:129575149-129575171 TTTGCTTCCTGGTTCATAGATGG - Intergenic
1061647999 9:132021874-132021896 CTCTTTTCCTGGTTTGCAGATGG - Intronic
1061702655 9:132427718-132427740 CCTCTCTCCTGGTTTGTAGATGG + Intronic
1061712171 9:132495870-132495892 CTCTCTTCTTGGTTTGCAGATGG - Intronic
1062251238 9:135596064-135596086 CTCTCTTCCTGGTTTGCAGATGG + Intergenic
1062404337 9:136387768-136387790 CTTGGATCCTGGTCTGAAGAAGG - Exonic
1203612190 Un_KI270749v1:19927-19949 CTGTCTTCCTGGTTTACAGATGG - Intergenic
1185480398 X:441848-441870 CTCCCTTCCTGGCTTGCAGACGG - Intergenic
1185664075 X:1750493-1750515 TTTGCTGCCTGCTTTGAAGATGG - Intergenic
1185676775 X:1855778-1855800 CTCGCTTCCTGGTTCATAGACGG + Intergenic
1185676789 X:1855855-1855877 CTCGCTTCCTGGTTCATAGACGG + Intergenic
1185676802 X:1855932-1855954 CTCGCTTCCTGGTTCATAGACGG + Intergenic
1185676816 X:1856009-1856031 CTCGCTTCCTGGTTCATAGACGG + Intergenic
1185676829 X:1856086-1856108 CTCGCTTCCTGGTTCATAGACGG + Intergenic
1185676843 X:1856163-1856185 CTCGCTTCCTGGTTCATAGACGG + Intergenic
1185676857 X:1856240-1856262 CTCGCTTCCTGGTTCATAGACGG + Intergenic
1185721002 X:2381343-2381365 CCTGCTTCCTGGTTCACAGACGG - Intronic
1185808296 X:3080628-3080650 CCTGCTTCCTGGTTCATACACGG + Intronic
1185827031 X:3261339-3261361 CCTCCTTCCTGGTCTGCAGATGG - Intergenic
1185827389 X:3264942-3264964 CCTGCTTCCTGATTCATAGACGG - Intergenic
1185828596 X:3276694-3276716 CTGGCTTCCTGGTTCATACATGG - Intronic
1185855434 X:3530615-3530637 CTTCCTTCCTGGTACGTAGATGG + Intergenic
1185869684 X:3653290-3653312 CCAGCTTCCTGGTTCGTAGACGG - Intronic
1185872264 X:3673930-3673952 CCCGCTTCCTGGTTCATAGATGG - Intronic
1185876765 X:3708221-3708243 CCTGCTTCCTGGTTCATAGATGG - Intronic
1185885677 X:3780489-3780511 CCTCCTTCCTGGTTCATAGATGG - Intergenic
1185959243 X:4529472-4529494 CTCGTTTTCTGGTTTGCAGATGG - Intergenic
1186014435 X:5175156-5175178 CTCTCTTCCTGGTTTGTAGATGG + Intergenic
1186027186 X:5326175-5326197 CTCTCTTCCTGCTTTGTAGATGG + Intergenic
1186033389 X:5393807-5393829 CTCTCTTCCTGGGTTGCAGATGG - Intergenic
1186103159 X:6177973-6177995 CCCACATCCTGGTTTGTAGATGG - Intronic
1186117388 X:6319225-6319247 CTCTCTTCCTGGTTCATAGATGG + Intergenic
1186144006 X:6606840-6606862 CTCTCTTCCTGTCTTGTAGACGG - Intergenic
1186148944 X:6653910-6653932 CTCTTTTCCTGGTTTGTGGATGG - Intergenic
1186160864 X:6775822-6775844 CCCGCTTCCTGGTTCATAGACGG - Intergenic
1186172839 X:6895856-6895878 CTCGCTTCCTAGTTCATAGACGG + Intergenic
1186174503 X:6910868-6910890 CCTGCTCCCTGGTTCATAGATGG + Intergenic
1186208210 X:7222088-7222110 CTTGCTTCCTGGTTCATAGATGG - Intronic
1186268974 X:7864515-7864537 CCCACTTCCTGGTTTGTAGACGG - Intergenic
1186325849 X:8476054-8476076 CTTGGTTCCTGGTTTTTATCAGG + Intergenic
1186387192 X:9121792-9121814 CCTGCTTTCTGGTTCGTAGATGG - Intronic
1186415347 X:9378684-9378706 CTCTCCTCCTGGTTTGCAGAGGG + Intergenic
1186440900 X:9585687-9585709 CTCTCTTCTTGGCTTGTAGAAGG + Intronic
1186450907 X:9672969-9672991 CCCGCTTCCTGGTTCATAGATGG + Intronic
1186468927 X:9806036-9806058 CCTACTTCCTGGTTTGTAGGAGG - Intronic
1186720354 X:12297108-12297130 CTTAGTTCCTGGTGTGTAAATGG - Intronic
1186745519 X:12564043-12564065 CCTGCCTCCTGGTTTGTAGTTGG + Intronic
1186890400 X:13953994-13954016 CTCGCTTCCTGGTTCATAAATGG + Intergenic
1187297405 X:18015193-18015215 CCTGCTTCCTGGTTCACAGATGG - Intergenic
1187338921 X:18404221-18404243 CTCTCTCCATGGTTTGTAGATGG + Intergenic
1187542124 X:20207143-20207165 CTTTCTTCCTGGTCTATTGAAGG - Intronic
1187581896 X:20616159-20616181 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1187892411 X:23948618-23948640 CTTGCTTCCTGGCTCATAGGTGG + Intergenic
1188050456 X:25478907-25478929 CTCTCTTTCTGGCTTGTAGATGG + Intergenic
1188112852 X:26212669-26212691 CGTGCTTCCTTGTTCATAGATGG - Intergenic
1188189095 X:27152327-27152349 CTCTGGTCCTGGTTTGTAGAAGG + Intergenic
1188573889 X:31622613-31622635 CCCTCTTCCTGGTTTGCAGATGG - Intronic
1188760763 X:34026846-34026868 CTTTCTTCCTGGCTGGTAGATGG + Intergenic
1188929461 X:36088579-36088601 CTCTTTTCCTGGCTTGTAGATGG - Intronic
1188934026 X:36151925-36151947 CTTGCTTTCTAGTTCATAGATGG + Intergenic
1189219953 X:39363047-39363069 CTCGCTTCCTGGTTCATAGATGG - Intergenic
1189324475 X:40104672-40104694 CTTGCAGCCTGGCTTGGAGACGG - Intronic
1189343314 X:40221104-40221126 CTCTCTTCCTGGCTTATAGATGG + Intergenic
1189343606 X:40223359-40223381 CTCTCTTCCTGGTTTGTAAACGG + Intergenic
1189356326 X:40312656-40312678 CTCTCTTCTTGGCTTGTAGATGG - Intergenic
1189367121 X:40397436-40397458 CCTGCTTCCTAGTTCATAGATGG + Intergenic
1189545834 X:42041994-42042016 CTCCCCTCCTGGCTTGTAGATGG + Intergenic
1189547491 X:42056940-42056962 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1189548846 X:42072338-42072360 TCTGCTTCCAGGTTTGCAGATGG - Intergenic
1189560238 X:42184797-42184819 CCTGATTCCTGGTTTATAGATGG - Intergenic
1189575987 X:42354155-42354177 CCTGCTTCCTGGTTCATAGATGG + Intergenic
1189738820 X:44098121-44098143 CTTTCTTCTTGGCTTATAGATGG + Intergenic
1189785995 X:44559226-44559248 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
1189916922 X:45864552-45864574 CTTGCTGCCTGGCTTTTAGTTGG - Intergenic
1190135752 X:47796071-47796093 CCCTCTTCCTGGTTTGCAGATGG - Intergenic
1190153528 X:47968132-47968154 CCACCTTCCTGGTTTGCAGATGG - Intronic
1190372064 X:49752414-49752436 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
1190381949 X:49847651-49847673 GCCGCTTCCTGGTTTGCAGATGG + Intergenic
1190434179 X:50407404-50407426 CTTCCTTCCTAGCTTGTAGAAGG + Intronic
1190688333 X:52893457-52893479 CTTGGTTCCTTATCTGTAGATGG + Intronic
1190697650 X:52962335-52962357 CTTGGTTCCTTATCTGTAGATGG - Intronic
1190838788 X:54127013-54127035 CCTGCTTCCTGGTATGCAGATGG + Intronic
1190928338 X:54928103-54928125 CTCTCTTCCTGGCTTGCAGATGG + Intronic
1191578825 X:62737642-62737664 CTTTCTTCCTAGTTTTTATATGG + Intergenic
1193758127 X:85433823-85433845 CTTTCTCCTTGGTTTGTAAATGG - Intergenic
1194579661 X:95656250-95656272 CGTGCTTTCTGGCTTGTAGATGG - Intergenic
1195628901 X:107033342-107033364 CTCTCTTCTTGGCTTGTAGATGG - Intergenic
1196410416 X:115412510-115412532 CCTGCCCTCTGGTTTGTAGATGG + Intergenic
1196507682 X:116467274-116467296 TTTGATTCCTAGTTTGTTGAGGG + Intergenic
1196731563 X:118946118-118946140 CTTGCTTCCTGGTTCACAGATGG - Intergenic
1196910321 X:120478227-120478249 CACTCTTCTTGGTTTGTAGATGG - Intergenic
1196963735 X:121032404-121032426 CTTGCTTTTTGGTCTGTAAATGG + Intergenic
1197037622 X:121895492-121895514 CTTGCTCCCCGGCTTGCAGATGG + Intergenic
1197110964 X:122774380-122774402 CTTTCTTCCTGGCTTGCAGACGG - Intergenic
1197182606 X:123552385-123552407 CCTACTTCCTGCTTTGCAGATGG + Intergenic
1197531925 X:127639299-127639321 CTTTCTTCCTGGCTTGCAGATGG - Intergenic
1197631842 X:128869832-128869854 CCTGGTTCCTGGTTTGCACAAGG + Intergenic
1197718624 X:129728627-129728649 CACTCTTCCTGGTTTGCAGATGG - Intergenic
1197733731 X:129834162-129834184 CCTGCTTTCTGGTTCATAGATGG - Intronic
1197788432 X:130224262-130224284 CCTGCTTCCTTGTTCATAGATGG - Intronic
1197828500 X:130615809-130615831 CTCTCTTCCTGGTTTGCAGATGG - Intergenic
1197970203 X:132107553-132107575 CTCTCTTCTTGGTTTGTAAATGG + Intronic
1198009733 X:132539371-132539393 CCTGCTTCCTGGCTTACAGATGG + Intergenic
1198135073 X:133741170-133741192 CTTTCTTCTTGGCTTGCAGATGG - Intronic
1198472778 X:136964537-136964559 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1198510940 X:137350857-137350879 CTTGCTTCTTGGCTTGCAGATGG + Intergenic
1198786079 X:140289734-140289756 CTTGCTCCTTGGCTTGCAGATGG + Intergenic
1198864796 X:141110295-141110317 TTTGCTTCCTTATTTGTAAATGG - Intergenic
1198897893 X:141477096-141477118 TTTGCTTCCTTATTTGTAAATGG + Intergenic
1198939720 X:141940127-141940149 ATGGCTTCCTGGTATTTAGAAGG - Intergenic
1199020604 X:142872758-142872780 CCTGTTTCCTGGCTTGTAGATGG - Intergenic
1199354342 X:146843529-146843551 TTTGATTCTTGGTTTGTTGAGGG + Intergenic
1199370767 X:147044819-147044841 GTTGCTCTCTGGTTTCTAGATGG + Intergenic
1199483288 X:148322133-148322155 CTCTCTGCCTGGCTTGTAGATGG + Intergenic
1199713494 X:150489325-150489347 CTCTCTTCCTGATTAGTAGATGG + Intronic
1199775841 X:151011145-151011167 CTTTCTCCTTGGTTTGTAGATGG - Intergenic
1199844648 X:151682036-151682058 CTCTCTTCCTGGCTTGCAGATGG - Intergenic
1199954120 X:152728734-152728756 CCTTATTCCTGGCTTGTAGATGG + Intronic
1199955576 X:152739717-152739739 CCTTATTCCTGGCTTGTAGATGG - Intergenic
1200021863 X:153218549-153218571 CCTGCTTCCTGGCTTGTGGGTGG + Intergenic
1200354612 X:155535026-155535048 CTCTCTTCCTGGCTTGCAGAAGG - Intronic
1200788598 Y:7280189-7280211 CCTGCTTCCTGGTTCATAGATGG + Intergenic
1200791640 Y:7304751-7304773 CCCGCTTCCTGGTTCATAGATGG + Intergenic
1201144289 Y:11054797-11054819 CTCTCTTCCTGGCTTGCAGATGG + Intergenic
1201148211 Y:11078213-11078235 ACTGCTTCCTGGCTTGCAGAGGG - Intergenic
1201436046 Y:13959594-13959616 CTTGGTTCCTGGTTTTTATCAGG - Intergenic
1201554130 Y:15250879-15250901 CCCGCTTCCTGGTTCATAGATGG - Intergenic
1201626264 Y:16018095-16018117 CTTGCTTCCTGCTTCATAGATGG + Intergenic
1201642375 Y:16193271-16193293 CTCTCTTCCTGGTTTGTTGATGG - Intergenic
1201660439 Y:16392049-16392071 CTCTCTTCCTGGTTTGTTGATGG + Intergenic
1201674390 Y:16562830-16562852 CCTGTTTCCTGGTTCATAGATGG - Intergenic
1201676106 Y:16586143-16586165 CCTACTTCCTGGTTCATAGATGG - Intergenic
1201688189 Y:16731400-16731422 CTTGCTTCCTGGTTCATAGATGG + Intergenic
1202231754 Y:22665858-22665880 TTTGTTTCCTGATTTGTGGAGGG - Intergenic
1202311404 Y:23530307-23530329 TTTGTTTCCTGATTTGTGGAGGG + Intergenic
1202559398 Y:26140287-26140309 TTTGTTTCCTGATTTGTGGAGGG - Intergenic