ID: 963908179

View in Genome Browser
Species Human (GRCh38)
Location 3:150791503-150791525
Sequence CTCTGTGTGTGGAGGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963908179_963908185 -5 Left 963908179 3:150791503-150791525 CCATGTGCCCTCCACACACAGAG No data
Right 963908185 3:150791521-150791543 CAGAGGCAACCCCTTCCCCTGGG No data
963908179_963908194 26 Left 963908179 3:150791503-150791525 CCATGTGCCCTCCACACACAGAG No data
Right 963908194 3:150791552-150791574 GTTCTTTCATGGTACCTGCTTGG No data
963908179_963908184 -6 Left 963908179 3:150791503-150791525 CCATGTGCCCTCCACACACAGAG No data
Right 963908184 3:150791520-150791542 ACAGAGGCAACCCCTTCCCCTGG No data
963908179_963908186 -4 Left 963908179 3:150791503-150791525 CCATGTGCCCTCCACACACAGAG No data
Right 963908186 3:150791522-150791544 AGAGGCAACCCCTTCCCCTGGGG No data
963908179_963908193 15 Left 963908179 3:150791503-150791525 CCATGTGCCCTCCACACACAGAG No data
Right 963908193 3:150791541-150791563 GGGGCTGCTTTGTTCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963908179 Original CRISPR CTCTGTGTGTGGAGGGCACA TGG (reversed) Intergenic
No off target data available for this crispr