ID: 963908309

View in Genome Browser
Species Human (GRCh38)
Location 3:150792473-150792495
Sequence TTGTGAGAAGGCAAGATCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963908309_963908316 20 Left 963908309 3:150792473-150792495 CCCCTGATCTTGCCTTCTCACAA No data
Right 963908316 3:150792516-150792538 GTTTTTTTTCTTATTTTATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963908309 Original CRISPR TTGTGAGAAGGCAAGATCAG GGG (reversed) Intergenic
No off target data available for this crispr