ID: 963914529

View in Genome Browser
Species Human (GRCh38)
Location 3:150845936-150845958
Sequence GAACCTTGTGTGCACCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963914529_963914535 14 Left 963914529 3:150845936-150845958 CCCCATGGGTGCACACAAGGTTC No data
Right 963914535 3:150845973-150845995 TTGTTCATGGACACATTATTTGG No data
963914529_963914537 22 Left 963914529 3:150845936-150845958 CCCCATGGGTGCACACAAGGTTC No data
Right 963914537 3:150845981-150846003 GGACACATTATTTGGAATGGTGG No data
963914529_963914533 1 Left 963914529 3:150845936-150845958 CCCCATGGGTGCACACAAGGTTC No data
Right 963914533 3:150845960-150845982 TTTTCCAGTTCTCTTGTTCATGG No data
963914529_963914536 19 Left 963914529 3:150845936-150845958 CCCCATGGGTGCACACAAGGTTC No data
Right 963914536 3:150845978-150846000 CATGGACACATTATTTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963914529 Original CRISPR GAACCTTGTGTGCACCCATG GGG (reversed) Intergenic
No off target data available for this crispr