ID: 963915312

View in Genome Browser
Species Human (GRCh38)
Location 3:150854370-150854392
Sequence CAGCAAACAGCAGTAGCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963915312_963915314 13 Left 963915312 3:150854370-150854392 CCGTCTGCTACTGCTGTTTGCTG No data
Right 963915314 3:150854406-150854428 GCCGCTGACTTCCATCCCTCTGG 0: 22
1: 88
2: 109
3: 75
4: 146
963915312_963915317 23 Left 963915312 3:150854370-150854392 CCGTCTGCTACTGCTGTTTGCTG No data
Right 963915317 3:150854416-150854438 TCCATCCCTCTGGATCTGGCAGG No data
963915312_963915319 24 Left 963915312 3:150854370-150854392 CCGTCTGCTACTGCTGTTTGCTG No data
Right 963915319 3:150854417-150854439 CCATCCCTCTGGATCTGGCAGGG 0: 13
1: 43
2: 96
3: 162
4: 295
963915312_963915316 19 Left 963915312 3:150854370-150854392 CCGTCTGCTACTGCTGTTTGCTG No data
Right 963915316 3:150854412-150854434 GACTTCCATCCCTCTGGATCTGG 0: 25
1: 61
2: 115
3: 90
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963915312 Original CRISPR CAGCAAACAGCAGTAGCAGA CGG (reversed) Intergenic
No off target data available for this crispr