ID: 963922699

View in Genome Browser
Species Human (GRCh38)
Location 3:150921388-150921410
Sequence GTGTGTGCGTGCACATGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 1, 2: 6, 3: 111, 4: 516}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963922699_963922702 -7 Left 963922699 3:150921388-150921410 CCCCTGCATGTGCACGCACACAC 0: 1
1: 1
2: 6
3: 111
4: 516
Right 963922702 3:150921404-150921426 CACACACGTACTGTGCACCCAGG 0: 1
1: 0
2: 2
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963922699 Original CRISPR GTGTGTGCGTGCACATGCAG GGG (reversed) Intronic
900122093 1:1053017-1053039 GTATGTGTGTGAACATGGAGGGG + Intronic
900177432 1:1297149-1297171 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177444 1:1297195-1297217 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177471 1:1297283-1297305 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177498 1:1297375-1297397 GTGTGTGTGTGCACAGGCACGGG + Intronic
900177510 1:1297421-1297443 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177537 1:1297509-1297531 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177564 1:1297601-1297623 GTGTGTGTGTGCACAGGCACGGG + Intronic
900177576 1:1297647-1297669 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900177603 1:1297733-1297755 GTGTGTGTGTGCACAGGCGCGGG + Intronic
900229059 1:1547073-1547095 TTGTGTGCAGCCACATGCAGAGG + Intronic
900334120 1:2152873-2152895 GTTTGTGCGTGCACCTGCCAAGG + Intronic
900426868 1:2584923-2584945 GTGTGTGTTTGCATATGTAGGGG - Intergenic
900600440 1:3500479-3500501 GTGTGTGCGCGCACAGGAGGGGG + Intronic
901150500 1:7098143-7098165 GCGTGTGTGTGCATGTGCAGGGG + Intronic
901404841 1:9039031-9039053 GAGTGTGCGTGCACATGGGTGGG - Intronic
901470735 1:9454628-9454650 GTGTGGGCGTCCACACGCATAGG - Intergenic
901661904 1:10803988-10804010 GTGTGTGTGTGCACTTGTGGAGG + Intergenic
902391918 1:16111903-16111925 GTGTGTGTGTGCACGTGGTGGGG - Intergenic
902538350 1:17134889-17134911 GTGTGCGCGTGCGCATGCGGGGG - Intergenic
902551587 1:17222829-17222851 GTGTGTGTGTGCACCTGCACGGG - Intronic
903550581 1:24155220-24155242 GTGTGTGTGTGCCCCAGCAGCGG + Exonic
904357306 1:29948692-29948714 GTGTGTGTGTGCACAGGCAGAGG - Intergenic
904357308 1:29948722-29948744 GTGTGTGTGTGCAGAGGCAGGGG - Intergenic
906077635 1:43063688-43063710 GTGTGTGTGCGCGCATGTAGGGG + Intergenic
906278615 1:44537162-44537184 GTGTGTGTGTGTGTATGCAGGGG - Intronic
906795732 1:48695196-48695218 GTGTGTCTCTGCAAATGCAGGGG - Intronic
907387864 1:54137693-54137715 GTGTGTGTGTGTGCATGCGGGGG + Intronic
907547615 1:55275628-55275650 GTGTGAGCGTGTACATGAATGGG - Intergenic
907875395 1:58482172-58482194 GCATGTGTGTGCACATGCACAGG + Intronic
909924633 1:81425259-81425281 CTGTGTGTGTACACATGCATGGG - Intronic
911717867 1:101155514-101155536 GTGGGTGCTTGCACATGGCGGGG + Intergenic
912693932 1:111826488-111826510 GTGGGTGTGTGCACATACAAAGG - Intronic
912750861 1:112286224-112286246 GTGTTTGCATGCACGTGGAGTGG + Intergenic
913111231 1:115658932-115658954 GTGTGTGTGTGTACATGGGGAGG - Intronic
915771548 1:158430895-158430917 GTGTGTCTTTGCACATGCAATGG + Intergenic
915903299 1:159861573-159861595 GTGGGTGCGTGCACCTGCATGGG - Intronic
915939925 1:160112552-160112574 ATGTGTGTGTGCACAGGGAGGGG - Intergenic
917159818 1:172044935-172044957 GTGGGAGCGTGCATATGAAGTGG + Intronic
917389220 1:174515374-174515396 GTGTGTGCATGCACAAACACAGG - Intronic
917980414 1:180265745-180265767 CTGTGTGCGTGCATAGGAAGGGG + Intronic
918126983 1:181592786-181592808 GTGTGTGTGTGTGCATGCATGGG - Intronic
918826935 1:189336623-189336645 GTGTGTGTTTGCACAAGCAATGG - Intergenic
918905009 1:190479735-190479757 TTGTGAGCGTGCACAGGCTGGGG - Intergenic
919161995 1:193841917-193841939 ATGTGTGTGTGCACATGCATGGG + Intergenic
919399353 1:197091240-197091262 GTGTGTGCACACACATGCACAGG + Intronic
919641904 1:200053554-200053576 GTGTGTGCGTGTGCATGCTGGGG - Intronic
919976542 1:202616455-202616477 GTGTGTGCGTGGTCACGAAGGGG - Intronic
920297705 1:204969152-204969174 GTGTGTGCATGCCCGTGCATGGG + Intronic
920524997 1:206659793-206659815 GTGTGTGCGCGCGCACGCACCGG - Intronic
920853692 1:209646701-209646723 GTGGCTGCATCCACATGCAGAGG - Intronic
920939880 1:210472140-210472162 GTGTGTGCGTGCACAAACACAGG - Intronic
921055915 1:211542369-211542391 GTGTGTGTGTGCACGTGGGGTGG - Intergenic
921148517 1:212381661-212381683 GTGTGTCTGTGCACATGCCCAGG - Intronic
921879533 1:220238934-220238956 GTATGTGTGTGCACATACACAGG - Intronic
922023165 1:221724721-221724743 GTGTGTGCATGCACATGGAGGGG + Intronic
922155264 1:223036111-223036133 GTGTGTGTGTGAGCATGCACAGG + Intergenic
923047886 1:230368805-230368827 GAGTGAGCATGCACATGCAGAGG + Intronic
924435496 1:244036803-244036825 ATGAGTGAGTGCACATGAAGAGG - Intergenic
1062987937 10:1786682-1786704 GTGTGTGTGTCCACAGGCATGGG - Intergenic
1063074775 10:2703804-2703826 GTGTCTGCGTGTGCATGCACAGG + Intergenic
1063155501 10:3375674-3375696 GTGTGTGGATGCCCAGGCAGGGG - Intergenic
1063382103 10:5591895-5591917 GTGTGCGCGTGCACGTGCAGAGG - Intergenic
1063888970 10:10609447-10609469 GTGTGTGTGTGCACGCGCGGTGG - Intergenic
1064847344 10:19670055-19670077 GTGTGTGTGTGCACGTGCGAGGG - Intronic
1065921455 10:30396897-30396919 GTGTGTGTGTACACATGCTCAGG - Intergenic
1066557043 10:36625524-36625546 GTGCATGTGTGCACATGCATTGG + Intergenic
1067070776 10:43129778-43129800 GTGTGTGCGCACACACCCAGAGG + Exonic
1067074205 10:43164434-43164456 GTGTGTGTGCACACATGCATGGG - Intronic
1067189613 10:44058484-44058506 GTGTGTACGTACACATGCATGGG + Intergenic
1067552671 10:47246452-47246474 GTGTGTGCATGTGCATGGAGAGG - Intergenic
1068080620 10:52314141-52314163 GTGTGTTTGTGTACATGAAGGGG - Intergenic
1068859416 10:61831334-61831356 GTGTGTGTGTGTTCATCCAGGGG + Intergenic
1069851596 10:71408961-71408983 GTGTGTGCATGTGCATGCATTGG + Intronic
1069992103 10:72322325-72322347 CTGTGTGCGTGCACAGGGAGGGG + Intergenic
1070637204 10:78139257-78139279 GTGTGTGCGTGTGCAGGCGGAGG + Intergenic
1071953600 10:90732813-90732835 GTGTGTGCATGCACATGTATAGG + Intergenic
1073068201 10:100776628-100776650 CTGTGTGCCTGCTGATGCAGGGG + Intronic
1073392586 10:103192263-103192285 GTGTGTGCGCGCCCGTCCAGGGG - Intronic
1073448024 10:103592592-103592614 GCGTGTGCGTGCACATGTGGGGG + Intergenic
1073574273 10:104608667-104608689 ATGTGTCCTTGCACATGGAGTGG - Intergenic
1074245485 10:111687049-111687071 GTGTGTGTGTGCACGTGCACAGG + Intergenic
1074465580 10:113679043-113679065 GTGTGTGTGTGCGTATGCTGTGG + Intergenic
1075341381 10:121649146-121649168 GTGTGTGCCTGCACATCAACTGG + Intergenic
1075450777 10:122550683-122550705 GTGTGTGTGTGTACATGTACAGG - Intergenic
1075658327 10:124175982-124176004 GTGGCTGCGTGCACAGGAAGTGG - Intergenic
1076420493 10:130327952-130327974 CTGTGTGTGTGCACATGCACTGG + Intergenic
1076496647 10:130901746-130901768 GTGTGTGGCTGCAGATGAAGTGG + Intergenic
1076568819 10:131417910-131417932 GTGTGCGCGTGCACAGGCATGGG - Intergenic
1076568821 10:131417916-131417938 GTGTGTGTGTGCGCGTGCACAGG - Intergenic
1076841086 10:133045637-133045659 GAGTGTGTGTGTACATGCATGGG + Intergenic
1077470168 11:2754255-2754277 GTCTGTGTGTTCCCATGCAGTGG + Intronic
1077783464 11:5357229-5357251 GTGTGTGTGTGCACATGAGATGG - Intronic
1077785162 11:5375564-5375586 GTGTGTGTGTGCACATGAGATGG - Intronic
1078188731 11:9074408-9074430 GTGTGTGTGTGCGCGTGCAAGGG + Intronic
1078642312 11:13108262-13108284 GTATGTGTGTGCACATGTTGGGG - Intergenic
1078724903 11:13921367-13921389 GTGTGTGCGCGCACACACACAGG - Intergenic
1079133734 11:17764357-17764379 GTGTGTGTGTGGACATGTATGGG - Intronic
1081589379 11:44410423-44410445 GAGTGTGCCTGCAAAGGCAGTGG + Intergenic
1081760020 11:45570625-45570647 GGGTGTGTGTGTGCATGCAGGGG + Intergenic
1082008054 11:47431569-47431591 GTGTGTGTGTACACACACAGAGG - Intergenic
1082209839 11:49485483-49485505 GTGTGTGTGTACACATACATTGG - Intergenic
1082281571 11:50276339-50276361 GTGTGTGCATGTAAATGCTGGGG + Intergenic
1082755385 11:57070295-57070317 ATGGATGTGTGCACATGCAGTGG - Intergenic
1084033196 11:66492963-66492985 GTGTGTGTGTGGACAGGGAGGGG - Intronic
1084592698 11:70099695-70099717 GTCTGTGCTTGCACAGGCAGGGG + Intronic
1084979741 11:72822720-72822742 GTGTGGGTGTACACGTGCAGCGG - Intronic
1086380500 11:86247248-86247270 GTGTGTGCGTGCGCATGCCTTGG + Intronic
1086490140 11:87351106-87351128 GTGGGTGACTGCATATGCAGTGG + Intergenic
1086539116 11:87886329-87886351 GTGTGTGCATGCACATGTGCAGG + Intergenic
1086779862 11:90889873-90889895 GTGTGTGTGTGTATATTCAGAGG + Intergenic
1087072355 11:94093674-94093696 ATGTGTGCATGCACATGCTTGGG - Intronic
1087097649 11:94335085-94335107 CTGTGTGTGTGCGCAGGCAGAGG - Intergenic
1088062183 11:105668187-105668209 GTGTGTGTGTGTATATGCAATGG - Intronic
1088566384 11:111177253-111177275 GTGTGTGCATGCACACACAAGGG + Intergenic
1089056499 11:115589991-115590013 GTGCTTGCGTACACATGCATGGG + Intergenic
1089140440 11:116279905-116279927 GTGTGTGCGCGCACACACATAGG - Intergenic
1089153769 11:116385197-116385219 GTGTGTGCCTGCATGTGCATGGG - Intergenic
1089287789 11:117418841-117418863 ATGAGTGTATGCACATGCAGGGG + Intergenic
1089623782 11:119738359-119738381 GTGTGTGCATTCACATGCATAGG - Intergenic
1089650089 11:119907355-119907377 ATGTGGGCGTCCACTTGCAGAGG + Intergenic
1089702086 11:120251307-120251329 GTGTGTGTGTGCGCACGCACAGG - Intronic
1089900092 11:121973004-121973026 TTGTGTGTGTGCACATGCTGGGG - Intergenic
1090344605 11:126059518-126059540 GTGTGTGTGTGCAGAGGGAGTGG - Intronic
1090401366 11:126450953-126450975 GTGTGAGCGTGTGCATGCATGGG + Intronic
1090543813 11:127739314-127739336 GTGTGTGCGTGCACATATGAGGG + Intergenic
1090996130 11:131867323-131867345 CTGTGTGCGTGCGGATGGAGAGG + Intronic
1091678833 12:2511561-2511583 GTGTGTGTGTGTACATGCATAGG - Intronic
1092218574 12:6698516-6698538 GTGAGTGTGTGTACGTGCAGGGG + Intronic
1093101681 12:15036566-15036588 GTGTGTGTTTGCACATGTGGAGG - Intergenic
1094383826 12:29872456-29872478 GTGCATGCGTGCATATGCATGGG + Intergenic
1094785202 12:33840642-33840664 GTGTGTGTGTGTAGATGCATTGG - Intergenic
1098041151 12:66355226-66355248 GTGTGTGTGTGCACACACACTGG + Intronic
1098919180 12:76287244-76287266 GTGTGTGCGTGTGTGTGCAGAGG + Intergenic
1099913764 12:88865768-88865790 GTGCATGCCTGCACATGCATAGG - Intergenic
1101109659 12:101473313-101473335 CTGAGAGCGTGCACATGAAGTGG + Intergenic
1101152975 12:101901117-101901139 GTGTGTGTCTGTACATGCTGGGG + Intronic
1101389298 12:104285977-104285999 GTGTGTGTGTGCCCATTTAGAGG + Intronic
1101584692 12:106075054-106075076 GTGAGTGTGTGCATGTGCAGCGG - Intronic
1101966339 12:109284781-109284803 GTGTGTGTGCGCACATGCTGTGG + Intronic
1101966389 12:109285168-109285190 GTGTGCGCGTGCGTATGCATCGG + Intronic
1102484601 12:113247293-113247315 GGGTGTGAGTGCAGATGGAGTGG - Intronic
1103129523 12:118455109-118455131 ATGTGTGTGTGCACCTGCTGGGG + Intergenic
1104894716 12:132158536-132158558 GTGTGTGTGTGCGCATGTAGTGG - Intergenic
1104916545 12:132268264-132268286 GTGTGTGCGTGCGTGTGTAGGGG - Intronic
1104979160 12:132565665-132565687 GTGTGTACGTGCCCAAGCACAGG + Intronic
1105209311 13:18248323-18248345 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1105323263 13:19347223-19347245 GTGTGTGCGCGCACTTGGTGGGG - Intergenic
1105532083 13:21229343-21229365 GTGTGTGAGTGTGCATGTAGGGG - Intergenic
1105627544 13:22127407-22127429 GTGTGTGTGTGTGCATGCATAGG - Intergenic
1106019700 13:25902930-25902952 GTGTGTGTGTGTGCATGCTGAGG - Intronic
1106027688 13:25971026-25971048 GTGTGCGCGCACACATGCACGGG + Intronic
1106113341 13:26795986-26796008 GTGTGTGTGTGCAGGTGGAGAGG + Intergenic
1106594862 13:31127353-31127375 GTGTGTGCATGCATATGCATGGG + Intergenic
1107045047 13:35984882-35984904 GTGTGTGCATGCGCACGCTGGGG - Intronic
1107228991 13:38086059-38086081 GTGTGTGTGTGCACCTGGGGAGG + Intergenic
1108600090 13:51985171-51985193 GTGTGTGTTTGCACATGAGGTGG - Intronic
1109253363 13:60048057-60048079 GTGAATGCCTGCACATGCAGTGG + Intronic
1110270804 13:73587806-73587828 GTGTGTGAGCGCACATACACAGG + Intergenic
1110875940 13:80510557-80510579 GTGTGTGTGTGTACATGTGGGGG + Intergenic
1112312666 13:98333426-98333448 GTGTGTGTGTGTACATGTGGGGG - Intronic
1113186144 13:107687491-107687513 GTGTGTGTGTGCATGTGCACTGG - Intronic
1113349672 13:109516790-109516812 GTGTGTGCGCGCACATGTGCAGG + Intergenic
1113667444 13:112150765-112150787 GTGTGTGTGTGCGCTTGCTGTGG - Intergenic
1113667482 13:112150911-112150933 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1113667505 13:112151011-112151033 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1113667515 13:112151063-112151085 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1113667524 13:112151136-112151158 GTGTGTGTGTGCGCTTGCCGTGG - Intergenic
1113870564 13:113557210-113557232 ATGTGTAAGTGCACATGCACAGG + Intergenic
1114245865 14:20912831-20912853 GTGTGTGTGTGCACATGAGATGG - Intergenic
1115015764 14:28611693-28611715 GTATGTGGGTGCTCATGCACTGG + Intergenic
1115075353 14:29382867-29382889 GTGTGTGTGTGTGCATGCACTGG + Intergenic
1115922698 14:38394169-38394191 GTGTGTGTGTGTGCATGCATAGG - Intergenic
1117002205 14:51382238-51382260 GTGTGTGTGTGTACATGGAGGGG + Intergenic
1119350042 14:73956947-73956969 GTGTGTGCATGTACATGCATAGG + Intronic
1119778698 14:77264264-77264286 GTGTGTGCATGGGCATGCACTGG - Intergenic
1119988303 14:79165698-79165720 GTGTGTGCATGGACAGGGAGGGG + Intronic
1120179745 14:81331101-81331123 GCTTGTGTGTGCACGTGCAGTGG + Intronic
1120811719 14:88810602-88810624 GTGTGTGTGTGCATATGGAAGGG - Intergenic
1121416900 14:93785895-93785917 GTGTGTGTGTGTGTATGCAGGGG - Intronic
1121869305 14:97392626-97392648 GTGTGTGTGCACACATGCATGGG - Intergenic
1121883853 14:97524860-97524882 GTGTGTGTGTGGACAAGCTGAGG + Intergenic
1122043614 14:99007926-99007948 GTGTGTGCACGCACATGCAATGG - Intergenic
1122259285 14:100503071-100503093 GTGTGTGCATGCGCATTCAGAGG + Intronic
1123428537 15:20193700-20193722 GTGTGTGCGCGCACATAGCGGGG + Intergenic
1123460362 15:20464823-20464845 GTGTGCCTGTGCACATGCACAGG - Intergenic
1123657700 15:22535594-22535616 GTGTGCCTGTGCACATGCACAGG + Intergenic
1124269778 15:28269874-28269896 GTGTGCCCGTGCACATGCACAGG - Intronic
1124311609 15:28630792-28630814 GTGTGCCTGTGCACATGCACAGG + Intergenic
1124455877 15:29842450-29842472 GTGTGTGGGTGCACCTGCGGTGG - Intronic
1124590719 15:31050662-31050684 GTGCATGTGTGCACATACAGAGG - Intronic
1124635103 15:31360252-31360274 GTGTGGGCACGGACATGCAGCGG + Intronic
1125248946 15:37677166-37677188 CTGTGCGGGTGCGCATGCAGAGG + Intergenic
1125363671 15:38890921-38890943 ATGTGTGTGTGCATATGCGGTGG + Intergenic
1125383097 15:39108319-39108341 GTGTGTGTGTGTGTATGCAGGGG + Intergenic
1126328061 15:47503649-47503671 TTGTGTCTGTGCACATGCAGGGG + Intronic
1126419531 15:48456866-48456888 GTGTGTGCGTGCATGTGTTGGGG + Intronic
1126891680 15:53212141-53212163 GTGTATGTGTGTACATGCATGGG - Intergenic
1127013982 15:54662342-54662364 GTGTGTGTGTGTATAAGCAGAGG - Intergenic
1127867570 15:63044148-63044170 GTGTGAGCGTGCACTTACATCGG - Exonic
1128222650 15:65980046-65980068 GTGTGTGTGTGCAAGTGCAGGGG + Intronic
1128519406 15:68365564-68365586 GTGTGTGTGTGCACGTGTACAGG + Intronic
1129741243 15:77990656-77990678 GTGTGTGCGCGCGCATGTTGGGG - Intronic
1129835994 15:78706198-78706220 GTGTGTGTGTACACATGCTCAGG + Intronic
1130550399 15:84886869-84886891 GTGTGTGCACGCACATGCACGGG + Intronic
1130686252 15:86040457-86040479 GTGCGTGTGTGCCCATGCAGAGG + Intergenic
1130931237 15:88429553-88429575 GTGTGCGCATGCACATACATAGG - Intergenic
1131639248 15:94272301-94272323 GTGTGTGGGTGTGCATGCATTGG + Intronic
1131639372 15:94273747-94273769 GTGTGTGGGTGTGCATGCATTGG - Intronic
1132097227 15:98996536-98996558 GTGTGTGTGTGCATATGTATAGG + Intronic
1132124657 15:99212286-99212308 GTGTGTGCATGCATGTGCAATGG + Intronic
1132505933 16:308726-308748 GTGTGTGCGTGCTTGTGCTGTGG - Intronic
1133496789 16:6326030-6326052 GTGTGTACATGCATATGCATTGG + Intronic
1135650303 16:24200701-24200723 ACATGTGTGTGCACATGCAGGGG + Intronic
1135830028 16:25764871-25764893 GTGTGTGCATGAACTTGCTGTGG + Intronic
1136578086 16:31135883-31135905 GTATGTGTGTGCACATGCATAGG + Intergenic
1136623123 16:31443099-31443121 GTGTGTGCATGCGCATGGCGCGG - Intronic
1136704775 16:32177999-32178021 GTGTGCCTGTGCACATGCACAGG - Intergenic
1136763138 16:32751408-32751430 GTGTGCCTGTGCACATGCACAGG + Intergenic
1136804962 16:33118978-33119000 GTGTGCCTGTGCACATGCACAGG - Intergenic
1137484944 16:48882900-48882922 GTGTGAGCCTGAACATGCAGGGG - Intergenic
1137561069 16:49502755-49502777 GTGTGTGCATGCATATAGAGTGG - Intronic
1137911526 16:52382901-52382923 GTGTGTGTGTGCACGTGCAAAGG - Intergenic
1138116084 16:54361818-54361840 GTGTGTGCGTGCACGCTCAGGGG + Intergenic
1138397060 16:56713007-56713029 GTGTGTGCGTGCACACTCAAAGG - Intronic
1138431806 16:56973560-56973582 GTGTGTGTGTGCACACGCATGGG + Intronic
1138576809 16:57912898-57912920 GTGCATGCATGCACATGCAGGGG + Intronic
1139641781 16:68296847-68296869 ATGTGTGCATGCGCATGCAGAGG + Intronic
1140105398 16:71955270-71955292 GTGTGTGTGTGGAGGTGCAGTGG + Intronic
1140110759 16:72002635-72002657 GTGTGTGTGTGTACATGTAGGGG + Intergenic
1141304749 16:82851695-82851717 GTGTGTGCATGCACATGTCCTGG + Intronic
1141492863 16:84386613-84386635 GTCTGTGTGTGCATACGCAGTGG - Intronic
1141549493 16:84795842-84795864 AAGTGTGCCTGCACCTGCAGGGG - Intergenic
1203065290 16_KI270728v1_random:1011730-1011752 GTGTGCCTGTGCACATGCACAGG + Intergenic
1142884557 17:2904558-2904580 GTGTGTGTGTGTACGTGCAGAGG + Intronic
1143102603 17:4512638-4512660 GTGTGTGCGTGCGCGCGCACGGG + Intronic
1143163657 17:4886875-4886897 GTGTGTGCGAGCACAAGCACAGG + Intronic
1143963556 17:10739545-10739567 GTGTGTGTGTGCACGTGAAGTGG - Intergenic
1144099542 17:11931668-11931690 GGGTGTGGGTGCACATGCCATGG - Intronic
1144172835 17:12676230-12676252 GTGTGTGCGTGCGCGCGCAGGGG - Intronic
1144801159 17:17928576-17928598 GTGTGTGCATGCTCACGCGGGGG - Intronic
1145390292 17:22450558-22450580 GTGTGTGTGTGCACATGTGTGGG - Intergenic
1146681712 17:34813155-34813177 GTGTGTTCGTGCATGTGCACAGG - Intergenic
1147177008 17:38662227-38662249 GTGTGTGTGTGCATGTGCATAGG + Intergenic
1147252142 17:39159175-39159197 GTGTGTGCCACCACATCCAGCGG + Intronic
1147266389 17:39237296-39237318 GTGTGTGTGTGGTCAGGCAGAGG + Intergenic
1147946834 17:44085102-44085124 GTGTGTTCCCGCACATGCACTGG + Exonic
1148340955 17:46873075-46873097 GTGTGTGTGTGAAGAGGCAGAGG - Intronic
1148621123 17:49035613-49035635 CTGCGGGCGTGCACCTGCAGCGG + Intronic
1148790981 17:50172449-50172471 ATGTGTGTGTGCACATGCCTGGG + Intronic
1148859214 17:50595376-50595398 GTGTGTGCGTGCCTGTGCTGAGG + Intronic
1148867482 17:50636204-50636226 GTGTGTGCGTACACACACAAAGG - Intronic
1149287819 17:55185453-55185475 GTGTGTGTGTGCACATAGAGAGG + Intergenic
1149548022 17:57518756-57518778 GTGCGTGCGTGCATGTGCTGGGG - Intronic
1149574369 17:57701182-57701204 AGGTGTACGTGCACATGAAGTGG + Intergenic
1151379061 17:73712279-73712301 GTGTGTGCGTGCACATGTGGGGG + Intergenic
1151391689 17:73791478-73791500 GGGTGCACCTGCACATGCAGGGG - Intergenic
1151509830 17:74551437-74551459 GTGTGTGCGCACGCATGCACAGG - Intergenic
1151713126 17:75817970-75817992 GTGTGTGCATGCATGTGAAGAGG + Intronic
1151914579 17:77108090-77108112 GTGTGTGCGTGCGCATGGTATGG - Intronic
1152062669 17:78090130-78090152 GTGTGTGTGTGCATGTGCATAGG + Intronic
1152139225 17:78526475-78526497 ACGTGTGCGAGCACATGCATGGG - Intronic
1152148683 17:78585156-78585178 GTGTGTGTGTGCGCGTGCATAGG - Intergenic
1152235699 17:79137228-79137250 GTGTGTGTGTGTGCATGAAGAGG - Intronic
1152235840 17:79137982-79138004 ATGTGTGCTTGCACAGGCGGAGG + Intronic
1152290904 17:79439691-79439713 GAGTGTGTGTGCATGTGCAGAGG - Intronic
1152470084 17:80486276-80486298 TTGTGTGTGTGCATGTGCAGGGG + Intergenic
1153010300 18:532454-532476 ATGTGAGCGTGCTTATGCAGAGG - Intergenic
1153741695 18:8136916-8136938 GTGTGTGTGAACATATGCAGAGG - Intronic
1154001177 18:10483667-10483689 GTGTGTGCCTGCCCAGTCAGTGG + Intronic
1155245756 18:23907392-23907414 GTGGGTCTGGGCACATGCAGTGG + Intronic
1155386401 18:25282538-25282560 GTGTGAGCTTGCACATGGAGGGG + Intronic
1156099776 18:33578854-33578876 GTGTGTGCGTGCGCGCGCGGAGG + Intronic
1157032974 18:43935846-43935868 GTGTGTGTGTGTGCGTGCAGTGG + Intergenic
1157263890 18:46200086-46200108 GTGTGTGCGCGCGCGTGCTGGGG + Intronic
1157273961 18:46297112-46297134 GTGTGTGTGTGTGCATGCACAGG + Intergenic
1157289104 18:46397375-46397397 GTGTGTGTGTGGTCATGCTGAGG + Intronic
1157289109 18:46397422-46397444 GTGTGTGTGTGGTCATGCTGAGG + Intronic
1157289115 18:46397460-46397482 GTGTGTGTGTGGTCATGCTGAGG + Intronic
1157289119 18:46397496-46397518 GTGTGTGTGTGGTCATGCTGAGG + Intronic
1157289133 18:46397566-46397588 GTGTGTGTGTGGTCATGCTGGGG + Intronic
1157289137 18:46397602-46397624 GTGTGTGTGTGGTCATGCTGAGG + Intronic
1157289153 18:46397723-46397745 GTGTGTGTGTGATCATGCTGAGG + Intronic
1157289157 18:46397770-46397792 GTGTGTGTGTGATCATGCTGAGG + Intronic
1157289164 18:46397817-46397839 GTGTGTGTGTGGTCATGCTGGGG + Intronic
1157289169 18:46397870-46397892 GTGTGTGTGTGATCATGCTGAGG + Intronic
1157289185 18:46397964-46397986 GTGTGTGTGTGGTCATGCGGAGG + Intronic
1157289207 18:46398135-46398157 GTGTGTGTGTGGCCATGCAGAGG + Intronic
1158017149 18:52797677-52797699 GTGTGTGCAGGCACCAGCAGTGG + Intronic
1159366510 18:67472653-67472675 GTGTGTGTGTGCACACGCTGGGG + Intergenic
1159475379 18:68914330-68914352 GTGTGTGAGTGGCCCTGCAGTGG + Intronic
1159985426 18:74835656-74835678 GTGTGTGTGTGTAAATGGAGAGG + Intronic
1160130304 18:76219193-76219215 GTGTGTTCGTGTACATGCACAGG + Intergenic
1160518063 18:79489263-79489285 GACTGTGCGTGGACATGGAGGGG + Intronic
1160605174 18:80044738-80044760 GTATGTGTGTGTACATGCACAGG - Intronic
1161156478 19:2734383-2734405 GTGTGTGTGTGCACGTGCGCAGG - Intronic
1161459716 19:4389498-4389520 CTGTGTGAGTTCCCATGCAGGGG + Intronic
1161725470 19:5925871-5925893 GTGTGCGCGTGCATGTGCTGGGG + Intronic
1161725843 19:5928190-5928212 GGGAGTGCAGGCACATGCAGAGG - Intronic
1161839585 19:6671265-6671287 GTGTGTGTGCGCACTTGCACGGG + Intergenic
1162015267 19:7842212-7842234 GTGTGTGTGTGAATATGCATAGG + Intronic
1162379247 19:10322234-10322256 GTGTGTGTGTGCACACACTGAGG + Intronic
1162775490 19:12976375-12976397 GTGTGTGTGTGTAAATGCACAGG + Intergenic
1163390762 19:17028421-17028443 GTGTGTGCGTGCACGCGCGCAGG + Intergenic
1164755557 19:30686432-30686454 ATGTGTGTGTGCACACCCAGGGG + Intronic
1165107839 19:33484548-33484570 CTGTGTGTGTGCATATACAGTGG - Intronic
1166305327 19:41934351-41934373 CCGTGTGCCTGCACATGCTGTGG + Intergenic
1168307621 19:55443884-55443906 GTGTGTGCGTGTGCATGCCAGGG - Intergenic
925305293 2:2844115-2844137 GTGTGCGCGTGTACATACAGGGG + Intergenic
925556193 2:5133686-5133708 GTGTGTGTGTGTGCATGCTGTGG - Intergenic
926067728 2:9857748-9857770 GTGTGAGCAAGCCCATGCAGGGG + Intronic
926446148 2:12945552-12945574 ATGTGTTGGTGAACATGCAGAGG + Intergenic
928712541 2:34023520-34023542 GTGTTTGTGTGCACACGCATAGG + Intergenic
929457298 2:42075039-42075061 GTGTGGGGGAGCACATGGAGGGG - Intergenic
930946523 2:57083505-57083527 GTGTGTGCGTGAACAGGCATGGG + Intergenic
932430963 2:71673292-71673314 GTGTGGGACTGCACATGCGGAGG - Intronic
932684853 2:73859979-73860001 GTGTGTGCGTGCATATGTTTGGG + Intronic
933189791 2:79321782-79321804 GTGTGTGTGTGCAAACACAGTGG - Intronic
936247154 2:110838115-110838137 GTGCATGTGTGCACATGCGGTGG + Intronic
936248177 2:110846528-110846550 TTGTTTGCATGCATATGCAGTGG + Intronic
937476858 2:122223289-122223311 GTGTGTGTGTGTGTATGCAGAGG + Intergenic
937477030 2:122224914-122224936 CTGTGTGTGTGCACACGCACAGG + Intergenic
937477179 2:122226115-122226137 CTGTGTGTGCGCACATGCACAGG + Intergenic
938243340 2:129759441-129759463 GTGTGTGTGTGCACACCCATGGG - Intergenic
938416417 2:131106527-131106549 GTGCGTCTGTGCCCATGCAGTGG + Intronic
938461892 2:131502709-131502731 GTGTGCGCGTGCGCGTGCAATGG - Intergenic
939758204 2:146139294-146139316 GTGTGTGCATGCATATGCACAGG + Intergenic
940405055 2:153291892-153291914 GTCTTTGCATGCACGTGCAGTGG + Intergenic
940586858 2:155663174-155663196 GTGTGTGTGTGTACATGCCTGGG + Intergenic
941547057 2:166864660-166864682 GTGTGTGCATGCACATTTTGGGG + Intergenic
942061499 2:172232243-172232265 GTGTGTGTGTGTGCATGCTGGGG + Intergenic
942448594 2:176094374-176094396 GTGTGTGTGTGCGTTTGCAGGGG - Intronic
942624829 2:177888829-177888851 GTATGGGCATGCACATGCACTGG - Intronic
942865560 2:180670126-180670148 GTGTGTGCATGCACAGAGAGAGG + Intergenic
943288089 2:186031065-186031087 GTGTGGGTGTGTACATGCAAGGG - Intergenic
944094565 2:195951818-195951840 GTGTGTGCCTGCACATGAGATGG + Intronic
944494906 2:200296895-200296917 GTGCGTGCGCGCGCATTCAGGGG - Intergenic
946641363 2:221786754-221786776 GTGTGTGCGTGTGGATGCATTGG + Intergenic
948794068 2:240393162-240393184 GTGTGTGTGTGTGCATGCACAGG + Intergenic
1169473023 20:5904561-5904583 GTGTGTGTGTGCACGCGCACAGG + Intergenic
1170446525 20:16433568-16433590 GTGTGTGTGTCTACATGCTGGGG - Intronic
1170656088 20:18288789-18288811 GTGTGGGCGTGCATCTCCAGGGG + Intronic
1170797140 20:19557963-19557985 GTGTATGTGTGTACATGCATGGG + Intronic
1171824642 20:29883943-29883965 GTGTGCGTGTGCACATGGTGTGG - Intergenic
1172658034 20:36548893-36548915 GTGTGGGGGTGCACGTGAAGGGG - Intronic
1172838504 20:37888086-37888108 GGGTGTGGGTTCCCATGCAGAGG + Intergenic
1173119388 20:40275014-40275036 GTGTGTGCATGTACATGCTTGGG + Intergenic
1173163217 20:40667764-40667786 GTGTGTGTGTGCATGTGGAGGGG + Intergenic
1173341287 20:42155006-42155028 ATGTGTGTGGGCACATGCTGGGG + Intronic
1174191912 20:48746931-48746953 GTGTGTGTGTGTTCATGCACTGG - Intronic
1174736765 20:52972439-52972461 GTGTGTGTGTGCATATGTGGGGG + Exonic
1174845733 20:53941422-53941444 GTGTGTGTGTGTACGCGCAGTGG + Intronic
1175073370 20:56353483-56353505 ATGTGTGCGGGCACCTGCTGAGG - Intergenic
1175172876 20:57092430-57092452 GTGTGTGAGTGAATGTGCAGGGG - Intergenic
1175851327 20:62095111-62095133 GTATGTGCCTGCACCTGCACAGG + Intergenic
1175896316 20:62337098-62337120 GTGTGTTAGTGCACGTGTAGTGG - Intronic
1177729810 21:25014195-25014217 GTCTGAGGGTGCACAGGCAGTGG - Intergenic
1177860830 21:26451862-26451884 GTGTGTGTGTGTGCGTGCAGTGG - Intergenic
1179188290 21:39102164-39102186 GTGTGTGTGTGTAGATGGAGGGG - Intergenic
1179228214 21:39474897-39474919 GTGTGTGTGTGCTCTTGCTGTGG + Intronic
1180766947 22:18350974-18350996 GTGTGTGTGTGCACGTGCACTGG + Intergenic
1180779367 22:18511405-18511427 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1180812082 22:18768725-18768747 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181198238 22:21202969-21202991 GTGTGTGTGTGCACGTGCACTGG - Intergenic
1181401507 22:22652835-22652857 GTGTGTGCGCGCACGTGCACTGG + Intergenic
1181429869 22:22872744-22872766 GTGTGTGTGTGCATATGGTGTGG + Intronic
1181435517 22:22908207-22908229 GGGTGTAGGTGCACATGGAGGGG - Intergenic
1181494613 22:23280950-23280972 GTGTGTGTGTTCCCATGCAAGGG - Intronic
1181625869 22:24121723-24121745 GTGTGTGTGGGCTCTTGCAGTGG - Intronic
1181638977 22:24187087-24187109 GTGGGTGAGGGCACCTGCAGGGG - Intronic
1181648046 22:24244284-24244306 GTGTGTGTGTGCACGTGCACTGG - Intronic
1181703467 22:24633932-24633954 GCGTGTGTGTGCACGTGCACTGG + Intergenic
1182340869 22:29619776-29619798 GTGCGTGCGTGCTGATGAAGGGG + Intronic
1182702818 22:32254246-32254268 GTGTCTGGGTGCACTTGCTGGGG - Intronic
1183369861 22:37426471-37426493 GTGTGTGTGTGGACATGGGGTGG - Intronic
1184453632 22:44597182-44597204 GGGTGTGCGTGCTCGGGCAGGGG + Intergenic
1185038923 22:48494532-48494554 CTGTGTTGGTGCAGATGCAGGGG + Intronic
1185193826 22:49455732-49455754 CTGTGTGCGTTCACATGGGGTGG + Intronic
1203228569 22_KI270731v1_random:91868-91890 GTGTGTGTGTGCACGTGCACTGG + Intergenic
949776040 3:7633531-7633553 GGGTGTGTGTGGACAAGCAGGGG + Intronic
950495893 3:13334427-13334449 GTGTGTGCATGTGCAGGCAGGGG + Intronic
950759450 3:15207219-15207241 GTGTGTGCAGTTACATGCAGTGG + Intronic
951387612 3:22061753-22061775 GTGTGTGTGTACAGAGGCAGTGG - Intronic
951694632 3:25433501-25433523 GTGTGTGCGTGGACAGGGTGGGG + Intronic
954144111 3:48625866-48625888 TTGTGTGTGTGTACATGGAGGGG + Exonic
954424222 3:50434874-50434896 CTGTGTGTGTGCCCATGCATGGG - Intronic
954462149 3:50633462-50633484 GTGGGTGAGTGCATATGTAGGGG - Intronic
954796409 3:53163411-53163433 ATGTGGGTGTGCACATGGAGAGG + Intronic
954799647 3:53179844-53179866 GTGTGTGCGTGCACACACGCGGG + Intronic
956712029 3:72047554-72047576 GTGTGTGTGTGTATGTGCAGTGG - Intergenic
957183299 3:76909319-76909341 GTCTGCGAGTGCACATGCAGAGG - Intronic
957539126 3:81546189-81546211 GTGTGTGTGTGCATGTACAGTGG - Intronic
957878854 3:86184043-86184065 GTGTGTGTGTGCACCAGCAGAGG - Intergenic
958606552 3:96364960-96364982 GTGTGTGCAGGCACTAGCAGTGG - Intergenic
958620456 3:96551761-96551783 GTGTGTGTGTGTACATGCATGGG - Intergenic
959111401 3:102127186-102127208 GTGTATGCATGCACATCCATAGG - Intronic
959309088 3:104708573-104708595 GTGTGTGCGTGCATATGTGGAGG - Intergenic
959341573 3:105138195-105138217 ATGGATGCCTGCACATGCAGTGG + Intergenic
959623469 3:108423780-108423802 GTGTGTGTGTGCATCTGCACAGG - Intronic
961793737 3:129394588-129394610 GTGTGTGTGTGTATGTGCAGGGG - Intergenic
961867734 3:129966172-129966194 GTATGTGTATGCACATGCATGGG - Intergenic
962304899 3:134277495-134277517 GTGTGTGCATGCACACGCACAGG + Intergenic
962410096 3:135133381-135133403 GTGTGTGAGTGGACAAACAGAGG + Intronic
963069099 3:141287765-141287787 GTGTGTGTGTGCATAAGCACAGG - Intronic
963346393 3:144100079-144100101 GTGTGTGGGTGAACAAGCACAGG - Intergenic
963753478 3:149207899-149207921 GTGTGTGTGTGTAAATACAGAGG + Intronic
963922699 3:150921388-150921410 GTGTGTGCGTGCACATGCAGGGG - Intronic
964008836 3:151865109-151865131 GTGTGTGTGTGCACGCGCATTGG + Intergenic
964733780 3:159894952-159894974 GTATGTGCGTGCATGTGCATAGG + Intronic
964824253 3:160808315-160808337 GTGTGTGCGTGCATGTGTGGTGG + Intronic
965350318 3:167603896-167603918 GTGTGTGTGTGTGCATGCACTGG + Intronic
965350319 3:167603902-167603924 GTGTGTGCATGCACTGGTAGTGG + Intronic
966161277 3:176971299-176971321 GTGTGTGCATGCACGTGCTTCGG + Intergenic
967361530 3:188636783-188636805 GTGTCAGCGTGCCCCTGCAGGGG - Intronic
969719650 4:8886395-8886417 GTGTGGGTGTGGAGATGCAGGGG - Intergenic
970579950 4:17466017-17466039 GTGTGTGCCTGTGCATGCATGGG - Intronic
970671477 4:18401533-18401555 GAAAGTGCCTGCACATGCAGTGG + Intergenic
971587054 4:28417164-28417186 GTGTGTGTGTGCACACATAGAGG + Intergenic
972156104 4:36164204-36164226 ATGTGTGTGTGTACATACAGTGG + Intronic
973263668 4:48188894-48188916 GTGTGTGCGCGCATATGCATGGG - Intronic
973287229 4:48432096-48432118 GTGTGTGTGCCCACATGCAAGGG - Intergenic
973698262 4:53512506-53512528 GTGTGTGTGTGTGCATGCAGAGG + Intronic
974200564 4:58634131-58634153 GTGTGTGTGTGTACTTTCAGTGG - Intergenic
974394135 4:61313469-61313491 CTTTGTGTGTGCCCATGCAGGGG + Intronic
975573950 4:75844593-75844615 GTTTGTGCGTGTATGTGCAGTGG + Intergenic
975636070 4:76449993-76450015 GTGTGTGTGAGCACAGGGAGGGG + Intronic
977845233 4:101759878-101759900 GTGTGCACACGCACATGCAGGGG + Intronic
979475609 4:121154022-121154044 GTGTGCGTGTGTGCATGCAGGGG - Intronic
979774679 4:124574890-124574912 GTGTGTGTGTGCATGTGGAGAGG - Intergenic
980091322 4:128445964-128445986 GAGTGCGCATGCACATGCACGGG + Intergenic
980925441 4:139132434-139132456 GTGTGTGCATGCACATGTGGTGG - Intronic
981809026 4:148752213-148752235 GTGTGTGTGTTCACATGCATGGG + Intergenic
981829476 4:148983914-148983936 GTGTGTGTGTGCACATGTGTAGG + Intergenic
983747621 4:171221240-171221262 GTGTGTGTGTGCACGTACATGGG + Intergenic
984432704 4:179668558-179668580 GTGTGTGCGTGTGCATGTAAAGG + Intergenic
985068878 4:186149024-186149046 GTGTGTGTGCGCTCATGCACAGG + Intronic
985369717 4:189273113-189273135 GTGTGTGTGTGCACATGGTGTGG - Intergenic
985399991 4:189584738-189584760 GTGTGCGCAGGCACATGAAGGGG - Intergenic
985426536 4:189836811-189836833 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985426545 4:189836915-189836937 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985426582 4:189837266-189837288 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985426591 4:189837370-189837392 GTGTGTGTGTGCTAGTGCAGTGG - Intergenic
985674235 5:1222072-1222094 GTGTGTGCATGTACATGCATGGG + Exonic
985702397 5:1381502-1381524 GTGTGTGGGTGTCCATGTAGGGG - Intergenic
985843414 5:2326538-2326560 GTGTGTGTGTGTATGTGCAGTGG + Intergenic
985895918 5:2750077-2750099 CTGTGTGCGCGCACGTGCAAGGG - Intronic
986309868 5:6543970-6543992 GTGTGTGTGTAAACATGGAGTGG - Intergenic
986349948 5:6867951-6867973 GTGCGTGTGTGCACATGTATGGG + Intergenic
987159966 5:15132203-15132225 GTGTGTGTTTGCACCAGCAGTGG + Intergenic
987613505 5:20241407-20241429 GTGTATGTGTGCACATGCTTGGG + Intronic
990944648 5:61237191-61237213 GTGTGTGTGTGCAGAGGCTGGGG + Intergenic
990978257 5:61578069-61578091 GTGTGTGCATACACATGTTGGGG - Intergenic
991030276 5:62075180-62075202 GTGTGTGTGTGTGTATGCAGAGG + Intergenic
991568814 5:68033380-68033402 GTGTGTGCGTGCCCCTGTGGGGG - Intergenic
992029523 5:72708002-72708024 GGGTGTGTGCCCACATGCAGAGG - Intergenic
992915081 5:81441546-81441568 GTGTGTGTGTGTGGATGCAGTGG + Intronic
992965618 5:81997017-81997039 GTGTGTGTGTGCACCAGCACTGG - Intronic
993358649 5:86946093-86946115 GTGTGTGCATGCATATGAAGTGG - Intergenic
993638860 5:90378495-90378517 CTGTGTGTGTGCCCATGCATGGG + Intergenic
993740922 5:91538695-91538717 GTGTGTGTGTGTGCATGCACGGG - Intergenic
994424431 5:99566217-99566239 ATGTGTGTGTGCACATGCTCAGG - Intergenic
994596176 5:101838759-101838781 GTGTGTTTGTGCACGCGCAGAGG - Intergenic
994758568 5:103825173-103825195 GTGTGTGTGCACACATGCATGGG - Intergenic
994890179 5:105623395-105623417 ATGTTTACCTGCACATGCAGTGG + Intergenic
996537009 5:124587993-124588015 GTGTGTGTGTGTGCATGCTGGGG - Intergenic
996994911 5:129684218-129684240 TTGTGTGTGTCCACATGAAGAGG - Exonic
997031012 5:130128248-130128270 GTGTGTGCGCTCACATGCTCAGG + Intronic
999153753 5:149443577-149443599 GTGTGTGCGAGCATATGGAGGGG - Intergenic
1000262923 5:159606121-159606143 ATGTTTGTGTGCACATGCATGGG + Intergenic
1000723148 5:164733746-164733768 GTGTGTGTGTGTACATTTAGCGG - Intergenic
1001220766 5:169898504-169898526 GTGTGTGTGTGTGCATGTAGAGG - Intronic
1002376668 5:178794074-178794096 GTGTGTGTGTGCATATGTATGGG - Intergenic
1002604073 5:180371612-180371634 GTGTGTGTGTGCGCACGCAAAGG + Intergenic
1003035487 6:2637533-2637555 GTGTGTGTGTGCGCGTGCGGGGG + Intergenic
1003124320 6:3343450-3343472 GTGTGTGTGTGTATTTGCAGGGG - Intronic
1003427530 6:6007555-6007577 GTGTGTGTGTGCTCGTGCGGGGG - Intronic
1003497666 6:6678546-6678568 GTGTATGCGTGTACATGTGGTGG - Intergenic
1004130546 6:12915141-12915163 GTGTGTGTGTGGACATCCAAAGG - Intronic
1004135596 6:12962973-12962995 GTGTGTGCATGCATGTGCTGAGG - Intronic
1004770806 6:18779093-18779115 GTGTGTGCATGCACGTGTATTGG + Intergenic
1004849214 6:19679527-19679549 GTGTGTGCGCGCGCATGTGGTGG + Intergenic
1005091327 6:22059914-22059936 GTGTGTGTATGCACATGCATGGG + Intergenic
1005273799 6:24195054-24195076 GTTTGTGTGTGCACATACAGGGG - Intronic
1006134875 6:31889155-31889177 GTGTGTGCGTGCACACACTCTGG + Intronic
1007409869 6:41655258-41655280 GTGTGTGCGTGGAGATGGAGTGG - Intergenic
1008265509 6:49420557-49420579 GTGTGTGTGTGCAGATGATGTGG - Intergenic
1008300724 6:49835961-49835983 GTAGGTGCGTGCACATCCATGGG - Intronic
1008367556 6:50699936-50699958 GTGTGTGTGTGCATATGGTGGGG + Intergenic
1008709931 6:54212557-54212579 CTGTGTGTGTGCACATGCATGGG + Intronic
1009747632 6:67839288-67839310 GTGTGTGGGTGCACACACAGTGG - Intergenic
1009924972 6:70109572-70109594 GTGTGTGTGTGTATCTGCAGCGG + Intronic
1010021370 6:71163462-71163484 GTGTGTGAGCACACATGCAGAGG + Intergenic
1010051315 6:71507502-71507524 GTGTGTGTGTGCGCACGCATGGG - Intergenic
1011901980 6:92309923-92309945 ATGTGTGTGTGTGCATGCAGTGG + Intergenic
1012413173 6:98983432-98983454 GTGTGAGGGTGCCCAGGCAGGGG + Intergenic
1012989529 6:105911136-105911158 GTGTGTGTTTGCACGTGCACTGG - Intergenic
1013297030 6:108766834-108766856 CTGTGTGCAGGCATATGCAGAGG - Intergenic
1013374109 6:109497315-109497337 GTGTGTGTGTGAACAAGCACTGG - Intronic
1013772800 6:113646225-113646247 GTGTGTGGGTGAACATACATGGG + Intergenic
1015218292 6:130775560-130775582 ATGGATGCCTGCACATGCAGTGG - Intergenic
1016247574 6:142002206-142002228 TTTTGTGTGTGCACATGCATGGG + Intergenic
1016361362 6:143270940-143270962 ATGTGTGTGTGCATATGCACAGG + Intronic
1016672292 6:146722873-146722895 GTGTGTGCGTGTGTATGCAAGGG - Intronic
1017221361 6:151969469-151969491 GTGTGTGTGCACACATGCAAGGG + Intronic
1017562083 6:155639006-155639028 GTGTGTGTGTGCACGCACAGTGG - Intergenic
1017973983 6:159338224-159338246 GTGTGTGCAGGCACCTGCTGTGG - Intergenic
1018046843 6:159972771-159972793 CTGTGTCCGTGCACGTGGAGGGG + Intronic
1019149685 6:169996973-169996995 GTGTGTGTGTGTACACACAGTGG + Intergenic
1019264750 7:108398-108420 GTGTGTGTGTGCACATGCTTGGG - Intergenic
1019356681 7:583743-583765 GGGTGCGAGTGCACATGCATGGG - Intronic
1020936362 7:14469643-14469665 CTGTGTGTGTTCTCATGCAGGGG - Intronic
1021811533 7:24406437-24406459 GTGTGGGCGTGTACAGGAAGGGG - Intergenic
1022151412 7:27611481-27611503 GTGTGCGCGCACACACGCAGTGG - Intronic
1022297527 7:29069822-29069844 GTGTGTGCATGTAAATGCATAGG + Intronic
1022344381 7:29500150-29500172 GTGTGTGCGCACACATGCGTAGG - Intronic
1022510239 7:30930662-30930684 GTGTGTGTGTGCACGTGCATAGG + Intergenic
1023032915 7:36106763-36106785 GTGTGTGTGCGCACATGTAAGGG - Intergenic
1023354945 7:39357229-39357251 GTGTTTGCCTGCTCTTGCAGTGG - Intronic
1024780332 7:52840470-52840492 TTGTGTGTGTGCACATGTATAGG - Intergenic
1024918832 7:54535428-54535450 GTGCATGCATGCACATGCACAGG - Intergenic
1026230273 7:68476891-68476913 GTGTGTGTGTGTACACACAGGGG + Intergenic
1026572017 7:71539489-71539511 GTGTGTGCGTGCACGTGTACAGG + Intronic
1027759167 7:82255933-82255955 GTGTGTACTTGCACAGGCACAGG - Intronic
1029653997 7:101912391-101912413 GTCTGTGTGTCCACCTGCAGGGG - Intronic
1029711859 7:102304131-102304153 GTGGGTGGGTGCAGAGGCAGTGG - Intronic
1030331519 7:108276623-108276645 GTGTGTCTGTGCACATGAGGTGG + Intronic
1031011291 7:116526793-116526815 GTGTGTGTGTGCGCGTGTAGGGG - Intronic
1032013411 7:128360970-128360992 GTGTGCGCGCGCGCGTGCAGGGG - Intronic
1032389039 7:131543923-131543945 GTGTGTGGCTGCATATGCAGAGG - Intronic
1032496296 7:132365359-132365381 GTGCGTGCGCGCGCATGCATGGG + Intronic
1032567477 7:132961584-132961606 TTGTGTGCGAGCACACGCACAGG - Intronic
1032758135 7:134911392-134911414 CTGTGTGTGTGCACATGCTTTGG + Intronic
1033385780 7:140873740-140873762 CTGTGTGCATGAACATGCAGAGG - Intronic
1033724346 7:144097018-144097040 GTGCGTGTGTGCGCATGCATGGG - Intergenic
1033725734 7:144115839-144115861 GTGTGTGCGCGCACACGCATGGG - Intergenic
1033732339 7:144192220-144192242 GTGTGTGTGTGTACACACAGTGG - Intronic
1033750711 7:144358793-144358815 GTGTGTGTGTACACACACAGTGG + Intronic
1034526850 7:151669819-151669841 GTGTGTGCCTGCAGGTGCACAGG - Intronic
1034927017 7:155130606-155130628 GTGTGTGAGTGCTCACGCATGGG - Intergenic
1034927019 7:155130652-155130674 GTATGTGAGTGCTCATGCACAGG - Intergenic
1034927020 7:155130694-155130716 ATGTGTGCGTGCTCATGCATGGG - Intergenic
1034927025 7:155130776-155130798 ACGTGTGCGTGCTCATGCACGGG - Intergenic
1036772221 8:11587161-11587183 GTGTGTGCGCACACACGCATGGG - Intergenic
1037367174 8:18135444-18135466 GTGTGTGTGTGCTCATGGACTGG - Intergenic
1039200561 8:35088367-35088389 GTGTGTGTGTGTGCATGCTGAGG - Intergenic
1039312403 8:36331542-36331564 GTGTGTGTGTGTGCATGCATAGG + Intergenic
1039466477 8:37788589-37788611 GTGCGTGCATGCACATGTTGGGG - Intronic
1039567523 8:38561892-38561914 GTGTGCGTGTATACATGCAGAGG - Intergenic
1039736116 8:40334890-40334912 GTGTGTGTGTGCATATGTATGGG + Intergenic
1040759846 8:50826910-50826932 GTGTGTGCGTGCACACACATAGG + Intergenic
1040876385 8:52156755-52156777 GTGTGTGTGTGTGCATGCACTGG + Intronic
1042206670 8:66336404-66336426 GTGTGTGCATGCACGTGCCTTGG - Intergenic
1043257317 8:78152089-78152111 GTGTGTGTGTGCATATGCATAGG - Intergenic
1045287780 8:100806878-100806900 GTGTGTGCGCGCGCACGCACAGG + Intergenic
1045652146 8:104351294-104351316 GTGTGTGTATGCACATGTATGGG + Intronic
1045710320 8:104975561-104975583 GTGTGCGCATGCACGTGCAGGGG - Intronic
1047168242 8:122464321-122464343 GTGTGTGCGTGCACACACAGAGG - Intergenic
1047309046 8:123676857-123676879 GTGTGTGTGCACACATGCACAGG + Intergenic
1047330152 8:123879708-123879730 GTGTGTGTATGCGCATGCACAGG - Intronic
1047468447 8:125143083-125143105 GTGTGTGCGTGCACCCACACTGG - Intronic
1047761458 8:127957792-127957814 GTGTGTGTGTGCATGTTCAGGGG - Intergenic
1048393708 8:133992490-133992512 TTGGGTGACTGCACATGCAGGGG + Intergenic
1048544427 8:135373233-135373255 GTGTGTGTGTGCACTTGCATAGG - Intergenic
1048720583 8:137319853-137319875 GTGTGTGTGTGTACATGCAAAGG + Intergenic
1049197453 8:141323572-141323594 GTGTGTGTGTGCCTGTGCAGTGG - Intergenic
1049220989 8:141428704-141428726 GTGTGAGCGTGCACATCCCATGG - Intronic
1049339083 8:142102324-142102346 GTGTGTGGGTGCACAGGCCTGGG + Intergenic
1049531866 8:143159145-143159167 GTGTGTGCACGCACGTGCATGGG - Intronic
1049623093 8:143607403-143607425 GTGAGTGCGTGCATGTGCATGGG - Intronic
1050771851 9:9211500-9211522 GTGTGTGCGTGCGCACACTGGGG - Intronic
1051956878 9:22706162-22706184 ATGTGTGTGTGCACATACGGGGG + Intergenic
1053748537 9:41229849-41229871 GTGCATGTGTGCACATGGAGTGG + Intergenic
1054785600 9:69207113-69207135 GTGTGTACGCACGCATGCAGTGG - Intronic
1055253090 9:74332184-74332206 GTGTGTGTGTGCATATGTATAGG + Intergenic
1055618814 9:78101685-78101707 GTGTGTGTGAGGAAATGCAGGGG + Intergenic
1055956989 9:81783314-81783336 GTGTGTGTGTGGACGTGGAGGGG + Intergenic
1056782705 9:89563267-89563289 GTGTGCGCGTGCACGTGCATAGG - Intergenic
1057835423 9:98440770-98440792 GCCTGTGTGTGCTCATGCAGAGG - Intronic
1058454568 9:105127172-105127194 GTGTGTGTGTGCATGTGCAGGGG - Intergenic
1059276968 9:113105907-113105929 GTATGTGCGTACACAAACAGAGG + Intergenic
1059279283 9:113118644-113118666 GTATGTGCGTACACAAACAGAGG - Intergenic
1060274975 9:122175569-122175591 GTGTGTGTGTGTGCATGCATTGG - Intronic
1060428422 9:123526160-123526182 GTGTGTGTGTGCACATGTGCAGG - Intronic
1060826854 9:126692637-126692659 GTGTGTGCGTGCATACGCTGTGG + Intronic
1061201794 9:129142344-129142366 GTGTGTGTGTGTGCATGCATGGG + Intronic
1061935293 9:133854113-133854135 GTGTGTGTGTGCAGGTGCAAGGG - Intronic
1062010150 9:134262500-134262522 GTGTGAGCGTGCACATGTTGGGG - Intergenic
1062010163 9:134262644-134262666 GTGTGAGCGTGCACATGTTGGGG - Intergenic
1062325560 9:136010925-136010947 GTGTGTGCGTGTGTGTGCAGGGG - Exonic
1203445506 Un_GL000219v1:50913-50935 GTGTGCGTGTGCACATGGTGTGG - Intergenic
1203445540 Un_GL000219v1:51194-51216 GTGTGTGTGTGCACATGGTGTGG - Intergenic
1186486739 X:9939392-9939414 GCGTGTGCGTGTCCAGGCAGGGG + Intronic
1187341346 X:18424888-18424910 GTGTGTGTGTGCACACGCAGCGG + Intergenic
1188095865 X:26020644-26020666 GTGTGTGCGCGCGCGTGCATGGG - Intergenic
1188363319 X:29283646-29283668 GTGTGTATGTGCACAGGGAGAGG + Intronic
1189197054 X:39161790-39161812 GTGTCTGCGTGCACACGCTGAGG + Intergenic
1189761354 X:44324559-44324581 GTGTGTGTGTGTGTATGCAGGGG - Intronic
1189798441 X:44669341-44669363 GTGTGTGTGTGCACATGCAGTGG + Intergenic
1189926432 X:45959915-45959937 GGGTGTGCTTGCACTGGCAGTGG - Intergenic
1189989463 X:46580498-46580520 ATGTGTGTGTGCACATGGATAGG + Intronic
1190106293 X:47563201-47563223 GTGTGTATGTGCAGATGTAGGGG - Intronic
1190180352 X:48186441-48186463 GTGTGTTTGTGTAAATGCAGAGG + Exonic
1190189709 X:48267246-48267268 GTGTGTGTGTGTAAATGCAGAGG - Exonic
1190193357 X:48295632-48295654 GTGTGTGTGTGTAAATGCAGAGG + Intergenic
1190199325 X:48346621-48346643 GTGTGTGTGTGTAAATGCAGAGG + Exonic
1190212366 X:48458887-48458909 CTGTGCGCATGCACATGGAGGGG - Exonic
1190666093 X:52697104-52697126 GCGTGTGTGTGTAAATGCAGAGG + Exonic
1190673325 X:52761306-52761328 GCGTGTGTGTGTAAATGCAGAGG - Exonic
1191733107 X:64358834-64358856 GTGTGTGTGTGTGCATGCACGGG - Intronic
1191794784 X:65009705-65009727 GTGTATGGATGCACATGCAGTGG - Intronic
1191957949 X:66666791-66666813 GTGTGTGTGTGCATGTGTAGGGG + Intergenic
1192195848 X:69027666-69027688 GTATGTGTGTGTACATGCACAGG + Intergenic
1192438296 X:71156010-71156032 ATGTGTGTGTGTACATGCGGAGG - Intronic
1192483913 X:71508756-71508778 GTGTGTGCGCGCATATGCATAGG + Intronic
1193601776 X:83515355-83515377 GTGTCTGTGTGCAAGTGCAGGGG - Intergenic
1193651410 X:84138831-84138853 GTGTGTGTGTGTACATTCTGAGG + Intronic
1193928088 X:87515910-87515932 GTGTGTGTGTGTACATATAGAGG - Intergenic
1195922580 X:109998333-109998355 GTGTGTGCGTGCACGTGCTTGGG + Intergenic
1196176494 X:112644471-112644493 GTGTGTGTGTACACATTAAGAGG + Intronic
1196318115 X:114253797-114253819 GTGTGTGTGTGCCTATGCAGGGG - Intergenic
1197431525 X:126372642-126372664 GTGTGTGTGTACACACACAGTGG + Intergenic
1198438274 X:136637865-136637887 GTTTCTGTGTGCACATGTAGAGG + Intergenic
1198753392 X:139958006-139958028 GTGTGTGTGTGTACATATAGCGG - Intronic
1199506164 X:148563493-148563515 GTGTGTGTGTGTGCATGCTGGGG + Intronic
1199571767 X:149273651-149273673 CTGTGTGCGTGCAAATGGTGTGG + Intergenic
1200097945 X:153672878-153672900 GTGTGTGTGTGAATATGTAGGGG - Intronic
1200685383 Y:6254283-6254305 GTGTTTGTGTGCACATGCTCAGG + Intergenic
1200687766 Y:6272891-6272913 GTGTTTGTGTGCACATGCTCAGG + Intergenic
1201006724 Y:9515613-9515635 GTGTTTGTGTGCACATGCTCAGG + Intergenic
1201009376 Y:9535919-9535941 GTGTTTGTGTGCACATGCTCAGG + Intergenic
1201011968 Y:9556589-9556611 GTGTGTGTATGCACATGCACAGG + Intergenic
1201047503 Y:9901811-9901833 GTGTTTGTGTGCACATGCTCAGG - Intergenic
1201062552 Y:10059937-10059959 GTGTTTGTGTGCACATGCTCAGG - Intergenic
1201765676 Y:17571588-17571610 GTGTGCGTGTGCACGTGCATAGG - Intergenic
1201835876 Y:18334401-18334423 GTGTGCGTGTGCACGTGCATAGG + Intergenic