ID: 963924818

View in Genome Browser
Species Human (GRCh38)
Location 3:150939943-150939965
Sequence GACATGAGCCAGTGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 504}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963924818 Original CRISPR GACATGAGCCAGTGAGGAGA GGG (reversed) Intronic
900943835 1:5818221-5818243 GACATGAGCAGGGCAGGAGATGG + Intergenic
901183867 1:7359646-7359668 GACATGAGGCAGTCTGCAGATGG + Intronic
901473114 1:9471340-9471362 AAAAGTAGCCAGTGAGGAGATGG + Intergenic
902183530 1:14708070-14708092 AAGCCGAGCCAGTGAGGAGAAGG - Intronic
902707968 1:18219472-18219494 CAGGTGGGCCAGTGAGGAGATGG + Intronic
902726606 1:18340277-18340299 AAGATGAGCAAGTGAAGAGATGG + Intronic
902753240 1:18532041-18532063 GACTTGAGACACAGAGGAGAAGG + Intergenic
903238500 1:21966680-21966702 GAAGTGAGACAGGGAGGAGAGGG - Intergenic
903379328 1:22885894-22885916 GGCATCTGCCAGTGGGGAGATGG + Intronic
904678732 1:32214517-32214539 GAAATGAGCCAGTGAGCATGGGG + Intronic
905006256 1:34712557-34712579 GACATGAGCAGGAGAGGAGGAGG + Intergenic
905845453 1:41227481-41227503 GATATAAGCCAGTGACAAGAGGG + Intronic
905893522 1:41531326-41531348 GACATGAGACATAGAGGACAGGG + Intronic
906140055 1:43528975-43528997 GACAGTAGCCAGTGAGGAGAGGG + Intronic
906866419 1:49425715-49425737 GTCATGAGGCAGAGATGAGAGGG - Intronic
907495642 1:54842431-54842453 GACATGAAACAGTGAGGGAAGGG - Intergenic
907667362 1:56445092-56445114 GACATGAGCCAGGAAGGTGATGG - Intergenic
907857559 1:58318688-58318710 GATGTGAGGCAGTGAGGAGGTGG - Intronic
907890118 1:58628979-58629001 GATCTGAGTCAGTGTGGAGAAGG + Intergenic
908881802 1:68741271-68741293 AAAATGAGCCAATGAGGAGAAGG + Intergenic
909122582 1:71622791-71622813 AACATGATCCAGTGAGGAACTGG - Intronic
909138088 1:71827561-71827583 AACATGAGACACTGAGGAAAGGG - Intronic
910452435 1:87360765-87360787 GACAGGAATCAGGGAGGAGATGG + Intergenic
910686818 1:89926074-89926096 GACATGAGGTGGTGGGGAGAGGG - Intronic
911317092 1:96368997-96369019 AACATGAGCCGGGCAGGAGAGGG + Intergenic
911947738 1:104134514-104134536 GACATGAGCAGGGCAGGAGAGGG + Intergenic
912401641 1:109398050-109398072 GACGCGAGCCAATGAGGAGTGGG - Intergenic
912718163 1:111997069-111997091 GAGAGGAGCCAGTGGGGTGAGGG - Intergenic
913316882 1:117561257-117561279 GTCATGAGCAAGTGGGGAGGAGG - Intergenic
913467751 1:119159582-119159604 AACATTAGACAGTGAGGAAATGG - Intergenic
915812327 1:158926787-158926809 TAGATGAGCTAGTGGGGAGACGG - Intergenic
915840957 1:159212510-159212532 GACAAGAGCAAGTGAAGGGAAGG + Intergenic
916004492 1:160646941-160646963 TCCATCAGCCAATGAGGAGAAGG + Exonic
916430248 1:164721038-164721060 TACTTGAACCAGTGAGAAGATGG + Intronic
916581539 1:166113789-166113811 GAGATGGGCCAGTGTGCAGATGG + Intronic
917060531 1:171032913-171032935 GACCTGAGCCCCTAAGGAGAGGG - Intronic
917864141 1:179177143-179177165 GAGATGAGCAAGTGAGGAGCAGG + Intronic
918525163 1:185456781-185456803 GAGCTGAGCCAGGGAGGTGAGGG - Intergenic
918868067 1:189929642-189929664 TACATGAGCTGGTGAGGAGGTGG + Intergenic
919130925 1:193449444-193449466 CACTTGAGCCAGTGGGGAGTGGG + Intergenic
920071039 1:203303616-203303638 GACATGAGCCACGGAGCAGCAGG + Intergenic
920191874 1:204198994-204199016 GACAAGAGCCCATGAGGAGAGGG - Intronic
920547352 1:206829496-206829518 GAGATGAGCCTGTGAGGTGTGGG + Intronic
920732564 1:208501468-208501490 GACAGCAGCCAGTGAGGAGGAGG + Intergenic
920832005 1:209473943-209473965 GACATGAGCAGGGCAGGAGAGGG + Intergenic
921179326 1:212619301-212619323 GCCAAGGGCCAGTGAGGAGGGGG - Intronic
921302231 1:213762290-213762312 GAAATGAGGCAGAGGGGAGAGGG - Intergenic
921406636 1:214787441-214787463 GACATGAGCCAGTTACTAAAGGG - Intergenic
922351134 1:224735411-224735433 GAGATGAGCCAAAGAGGAGCAGG - Intronic
922474755 1:225899247-225899269 GACATGATGCAGGGAGGAGGAGG - Intronic
922898389 1:229118031-229118053 GAAATGAGCAAGTGGGGAAATGG + Intergenic
922962125 1:229656719-229656741 GAGATGTGTCAGTCAGGAGAAGG + Intronic
1062986728 10:1776124-1776146 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1063045482 10:2387904-2387926 GACATAAGCTTGTGTGGAGAAGG + Intergenic
1063201725 10:3790786-3790808 GAAGTGTGCCGGTGAGGAGATGG + Intergenic
1064091299 10:12387943-12387965 GTCATGAGTGAGTGAGCAGATGG + Intronic
1064309705 10:14201362-14201384 GTCAGGATCCAGTCAGGAGATGG - Intronic
1065497482 10:26344424-26344446 GAGATGAGACACTGAGGACATGG + Intergenic
1065644954 10:27824418-27824440 TACATGAGACAGAGAGCAGATGG - Intronic
1066512720 10:36119604-36119626 GACATGAACCAGCGAGAAGTTGG - Intergenic
1067145747 10:43692546-43692568 GAGATGGGGCAGTGGGGAGAGGG - Intergenic
1067243854 10:44519527-44519549 GGCATGAGCAAATGAGTAGAAGG + Intergenic
1067530291 10:47066228-47066250 GACATGGGCACGGGAGGAGAAGG - Intergenic
1068518895 10:58057504-58057526 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1068869310 10:61926690-61926712 CACCTGAACCAGGGAGGAGAAGG - Intronic
1069131499 10:64709501-64709523 CACAAAAGCCAGTCAGGAGAAGG - Intergenic
1069528950 10:69200908-69200930 AACTTCATCCAGTGAGGAGAAGG + Intronic
1069574215 10:69515456-69515478 GAAATGAGCCTCAGAGGAGATGG - Intergenic
1070263307 10:74878870-74878892 GAGATGAGCAAGTGAGCACAAGG - Intronic
1070277122 10:75017991-75018013 CTCATGAGTCAGAGAGGAGAGGG + Intronic
1072352976 10:94576195-94576217 CACATGAGCCTGGGAGGTGAAGG - Intronic
1073562544 10:104509175-104509197 GAAATGAGCCAGAGAGTTGAGGG - Intergenic
1073849529 10:107598857-107598879 GACATGAGCAGGGAAGGAGAGGG + Intergenic
1076429795 10:130393739-130393761 GACATGAGCAGGGAAGGAGAGGG + Intergenic
1076549760 10:131270903-131270925 GACTTCAGCCAGTGTGGGGAGGG - Intronic
1077679797 11:4228021-4228043 GACATGAACCAGGCAGGAGAGGG - Intergenic
1077681689 11:4247887-4247909 GAGATGAACCAGGCAGGAGAGGG + Intergenic
1077689211 11:4324596-4324618 GACATGAACCAGGCAGGAGAGGG - Intergenic
1077786059 11:5384565-5384587 GACATGATCCAGGGAGGGGCTGG - Intronic
1078962647 11:16296417-16296439 GACATGAGCAGCTGAGCAGAAGG + Intronic
1079034273 11:17008754-17008776 GTCATGAGGCAATGAGGAGATGG - Intronic
1079405974 11:20146049-20146071 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1081630151 11:44683994-44684016 GCCAAGAGCCAGAGAGGGGAAGG - Intergenic
1081802807 11:45871344-45871366 GGCATGTCCCAGTGAGGAGCTGG + Intronic
1082187604 11:49203800-49203822 GACAGGAGCAAGTCAGGAGGGGG + Intronic
1082879549 11:58024671-58024693 GAGGTCAGCCAGAGAGGAGAGGG - Intronic
1083644450 11:64164562-64164584 GACTTTAGCCCGTGAGCAGATGG - Intronic
1083760976 11:64817547-64817569 GACAAGATCCAGTGGGAAGAGGG + Intergenic
1083858346 11:65404964-65404986 AACAGGAGCCAGTGAGGAGCTGG - Exonic
1083936486 11:65872497-65872519 GACCTGGGCCTGTGAGGAGTCGG - Intronic
1084375438 11:68773644-68773666 GACATGAGCAGGCCAGGAGAGGG + Intronic
1084380995 11:68812666-68812688 GACAGCAGGCAGTGAGAAGAGGG + Intronic
1085254916 11:75166981-75167003 GACATGACCCAGTGGGGCGCAGG + Intronic
1085302738 11:75467871-75467893 CTCAGGAGACAGTGAGGAGAAGG - Intronic
1085446697 11:76605489-76605511 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1085518146 11:77123129-77123151 CACATCAGCCTGAGAGGAGAAGG - Intronic
1085804289 11:79620315-79620337 GCCATGAGCAAGAGAGGTGAAGG + Intergenic
1086390137 11:86355412-86355434 GGCATGAGCAGGTCAGGAGAGGG + Intergenic
1087041043 11:93800259-93800281 GAGAAGAGCCAGTGGGGACAAGG - Intronic
1087986705 11:104691157-104691179 CACATGAGCCTGAGAGGTGAAGG + Intergenic
1088538080 11:110883695-110883717 GCCAGGAGTCTGTGAGGAGAAGG + Intergenic
1088879915 11:113965045-113965067 GAGATGAGACAATGAGGAGAGGG - Intergenic
1089146343 11:116331995-116332017 TACATGAGACAAGGAGGAGATGG - Intergenic
1089150159 11:116358065-116358087 GAAATGAGCCAGAGGGGAGGCGG - Intergenic
1089485621 11:118843737-118843759 GACATGGGGCTGTGATGAGAAGG - Intergenic
1089981285 11:122774775-122774797 TAAATGAGCCAGTGTAGAGAAGG - Intronic
1090900139 11:131023226-131023248 GACAAGTGCTAGTGAGGAGATGG + Intergenic
1091039363 11:132262281-132262303 AACCTGAGGCAGTGGGGAGAAGG - Intronic
1091877882 12:3951753-3951775 GACAGGATGCAGTGAAGAGAGGG - Intergenic
1092910167 12:13139522-13139544 GATATGAGCAGGTGAGGAGAAGG - Intronic
1093531059 12:20164466-20164488 GAGAGGAGTCAGAGAGGAGAGGG - Intergenic
1095531768 12:43195538-43195560 TACATGAGCGAGTGAGGAAATGG + Intergenic
1095595063 12:43949723-43949745 GACATGAGCAGGGCAGGAGAGGG - Intronic
1096548945 12:52359713-52359735 GACTTGAGCCAGGCAGGAGAGGG + Intergenic
1096974024 12:55688323-55688345 GACATGGGGCATTTAGGAGAAGG - Intronic
1098517309 12:71392180-71392202 GACCTGAGCCAGAGAGGTCAAGG + Intronic
1098554910 12:71807681-71807703 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1100364037 12:93902885-93902907 GACATGAGCATGGCAGGAGAGGG - Intergenic
1100399545 12:94217003-94217025 GAGAGGAGCCAGTGAGGTGAAGG - Intronic
1100748946 12:97675647-97675669 GGCATGAGCCAGGGAGGTGGAGG + Intergenic
1102869571 12:116402958-116402980 CCCATGTGCCAGTGAGCAGAAGG - Intergenic
1103930310 12:124446625-124446647 GACATTAGCCAGAGAGGTCAGGG - Intronic
1104073580 12:125369963-125369985 CACTTGAACCAGTGAGGAGGAGG + Intronic
1105695179 13:22881472-22881494 GACATGAGCAGGGCAGGAGAAGG + Intergenic
1105977976 13:25490181-25490203 GGCATGAGCCAGAGAGCAGGAGG - Intronic
1106013140 13:25844048-25844070 GACCTGAGCCACTGAGGCCATGG + Intronic
1106105733 13:26731967-26731989 GAAATGAGCCAGTGAGAGGAAGG - Intergenic
1106197992 13:27510353-27510375 GACAGGAGCCAGAGAGCAGTTGG - Intergenic
1106627577 13:31436293-31436315 GGCATGAGCAAGACAGGAGAGGG + Intergenic
1106644503 13:31617725-31617747 AACTTGAGCCAGTGAGAACAGGG + Intergenic
1106884917 13:34174487-34174509 GAAATGAACCAGTGAAGAAAAGG - Intergenic
1107327404 13:39259527-39259549 AGCATGAGGCAGTGAGGAGGGGG + Intergenic
1107790373 13:43995889-43995911 GACATGAGCAGATCAGGAGAGGG - Intergenic
1108507645 13:51127081-51127103 TACTTGAGCCAGGGAGGACAAGG + Intergenic
1109193868 13:59356909-59356931 GACATCAGCCAGCGAGGAACTGG + Intergenic
1110584366 13:77171105-77171127 GACAAGTGCCTCTGAGGAGATGG + Intronic
1112020583 13:95367804-95367826 GGCATGAGCCAGGCAGGAGAGGG - Intergenic
1112307366 13:98287311-98287333 GGCATGAACCCGGGAGGAGAAGG - Intronic
1112347342 13:98601282-98601304 GACTTGAGCCACTGGGAAGATGG - Intergenic
1112442529 13:99434631-99434653 GACATCAGCCAGGAAGGAGCAGG - Intergenic
1113535812 13:111065564-111065586 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1113608372 13:111626380-111626402 GACATGAGTCACCCAGGAGATGG - Intronic
1113850774 13:113416489-113416511 GACATGAGTAAGTCAGCAGAGGG + Intergenic
1115284670 14:31703994-31704016 GGCATGAGCAAGGCAGGAGAGGG - Intronic
1116489900 14:45493025-45493047 GACATCAGCCAGAGAGGCTAAGG - Intergenic
1116618102 14:47163937-47163959 TCCACGAGCCAGTGAGGACATGG - Intronic
1116708501 14:48334959-48334981 GGCATGAGCAGGGGAGGAGAGGG + Intergenic
1117282678 14:54256074-54256096 GGCATGAGCAAGGCAGGAGAGGG + Intergenic
1117991121 14:61435042-61435064 GCCATCAGCCAGTGAGGAATGGG + Intronic
1118816521 14:69318037-69318059 GCCCTGAGCCAGTGAAGTGAAGG - Intronic
1119298332 14:73551295-73551317 GACATGAGCAGGGAAGGAGAGGG + Intronic
1119573795 14:75700174-75700196 GACATGAGCCGGGCATGAGAGGG + Intronic
1119633304 14:76253069-76253091 GACATGGGCCAGGGAGGCAATGG - Intronic
1119829181 14:77685682-77685704 GGCAGGAGCCTGGGAGGAGAAGG + Intronic
1121078667 14:91090129-91090151 GTGCTCAGCCAGTGAGGAGAGGG - Intronic
1121257784 14:92543950-92543972 GACATGGGACAGAGTGGAGAAGG - Intronic
1121259406 14:92555324-92555346 GACTTGAGTCTGTGAGGAAATGG - Intronic
1121413659 14:93764187-93764209 GAGATGAGCCAGAGGGGTGAGGG - Intronic
1122144513 14:99681578-99681600 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1122235748 14:100329871-100329893 GGCAGGAGCCAGGGAGGAGTGGG + Exonic
1123011280 14:105350690-105350712 GCCACCAGCCAGTGAGGCGAAGG - Intronic
1123937007 15:25198900-25198922 GCCATGCGCCACTGTGGAGATGG - Intergenic
1124184856 15:27515622-27515644 GCCATGAGAAAGAGAGGAGATGG + Intronic
1124713152 15:32031194-32031216 GAAATGAGACACTCAGGAGAGGG - Intronic
1124821558 15:33051415-33051437 GACATGAGCAGGGCAGGAGAGGG + Intronic
1125041073 15:35188033-35188055 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1125486730 15:40116319-40116341 GACGTGGGCCAGCGAGAAGAAGG + Intergenic
1125768778 15:42151642-42151664 GACATGACCAAGTGTGGGGAGGG + Intronic
1125993901 15:44137448-44137470 GAATTGAGTCAGTGGGGAGAGGG - Intronic
1126262312 15:46708079-46708101 GAAATAAGGCAATGAGGAGAGGG - Intergenic
1127805891 15:62520007-62520029 GACAAGAGACAGTGAGGACCAGG + Intronic
1127873358 15:63091239-63091261 GTCATCTGCCAGTGAGGAGCTGG - Intergenic
1130327034 15:82889492-82889514 GACAAGAGCCCATAAGGAGAAGG + Intronic
1130871869 15:87978183-87978205 AACTTGATCCACTGAGGAGAGGG - Intronic
1131795251 15:96009843-96009865 GACAAGAGGCAGAGAGGTGAAGG - Intergenic
1132654361 16:1035739-1035761 GACAGAAGCCAGTGAGGAGGCGG + Intergenic
1134606848 16:15578074-15578096 GCCATGAGCAAGAAAGGAGAGGG - Intronic
1135058295 16:19249368-19249390 AACTTGAGCCAGGGAGGGGATGG + Intronic
1135528642 16:23233495-23233517 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1135975799 16:27108392-27108414 GAGATGTGCCAGTGGGCAGAGGG + Intergenic
1136115328 16:28090963-28090985 GACATGACCCAGGAAGGGGAAGG + Intergenic
1136135742 16:28255916-28255938 GACAAGAGACAGGGAGGGGAGGG - Intergenic
1137002140 16:35238411-35238433 GAGATGAGGGAGTGGGGAGATGG + Intergenic
1137730196 16:50683963-50683985 GACACAACCCAGGGAGGAGAGGG - Intergenic
1137802654 16:51275473-51275495 CCCATGAGCAGGTGAGGAGATGG + Intergenic
1137832588 16:51558134-51558156 GACATCAGGCAGTGAGAAGGAGG + Intergenic
1137942979 16:52707141-52707163 GACATAATCTAGTGTGGAGAGGG - Intergenic
1138326631 16:56177259-56177281 TACATGAGCCAGGGAGGTCAAGG - Intergenic
1138802801 16:60055229-60055251 GACAAGAGAGAGAGAGGAGAGGG - Intergenic
1138988673 16:62363035-62363057 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1139072883 16:63404293-63404315 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1139206587 16:65034923-65034945 GACTTGAGGAAATGAGGAGATGG - Intronic
1139312934 16:66042414-66042436 GACAGAAGGCAGGGAGGAGAGGG - Intergenic
1139361190 16:66401215-66401237 GGGATGAGCCAGGGAGGAGGAGG + Intronic
1140536164 16:75711851-75711873 GGCATGAGCCAGGCAGGAGAGGG + Intronic
1140860321 16:79012512-79012534 GACAAGAGCCACTGCGCAGACGG + Intronic
1141234337 16:82201392-82201414 AGCATGAGGAAGTGAGGAGAAGG + Intergenic
1141576922 16:84970037-84970059 GGCATGAGCCACTGTGCAGAAGG + Intergenic
1142471169 17:164123-164145 GCCAGGAGCCAGTAAGGTGAGGG - Exonic
1142862330 17:2770296-2770318 GACAGGAGAGAGTGAGGAGGTGG - Intergenic
1143141472 17:4743977-4743999 GCCATGAGCCTGGCAGGAGAGGG - Exonic
1143331816 17:6142794-6142816 CACATGAGCCAGTGAAGAAGCGG + Intergenic
1143488919 17:7272312-7272334 GGCATGAGCCCGGGAGGAGGAGG + Intergenic
1143614259 17:8039973-8039995 GAGATGTACCAGTGAGGAGGGGG + Exonic
1143694288 17:8599945-8599967 GCCATCAGCCAGGGAGTAGAGGG + Intronic
1144171514 17:12663983-12664005 GACATGAACATGGGAGGAGAGGG - Intergenic
1144181870 17:12759679-12759701 GAGATGAGCCAGAGAGGAGGGGG + Intronic
1144408026 17:14971808-14971830 GACATGAGCAGGGTAGGAGAGGG - Intergenic
1144655308 17:17031266-17031288 GGCATGAGGAAGTGAGGAGTGGG + Intergenic
1146489927 17:33273577-33273599 GCCAGGACCCAGTGAGGAGAAGG + Intronic
1146953033 17:36919881-36919903 GACAATAGCCAGAGAGGACAAGG - Intergenic
1149305472 17:55342829-55342851 GAGCTTAGACAGTGAGGAGAGGG + Intergenic
1151414618 17:73953040-73953062 GACAGGAGCCTGGGTGGAGAGGG - Intergenic
1151618216 17:75228653-75228675 GACTTGAGCCAGTGAGCTGTTGG + Intronic
1152111125 17:78358349-78358371 GCCATGTGCCACGGAGGAGAGGG + Exonic
1152314797 17:79573878-79573900 GTCCTGAGCCAGGGAGGAGAAGG - Intergenic
1152854168 17:82654433-82654455 GCCCTGAGCCACTGTGGAGAGGG - Intergenic
1203162361 17_GL000205v2_random:63562-63584 GACAAAAGCCACTGAGGGGAAGG - Intergenic
1153348851 18:4057082-4057104 GACATGAGCAGGGCAGGAGAGGG + Intronic
1153719745 18:7889758-7889780 GAGACGAGCCAGTGAGGGGCAGG + Intronic
1155917791 18:31573070-31573092 GAAATGAAGCAGGGAGGAGAAGG - Intergenic
1156684068 18:39623093-39623115 GACATGAGCATGGCAGGAGAGGG + Intergenic
1156829176 18:41469763-41469785 GACATGAGAAGGAGAGGAGAAGG + Intergenic
1156972470 18:43172815-43172837 GACATAAGGCAGGCAGGAGAGGG + Intergenic
1158577098 18:58647350-58647372 CACTTGAGCCAGTGAAGTGAAGG - Intergenic
1158612651 18:58956391-58956413 GAGATGAGTGGGTGAGGAGAGGG + Intronic
1158812981 18:61059036-61059058 GGCATGAGCAGGTCAGGAGAGGG - Intergenic
1158901653 18:61967621-61967643 GGCATGAGCCGGTTAGGAGACGG + Intergenic
1160243703 18:77140792-77140814 GACGTGAGACACTGATGAGACGG - Intergenic
1160266247 18:77342610-77342632 GACATGCGTCTGTGAGGACATGG + Intergenic
1160452817 18:78977584-78977606 AAAATGACCCAGTGAGGAGTTGG + Intergenic
1160493339 18:79355859-79355881 GAAAGCAGCCAGTGAGGAGACGG + Intronic
1161128666 19:2574847-2574869 GACAAGAGCGGGAGAGGAGATGG - Intronic
1161524192 19:4743253-4743275 AACAAGAGACAGAGAGGAGAGGG + Intergenic
1162156479 19:8681480-8681502 GAGATGAGTCAGTGAGGAAGTGG + Intergenic
1163169033 19:15517952-15517974 GAGGTGAGCAAGTGAGGAGGAGG + Intronic
1163375349 19:16927016-16927038 GGCCTGAGTCAGGGAGGAGAGGG - Intronic
1164249419 19:23464248-23464270 GACATGGCCCAGGCAGGAGAGGG - Intergenic
1164912112 19:32021280-32021302 CACATGTGCCAGGGAGGAGGTGG - Intergenic
1165848017 19:38831457-38831479 CAGAGGAGCCAGTGAGGCGAAGG + Exonic
1166015095 19:39973818-39973840 GCTATGAGGAAGTGAGGAGAGGG + Intronic
1166053827 19:40276937-40276959 CACTTGAGCCAGTGAGGTCAAGG + Intronic
1168375218 19:55871455-55871477 GAGATGAGCCAGAAAGGAGATGG + Intronic
925223356 2:2160815-2160837 GACATAAAGCAGGGAGGAGAAGG + Intronic
925329227 2:3045237-3045259 GTCATTGGCCAGTGAGGACATGG - Intergenic
925553048 2:5096752-5096774 GACATGAGCAAGGCAGGAGGGGG - Intergenic
925652017 2:6100804-6100826 GACATGAACCTGTGAGGCGGTGG + Intergenic
926651650 2:15352971-15352993 GACATGAGCAAGACGGGAGAGGG - Intronic
926768637 2:16348415-16348437 CACTTGAGCCAGGGAGGCGAAGG - Intergenic
929014045 2:37476293-37476315 GAAATGAAGCAGTCAGGAGAAGG + Intergenic
929910512 2:46085599-46085621 GACCTGAGTCAGGGAGGAGGAGG - Intronic
929998814 2:46847286-46847308 GACCTGAGCCAGTGTGCAGACGG - Intronic
930319385 2:49835268-49835290 GACTTGAGCAATTGAGGAAATGG - Intergenic
930771644 2:55135974-55135996 GATATGAGCAAGGCAGGAGAGGG + Intergenic
930887372 2:56341416-56341438 AACATGAGCAAGGCAGGAGAGGG - Intronic
931006950 2:57861099-57861121 GAATTGAGTAAGTGAGGAGAAGG - Intergenic
933068545 2:77830877-77830899 GACATGTGCAAGGCAGGAGAGGG + Intergenic
933234979 2:79854816-79854838 GAAATGGGGCAGTGAAGAGAGGG - Intronic
933367681 2:81374823-81374845 GGCATGAGCCAGGCAGGAGAGGG + Intergenic
933533344 2:83538453-83538475 GAGATGAGCAAGGAAGGAGAAGG - Intergenic
933577790 2:84089650-84089672 GACCTGAGCCAGGGAGGAGATGG - Intergenic
934039699 2:88117552-88117574 GACATGAGCAGGGCAGGAGAGGG - Intergenic
934613328 2:95756360-95756382 GACATGGGCTTGTGAGGGGAGGG + Intergenic
934621759 2:95814498-95814520 GAAGTGAGTCAGAGAGGAGATGG - Intergenic
934850899 2:97700580-97700602 GAGATGAGACACTGAGGATACGG - Intergenic
935261519 2:101359647-101359669 GACATGAGCAGGCCAGGAGAGGG - Intronic
935292109 2:101619725-101619747 GACATGAGCAGGGCAGGAGAGGG - Intergenic
936035118 2:109104992-109105014 GACATGAGCAGGGCAGGAGAGGG + Intergenic
936167867 2:110139681-110139703 GACATGAGACAGTGGAGACAAGG - Intronic
937169558 2:119851890-119851912 GGCATAAGCCAGGCAGGAGAGGG - Intronic
937705200 2:124912415-124912437 TGAATGAGCCAGCGAGGAGATGG + Intronic
937739166 2:125329121-125329143 AACTTCAGCCAGTGTGGAGATGG + Intergenic
938941521 2:136173553-136173575 GACATGGGCCAGTGCGCTGAGGG + Intergenic
939936761 2:148302034-148302056 GACACGAGCAAGGCAGGAGAGGG - Intronic
940178102 2:150901710-150901732 AAAATGAGACTGTGAGGAGATGG + Intergenic
940721512 2:157287622-157287644 GACATGGGTCAGAGAAGAGAGGG - Intronic
940766599 2:157796468-157796490 CACTTGAGCCTGGGAGGAGAAGG + Intronic
943496869 2:188631199-188631221 GACATGAGCAGGGCAGGAGATGG + Intergenic
943499877 2:188674443-188674465 GACATGAGCAGGGCAGGAGATGG + Intergenic
943734047 2:191334339-191334361 TACATGAGCCCATCAGGAGATGG - Intronic
944046089 2:195413723-195413745 GACATCAGCCAGGGAGGCTAAGG + Intergenic
945391978 2:209275720-209275742 GACATGAGCCAGGTGGGAGAGGG + Intergenic
945608121 2:211962460-211962482 AAAATGAGTCAGGGAGGAGAGGG + Intronic
945663824 2:212717769-212717791 GACAGGTGCAAGTGAGGAGAAGG - Intergenic
945775264 2:214099587-214099609 TACATGAGACAGTGAGGAAAGGG + Intronic
947282379 2:228469720-228469742 GACATGAGCAGGGCAGGAGAAGG - Intergenic
948016416 2:234694478-234694500 GACTTGAGCCACTGAGCAGAAGG + Intergenic
948034538 2:234847450-234847472 GACATCAGGCAATGAGGAGAGGG + Intergenic
948046534 2:234950530-234950552 GAAAGGAGGCAGTGAGGCGAAGG - Intergenic
948585344 2:239015620-239015642 GCCATGAGCCAGAGAGCAAAGGG - Intergenic
948952427 2:241262868-241262890 GATATGAACCAGTTTGGAGAAGG - Exonic
1169110935 20:3033285-3033307 GACATGAGCAACTGGGCAGAAGG - Intronic
1169552439 20:6714863-6714885 GACAGTAGACAGTGTGGAGAAGG + Intergenic
1169763507 20:9123142-9123164 GACATGTTGGAGTGAGGAGAAGG + Intronic
1169799271 20:9498356-9498378 CACTTGAGCCTGTGAGGTGAAGG + Intergenic
1170778466 20:19401930-19401952 GAAATGAGACAGTGAAGTGAAGG - Intronic
1170791226 20:19511138-19511160 GAGATGAGGCAGGGAGGGGAAGG - Intronic
1170891208 20:20377399-20377421 CACTTGAGCCAGGGAGGCGAAGG - Intergenic
1171899104 20:30840373-30840395 GCCATGACCCAGTGGGGAGACGG - Intergenic
1172656678 20:36542123-36542145 GAGATGACCCAGAGAGGGGAAGG - Intronic
1173185548 20:40837199-40837221 GCCAGGAGCCAGTGGGGAGAAGG - Intergenic
1173200302 20:40949810-40949832 GAAGTGAGACAGGGAGGAGAAGG - Intergenic
1173724562 20:45288428-45288450 GACATGTGCTGGAGAGGAGAGGG - Intergenic
1173751828 20:45482414-45482436 GACATGAGCAGGACAGGAGAGGG + Intergenic
1173833428 20:46108647-46108669 GAACTGAGACAGAGAGGAGAAGG + Intergenic
1175220084 20:57411805-57411827 GACGTGAGGCAGTGAAGAGAAGG - Intergenic
1175630396 20:60530633-60530655 GAAATGAGACAGTGAGAAGGTGG - Intergenic
1176291319 21:5046455-5046477 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1178123016 21:29488669-29488691 GGCATGAGCAAGGCAGGAGAGGG + Intronic
1179010032 21:37549360-37549382 GACATGAGCGGGGCAGGAGAGGG - Intergenic
1179438663 21:41378866-41378888 GAGGGGAGCCAGGGAGGAGAAGG - Intronic
1179623296 21:42632791-42632813 GGCATGAGCCAGTGAGGTCATGG + Intergenic
1179865936 21:44217186-44217208 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1181440002 22:22930844-22930866 GACAGGAGCCAGGGAGGGGCTGG + Intergenic
1181515494 22:23409207-23409229 GTCAGGATCCAGAGAGGAGAGGG - Intergenic
1181980882 22:26765396-26765418 GGCAGAGGCCAGTGAGGAGATGG + Intergenic
1182705033 22:32271640-32271662 GCCAGGAGCCAGTGAGGTGAGGG - Intergenic
1183251080 22:36730905-36730927 GACATGACACAGGGAGGAGGAGG - Intergenic
1183439941 22:37817508-37817530 GACATCTTCCAGTGGGGAGAAGG - Intergenic
1183700841 22:39450124-39450146 AGCAGGAGACAGTGAGGAGACGG + Intergenic
1184919165 22:47593536-47593558 GGCAAGAGCCAGAGAGGGGAGGG - Intergenic
1185170776 22:49292600-49292622 TACATGAGACTGTGAGGACAAGG - Intergenic
949658996 3:6255676-6255698 GACATGAGCCCCTGAGAAAAAGG - Intergenic
950457823 3:13103126-13103148 GACATGGGCCAGGGAGGGGCTGG - Intergenic
950628147 3:14263571-14263593 GACATGAGCAGGGCAGGAGAGGG - Intergenic
950835948 3:15919104-15919126 GGCATGAGCCAGGCAGGAGCGGG - Intergenic
951692177 3:25408002-25408024 GAAATGAGACAGTAAAGAGATGG - Intronic
951885689 3:27521853-27521875 GCCAAGAGCCAGTGAGAAGCTGG + Intergenic
952188860 3:31000811-31000833 GGCCTGGGCCAGAGAGGAGATGG - Intergenic
952227780 3:31396528-31396550 GAGATGAGCCAGTGCTCAGATGG - Intergenic
952332964 3:32381710-32381732 GACATTGGCCAGTGAGGGAATGG - Intergenic
953194467 3:40719631-40719653 GACATGAGCAGGGCAGGAGAGGG + Intergenic
953225307 3:41013508-41013530 GAAATGAGGCAGGGAGGGGAAGG + Intergenic
953293625 3:41690900-41690922 GACATGAGCAGGGCAGGAGAGGG + Intronic
953437422 3:42889540-42889562 GACATGTGCCACTGTGGAGGAGG + Intronic
953790008 3:45940170-45940192 GACATGAGCAGGGCAGGAGAGGG + Intronic
953876522 3:46669866-46669888 GACTTCAGCCTGTGAGGGGAGGG - Exonic
953971763 3:47353872-47353894 CACTTGAGCCAGGGAGGAGGAGG - Intergenic
954933674 3:54307052-54307074 GAAATGAGCCAGTCTGGAGTCGG - Intronic
955029421 3:55201923-55201945 GGCATGCACCAGTGAGGAGCCGG - Intergenic
956368432 3:68531827-68531849 GACATGAGCAGGGCAGGAGAGGG - Intronic
956704245 3:71985685-71985707 GAAATGAGACAGGGAAGAGAAGG - Intergenic
957287463 3:78235029-78235051 GACATGAGCAGGGCAGGAGAGGG - Intergenic
957428873 3:80076110-80076132 GACATGATCAAGGTAGGAGAGGG + Intergenic
957738218 3:84228658-84228680 GACATGAGCAGGGCAGGAGAGGG - Intergenic
959194800 3:103166613-103166635 GACATGAGCAGGGCAGGAGAGGG + Intergenic
959749097 3:109812073-109812095 GACATGAGACAGATGGGAGAGGG + Intergenic
961353295 3:126317266-126317288 GACATGAGCAGGGCAGGAGAGGG + Intergenic
961357094 3:126346108-126346130 GCCCTGTGCCAGTGAGGAAATGG + Intronic
961480926 3:127180224-127180246 GACATGAGCAGGGAAGGAGAGGG + Intergenic
961748627 3:129082142-129082164 GACATGTGCCAGGAAGCAGAGGG + Intergenic
962396466 3:135018970-135018992 GGCATGAGGCAGAGAGGACAGGG + Intronic
963346606 3:144102470-144102492 GATATTACCCAGTGAGGACATGG - Intergenic
963924818 3:150939943-150939965 GACATGAGCCAGTGAGGAGAGGG - Intronic
967037897 3:185661870-185661892 GTCAAGACCCAGGGAGGAGATGG + Intronic
967461897 3:189757703-189757725 GACATGAGCAGGACAGGAGAGGG + Intronic
967994144 3:195154098-195154120 GACATGAGCAGGGCAGGAGAGGG + Intronic
968922861 4:3531722-3531744 GAAATGAGGAGGTGAGGAGATGG - Intronic
968930419 4:3575921-3575943 GACATGAGCCAGTGGGCACCGGG - Intergenic
969225595 4:5796095-5796117 GACATGAACAACTCAGGAGATGG - Intronic
969293709 4:6256738-6256760 GACATGAGCAGGGCAGGAGAAGG - Intergenic
969971849 4:11055921-11055943 GGTCTGAGACAGTGAGGAGAAGG - Intergenic
970471146 4:16380483-16380505 GACATGAGCAAGGCAGGCGAGGG - Intergenic
971150130 4:24022585-24022607 GCAATGAGCCAGGGAGGTGAAGG + Intergenic
971330102 4:25674922-25674944 CATAGGAGGCAGTGAGGAGATGG - Intronic
972411708 4:38801825-38801847 GACATGAGCAGGACAGGAGAGGG + Intronic
972987076 4:44777777-44777799 GACATGAGCAGGGAAGGAGAGGG + Intergenic
974326623 4:60422783-60422805 GACATGAGCAGGGCAGGAGAAGG + Intergenic
974857204 4:67475366-67475388 GCCAACAGCCAGTGAGGAAATGG + Intronic
975725777 4:77290472-77290494 GTCCTCAGCCAGTGAGGAGCAGG - Intronic
976616547 4:87083844-87083866 CACATGAGCCAGGGAGGTGGAGG - Intronic
976749560 4:88440522-88440544 TAGATGAGCTAGTGAGGAGGTGG + Intronic
977722629 4:100257843-100257865 CACATGAGTCAGTGAGGCAAGGG - Intergenic
978489266 4:109294253-109294275 GAAAGGAGCCATTGAGGAAATGG - Intronic
978524035 4:109646334-109646356 GACTTCAGCAAGTGCGGAGATGG - Intronic
979694978 4:123602943-123602965 GACATGAGCAGGTCAGGAGAGGG + Intergenic
980581893 4:134765423-134765445 GAAATAATCCAGTAAGGAGAAGG - Intergenic
980869373 4:138593602-138593624 GCCATCAGGCAGTGAGGAGCTGG - Intergenic
981419661 4:144534654-144534676 TAGATGAGCTGGTGAGGAGATGG - Intergenic
982793633 4:159620681-159620703 TAAATGAGCTAGTGGGGAGAGGG + Intergenic
983184228 4:164682598-164682620 GGCATGAGCGAGATAGGAGAAGG - Intergenic
983263004 4:165476703-165476725 GACATGAGCAGGGCAGGAGAGGG - Intronic
984436492 4:179717110-179717132 GACATGAGCAGGGCAGGAGAAGG + Intergenic
984456644 4:179977537-179977559 GAGAAGAGAAAGTGAGGAGAGGG - Intergenic
984707084 4:182855498-182855520 GACAGGGGCCAGTCAGGAGCAGG + Intergenic
985504152 5:269166-269188 AACAGGAGCCAGTGATGGGAGGG + Intergenic
985514183 5:330958-330980 GGCATGAACCCGGGAGGAGACGG - Intronic
986044536 5:4024569-4024591 GACAAGGGGCAGAGAGGAGATGG - Intergenic
986496205 5:8344386-8344408 GACATGGACCTGTGAGGATAGGG - Intergenic
987386833 5:17338103-17338125 GACAGCAGCCAGTGAGGAACTGG - Intergenic
987487991 5:18544189-18544211 GACATGAGCAGGACAGGAGAGGG + Intergenic
988179083 5:27766522-27766544 GGCATGAGCCGGGCAGGAGAGGG + Intergenic
988882138 5:35515329-35515351 GACATGAGCAAGGCAAGAGAGGG + Intergenic
989055264 5:37360399-37360421 TACTTGAACCAGGGAGGAGAAGG + Intronic
989130129 5:38099160-38099182 GACAAGACCCAGAGAGGTGAAGG + Intergenic
989139562 5:38189388-38189410 CACAAGAACCTGTGAGGAGAGGG - Intergenic
989409432 5:41101267-41101289 ACCATGAACCAGTGAGGAGGAGG + Intergenic
989411351 5:41122850-41122872 GATATGAGCCGGTCAGGATAGGG - Intergenic
989634094 5:43516126-43516148 GGCATGAGCAAGGCAGGAGAGGG + Intergenic
990213203 5:53502668-53502690 GACATGAGCAGGGCAGGAGAGGG - Intergenic
990450768 5:55929868-55929890 GCAATGAGCCTGTGAGGTGAAGG - Intergenic
993273046 5:85819320-85819342 GGCATGAGCGAGGCAGGAGAGGG - Intergenic
995330983 5:110945716-110945738 GACATGAGCAGGGCAGGAGAGGG + Intergenic
995477177 5:112560114-112560136 GACATGAGCAGGACAGGAGAGGG - Intergenic
995496401 5:112748918-112748940 GACTTGAGCCAGGGAGGTCAAGG + Intronic
995508560 5:112885176-112885198 GAGAGGAGCCAGCCAGGAGATGG + Intronic
995966290 5:117911395-117911417 GACATGAGCAGGTCAGGAGAGGG + Intergenic
996735082 5:126750880-126750902 GGCAGGAGCCAGACAGGAGAGGG - Intergenic
996853982 5:127983873-127983895 CACATGAGCCAGGGAGGTCAAGG + Intergenic
996906840 5:128610488-128610510 GACATGAGCAGGGCAGGAGAGGG - Intronic
997368647 5:133342007-133342029 TGCCAGAGCCAGTGAGGAGATGG - Intronic
997889980 5:137667407-137667429 GACATTAATCAGTGAGGAAATGG - Intronic
999148126 5:149409162-149409184 CACAAGAGCCAGTGAGGAAGGGG + Intergenic
999233977 5:150079495-150079517 GCCAAGAGGCAGGGAGGAGATGG - Intronic
1000766646 5:165299739-165299761 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1001706770 5:173746860-173746882 GACTTGAGCCTGGGAGGAGGAGG + Intergenic
1001914365 5:175547246-175547268 GACATGAGCAGGAGAGGAGAGGG - Intergenic
1002414919 5:179115204-179115226 GAGATGGGCCAGGGAGAAGATGG - Intronic
1002465214 5:179404971-179404993 GAGATGAGCCAGTGACAGGAGGG - Intergenic
1003073609 6:2963844-2963866 CAGATGAGCCCCTGAGGAGAGGG - Intronic
1003157477 6:3608650-3608672 GACATGGGCCAGAGAAAAGAAGG + Intergenic
1003168485 6:3701713-3701735 GGCATGAGCAAGGCAGGAGAGGG + Intergenic
1003193464 6:3894097-3894119 GAGATGAGCTAGTCAGGAGCAGG + Intergenic
1003950621 6:11112173-11112195 GACATGAGCAGGGCAGGAGAGGG - Intronic
1004307640 6:14515506-14515528 GACATGTGCAAGTGAGGGCAGGG - Intergenic
1004362979 6:14987329-14987351 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1004426115 6:15508194-15508216 GACAAAAGACAGTGAGCAGAAGG - Intronic
1005345919 6:24890490-24890512 GACTTGGGACAGTGGGGAGAGGG + Intronic
1005762468 6:28980045-28980067 CAGATGAGCTAGTGGGGAGATGG - Intergenic
1005886119 6:30098987-30099009 CACTTGAGCCAGTGAGGTGGAGG + Intergenic
1006544940 6:34772776-34772798 TAAATGAGCCAGGGAGGGGAGGG - Intronic
1008100669 6:47387549-47387571 CACTTGAGCCAGGGAGGACAAGG - Intergenic
1010106012 6:72168866-72168888 GACATGAGCAGGGCAGGAGAGGG - Intronic
1011176559 6:84567669-84567691 GCCAAGAGCCAGTGAGGAATTGG - Intergenic
1011325169 6:86142712-86142734 GCCATGAGCCAAGGAGGAGGGGG + Intergenic
1012152581 6:95773169-95773191 GACATGATCCAGTGAGAAGAAGG - Intergenic
1013988461 6:116225091-116225113 CAAATGAGCAAGTGAGTAGATGG + Intronic
1014057107 6:117028771-117028793 GACATAAGGCAGGGTGGAGAAGG + Intergenic
1014524970 6:122491491-122491513 GGCATGAGCGGGGGAGGAGAGGG - Intronic
1015513260 6:134060291-134060313 GACAGGAGCGGGTGGGGAGATGG - Intergenic
1016126586 6:140411487-140411509 GTCATGAGCAAGGCAGGAGAGGG + Intergenic
1016999973 6:149989893-149989915 TAAATGGGCCAGTGAGGAGGGGG - Intergenic
1017129290 6:151094171-151094193 AACAGGAGTCAGTGGGGAGAAGG - Intronic
1017408721 6:154147254-154147276 AACATGAGCGAGAGAAGAGATGG - Intronic
1017426847 6:154330924-154330946 GACATGAGCAGGGCAGGAGAGGG + Intronic
1017726895 6:157282558-157282580 GAGATGAGGCAGAGAGGAGCAGG - Intergenic
1018455940 6:163952187-163952209 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1018863546 6:167730768-167730790 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1019099520 6:169617457-169617479 CACTTGAACCAGGGAGGAGAAGG - Intronic
1019449186 7:1088049-1088071 GAGAGGAGCCAGAGAGGAGCGGG + Intronic
1019497448 7:1347066-1347088 GACATGAACCAGGGAGAAGAGGG - Intergenic
1021932840 7:25598775-25598797 GACATAAGCAACTGAGGAAAAGG - Intergenic
1022527162 7:31045586-31045608 TACATGAGCCCGTTAGAAGAGGG + Intergenic
1023438072 7:40158997-40159019 CACTTGAGCCAGTGAGGTCAAGG - Intronic
1023739779 7:43269026-43269048 GACATGAGAGAGTGGGTAGAGGG - Intronic
1024251218 7:47507110-47507132 GACAGAAGGCAGTGAGGACATGG + Intronic
1024465581 7:49708955-49708977 GACATTAGCCAGGGAGAAGTGGG + Intergenic
1026075718 7:67165844-67165866 CACTTGAGCCAGGGAGGTGAAGG + Intronic
1026701139 7:72646453-72646475 CACTTGAGCCAGGGAGGTGAAGG - Intronic
1028892334 7:96002194-96002216 GAGAGGAGCCAGTCAGGTGATGG - Intronic
1028896499 7:96047655-96047677 GACATGAGGCAGTGAACATAAGG + Intronic
1030730816 7:112986326-112986348 AGCATGGGGCAGTGAGGAGAGGG + Intergenic
1031539515 7:122976757-122976779 GACATGAGCAAGGCAGGAGAGGG + Intergenic
1031631432 7:124048229-124048251 GGCATGACCCAGACAGGAGAGGG + Intergenic
1032204660 7:129851668-129851690 GACATGAGCCAGCCAGGGTATGG - Intronic
1034635383 7:152563344-152563366 GACTTGAGCCCGTGAGGTGGAGG - Intergenic
1034719923 7:153282186-153282208 GGGAGGAGCCAGTGAGGAGTAGG - Intergenic
1035412406 7:158655698-158655720 GTCATGAGGCAGGGAGGGGACGG - Intronic
1035464987 7:159069112-159069134 GCCAGGAGCCTGTGGGGAGATGG - Intronic
1035870468 8:3131992-3132014 GACATGAGCCAGTGGAGTGATGG - Intronic
1036044475 8:5123849-5123871 GACATGAGTAAGGCAGGAGAGGG - Intergenic
1036398616 8:8388248-8388270 CACATGAGCCAGGGAGGTGGAGG + Intergenic
1037152499 8:15655067-15655089 GACATGAGCAGGGCAGGAGAGGG + Intronic
1037434606 8:18849400-18849422 GATATGAGCGACTGAAGAGAAGG - Intronic
1037487094 8:19357903-19357925 GATGTGAGCCTGTGAAGAGAAGG + Intronic
1037886433 8:22598746-22598768 GACAAGAGCCAGGAAGGAAATGG - Intronic
1038481270 8:27903289-27903311 GATATGAGCAACTGAAGAGAAGG + Intronic
1038959593 8:32504298-32504320 GACATGAGCAGGGCAGGAGAGGG - Intronic
1040412533 8:47168920-47168942 GACCTGAGCCAGGGAGGTCAAGG + Intergenic
1041178304 8:55221033-55221055 CATATAAGCCAATGAGGAGATGG - Intronic
1041431060 8:57781045-57781067 GACAAGGGCCAGTGAGGACATGG + Intergenic
1041458682 8:58087598-58087620 CCGATGAGCCAATGAGGAGATGG - Intronic
1041565160 8:59268850-59268872 GGAAAGAGCCAGTGAGTAGAAGG - Intergenic
1042396383 8:68295990-68296012 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1042397376 8:68307834-68307856 GACATGAGCAGGACAGGAGAGGG - Intronic
1042758066 8:72240078-72240100 GACGTGGTCCAGTGAGGGGATGG - Intergenic
1043091141 8:75906213-75906235 GACATGAGCGGGACAGGAGAGGG + Intergenic
1043870827 8:85429859-85429881 GACAAGAACCAGTGGGGAAATGG - Intronic
1044217491 8:89629193-89629215 CACTTGAGCCAGGGAGGCGAAGG + Intergenic
1044243035 8:89908925-89908947 GACATGAGCCCGGGAGGTGGAGG + Intronic
1044700785 8:94963778-94963800 GGCAAGAGCCAGAGAGCAGAGGG + Intronic
1045504312 8:102767751-102767773 GACATGAGCCACTGAGGGCAGGG - Intergenic
1046805254 8:118473070-118473092 GAGGTGAGGCAGTGGGGAGAAGG + Intronic
1047614748 8:126555325-126555347 GGGATGGGCCAGTGAGGGGATGG + Exonic
1047719132 8:127622500-127622522 CACTTGAGCCTGGGAGGAGAAGG + Intergenic
1048431869 8:134378115-134378137 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1048535390 8:135289679-135289701 GACTTCAGCCAGTGAGAAGGAGG - Intergenic
1048540163 8:135334986-135335008 GCCGTGGGCCAGTGTGGAGAAGG + Intergenic
1049703453 8:144025139-144025161 GAAATGATCCTGAGAGGAGAGGG - Intronic
1049774021 8:144396463-144396485 ACCAAGAGCCAGTGAGGGGAGGG + Exonic
1049820573 8:144630748-144630770 GAGAGGTGCCAGTGAGGAGCTGG + Intergenic
1051388615 9:16539442-16539464 GACTTGAGCCAGGGAGGTGGAGG + Intronic
1051510152 9:17868532-17868554 GACATGAGCTGGAGAGGAGAAGG - Intergenic
1052199684 9:25763632-25763654 GGCATGACCCAGGGAGAAGAAGG + Intergenic
1052463525 9:28798961-28798983 GACAGGAGGCAGTGGTGAGAAGG + Intergenic
1052517679 9:29503861-29503883 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1052664043 9:31471782-31471804 GATATGAGCAGGGGAGGAGAGGG + Intergenic
1052669540 9:31538545-31538567 GGCATGAGCCAGGCAGAAGAGGG + Intergenic
1052854697 9:33399957-33399979 GGCTTGAGCAACTGAGGAGAAGG + Intronic
1052966129 9:34341916-34341938 GCCATGAGCCTGTGAGCAGGAGG + Intronic
1055464156 9:76547223-76547245 GACATGAGCTGGGCAGGAGAGGG - Intergenic
1055734597 9:79313377-79313399 AAAATGAGACAGTCAGGAGATGG - Intergenic
1056219342 9:84435856-84435878 GGCATGAACAAGAGAGGAGATGG - Intergenic
1056423581 9:86454105-86454127 CACATGAGCCTGGGAGGAGGAGG - Intergenic
1057333594 9:94139267-94139289 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1059119453 9:111628786-111628808 GACATGATCCAATGTGGAGATGG + Intergenic
1059260185 9:112968344-112968366 AACATGAGCCAGTAAGTAGTTGG - Intergenic
1059562787 9:115351372-115351394 GGCATGAGTGAGTGAGGCGAGGG + Intronic
1060142598 9:121223315-121223337 GACATGAGCAGGGCAGGAGAGGG - Intronic
1060475911 9:123986454-123986476 GACATGAGACAGTGTGGAGAAGG - Intergenic
1060901525 9:127262105-127262127 GGCAGCAGCCAGTGAGGAAATGG - Intronic
1061709978 9:132480746-132480768 GCCAGGCGCCGGTGAGGAGAGGG + Intronic
1062627574 9:137450164-137450186 GACATGATTCAGTGAGAAGCCGG - Exonic
1062687886 9:137825305-137825327 GGCAGGTGCCCGTGAGGAGAGGG - Intronic
1185916560 X:4041946-4041968 GACAAGTGCCAGTGATGAGGTGG + Intergenic
1187921429 X:24206418-24206440 CACATGAGCCTGGGAGGTGAAGG - Intronic
1188383714 X:29530359-29530381 GAGATGAGAAAGTGAGGAGAAGG + Intronic
1188905801 X:35789639-35789661 GACATAAGCAGGGGAGGAGAGGG - Intergenic
1189090893 X:38081616-38081638 GAAATGAGCCAGGGAAGGGAAGG + Intronic
1189591853 X:42521316-42521338 GAAATGAGACAGGGAAGAGATGG + Intergenic
1189669065 X:43388283-43388305 AGCATGAGCCGGTCAGGAGAGGG - Intergenic
1190771933 X:53522040-53522062 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1193293861 X:79810120-79810142 GACATCAGCCAGGGAGGCTAAGG - Intergenic
1194065734 X:89259758-89259780 TACATGAACCAGAGAGGGGATGG - Intergenic
1195325835 X:103757696-103757718 GACATGAGCAGGGCAGGAGAGGG - Intergenic
1195684213 X:107570906-107570928 GGCATGAGCCAGCCAGAAGAAGG - Intronic
1195803435 X:108736589-108736611 GAGGTGAGCAAGGGAGGAGACGG + Intergenic
1196291823 X:113950718-113950740 GAAATGTGCCAGTGAGAAAATGG - Intergenic
1196366048 X:114925630-114925652 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1196890108 X:120283388-120283410 GACTAGAGTCAGGGAGGAGAAGG - Intronic
1196942353 X:120789559-120789581 GACATGAACTAATGAGCAGAGGG - Intergenic
1198725919 X:139676853-139676875 GACATGAGCAGGGCAGGAGAGGG + Intronic
1198823463 X:140673979-140674001 GACATGAGCAGGGCAGGAGAGGG + Intergenic
1199347388 X:146757508-146757530 GGCATGAGCCGGGCAGGAGAGGG - Intergenic
1199604083 X:149562855-149562877 CACTTGAGCCAGTGAGGTCAAGG + Intergenic
1199604892 X:149569440-149569462 AAAATGAGCCAGTGAGCAGGGGG + Intergenic
1199643768 X:149885828-149885850 AAAATGAGCCAGTGAGCAGGGGG - Exonic
1199845716 X:151691735-151691757 GAAATGTGCCACTGAGAAGATGG - Intergenic
1199899974 X:152163519-152163541 GACATCAGCCAGTGAAGGCAAGG + Intergenic
1200106123 X:153713810-153713832 GACATGGAGAAGTGAGGAGAAGG - Intronic
1200136729 X:153878875-153878897 GATATGAGCCTGTGGGGAGATGG - Intronic
1200719901 Y:6593884-6593906 TACATGAACCAGAGAGGGGATGG - Intergenic
1201362510 Y:13168360-13168382 GAAATGAGTCAGTGTGGAGGAGG - Intergenic
1201930572 Y:19340995-19341017 GACATGAACCAGGGAGGTGGAGG - Intergenic
1202274147 Y:23098347-23098369 GACATGAGCAGGGAAGGAGAGGG + Intergenic
1202291879 Y:23322330-23322352 GACATGAGCAGGGAAGGAGAGGG - Intergenic
1202427143 Y:24732092-24732114 GACATGAGCAGGGAAGGAGAGGG + Intergenic
1202443648 Y:24938002-24938024 GACATGAGCAGGGAAGGAGAGGG - Intergenic