ID: 963925584

View in Genome Browser
Species Human (GRCh38)
Location 3:150947481-150947503
Sequence CAGTATTAGATCATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 2, 2: 7, 3: 14, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963925580_963925584 16 Left 963925580 3:150947442-150947464 CCCACACAATAGTAGTAGGAGAC 0: 3
1: 101
2: 1475
3: 5225
4: 5307
Right 963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG 0: 1
1: 2
2: 7
3: 14
4: 134
963925581_963925584 15 Left 963925581 3:150947443-150947465 CCACACAATAGTAGTAGGAGACT 0: 3
1: 118
2: 1590
3: 5377
4: 5377
Right 963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG 0: 1
1: 2
2: 7
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963925584 Original CRISPR CAGTATTAGATCATGGAGGC AGG Intronic
902488698 1:16764989-16765011 CACTCTTTGATAATGGAGGCTGG - Intronic
904414969 1:30355092-30355114 TAGTATTAAATAATGGAGCCAGG + Intergenic
904590850 1:31614650-31614672 CAGGATTAGATCAACAAGGCTGG + Intergenic
905751225 1:40466230-40466252 CTGTATGAGATCACTGAGGCAGG - Intergenic
908663479 1:66463387-66463409 GGTGATTAGATCATGGAGGCAGG - Intergenic
910462637 1:87465035-87465057 GAGTCTAAGATCTTGGAGGCAGG + Intergenic
919150933 1:193697486-193697508 AAGGATTAAATTATGGAGGCTGG - Intergenic
919307006 1:195855138-195855160 CTCTATTAGATCATGTTGGCTGG - Intergenic
919733551 1:200929956-200929978 CAGTGTTAGATCCTGGAGGCTGG - Intergenic
1065353916 10:24820753-24820775 CAGCAGTGGATCATGGAGACAGG + Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1069548865 10:69348512-69348534 CAGAATTAATTCATTGAGGCTGG + Intronic
1070343406 10:75519267-75519289 CAATATTAGATCAACGAGACAGG - Intronic
1071327047 10:84528001-84528023 CAGAATTAGAACATGGAGATTGG - Intergenic
1072831856 10:98666357-98666379 CAGTGTTAGATCATTGAGGCAGG + Intronic
1075179974 10:120202133-120202155 TAGTATGAGATCATCAAGGCAGG - Intergenic
1076118013 10:127914016-127914038 AGGTATTGGATCATGGGGGCAGG + Intronic
1078927995 11:15891588-15891610 TAGGATGAGATCATGGAGGAGGG - Intergenic
1079132430 11:17755153-17755175 CAGTGCAAGAGCATGGAGGCAGG + Intronic
1084367324 11:68710712-68710734 CAGGATTAGCCCATGGAGGGAGG + Intronic
1085986161 11:81791314-81791336 AGGTATTGGATCATGGAGGCAGG + Intergenic
1088034460 11:105295349-105295371 CAATATTAGATCAATGAGACAGG - Intergenic
1089459169 11:118642586-118642608 TAGTTTTAGACTATGGAGGCTGG - Intronic
1091543082 12:1480479-1480501 CAGTATTAGAAAATGGAGAATGG + Intronic
1094054891 12:26258717-26258739 CAGTATTAGATCAATGAGACAGG + Intronic
1095259214 12:40079665-40079687 CAGTGTTAGATCATCGAGGCAGG - Intronic
1099780209 12:87183945-87183967 TAGAATTAAATCATGGAGGCTGG + Intergenic
1101160186 12:101965336-101965358 AAGTATCAGCTCATGGAGGGTGG - Intronic
1105802298 13:23917583-23917605 CAGCATTAGATCATCAAGGCAGG + Intergenic
1107297034 13:38920599-38920621 GAGTATTAGATCATCGAGGCAGG - Intergenic
1107354810 13:39555873-39555895 AAGTACTGGATCATGGGGGCAGG + Intronic
1108293554 13:48988226-48988248 CAGTATTAGATCAACGAGACAGG + Intronic
1108560976 13:51643682-51643704 CACCAGAAGATCATGGAGGCTGG - Intronic
1110132851 13:72028596-72028618 CTGTATTAAATAATGTAGGCCGG + Intergenic
1110716755 13:78714485-78714507 CAGCAAAAGATCATAGAGGCTGG - Intergenic
1111217172 13:85159486-85159508 CAATATTTGGTCATGAAGGCAGG - Intergenic
1114238104 14:20840142-20840164 CAGTAATAAAACATGAAGGCCGG - Intergenic
1115165857 14:30448177-30448199 CAGTCTTAAATCTTGGAAGCAGG - Intergenic
1116479162 14:45377266-45377288 CAGCACTAAATCATGAAGGCTGG + Intergenic
1119178149 14:72584798-72584820 TAATATTGGATCATGGAGTCAGG + Intergenic
1119800477 14:77440688-77440710 CAGTCTGGGATCTTGGAGGCGGG + Intronic
1121672690 14:95724898-95724920 AGGTTTTAGATCATGGGGGCAGG + Intergenic
1123908299 15:24942173-24942195 GAGTATGAGATCATGGGGACAGG + Intronic
1126010269 15:44295830-44295852 CATTCTGAGATCCTGGAGGCTGG + Intronic
1128519132 15:68364166-68364188 CAGGATTAGATGAAGAAGGCTGG - Intronic
1135739158 16:24958502-24958524 GATTATTAGTTCATGGAGGATGG - Intronic
1136461376 16:30412494-30412516 TAGAATTGCATCATGGAGGCTGG + Intronic
1137476244 16:48811788-48811810 CAGCATTAGAACAAGGCGGCAGG - Intergenic
1138534276 16:57651705-57651727 CAATATCAGATCATGAAGACTGG + Intronic
1138873405 16:60920434-60920456 AGGTGATAGATCATGGAGGCAGG - Intergenic
1139001747 16:62519216-62519238 CAATATTAGATCAACGAGACAGG + Intergenic
1142410368 16:89912892-89912914 CAGGAAGAGATCATGGGGGCGGG + Intronic
1143681869 17:8481810-8481832 CAGTTTGAGATCAAGGACGCTGG + Intronic
1151054961 17:71020314-71020336 TAGTACTAGACCATGGAGGATGG - Intergenic
1153350032 18:4069463-4069485 GGTGATTAGATCATGGAGGCAGG + Intronic
1157066288 18:44354756-44354778 CAATATTAGATCAACGAGACAGG - Intergenic
1157576700 18:48748480-48748502 CAGCATGGGATAATGGAGGCAGG + Intronic
1158330713 18:56359011-56359033 AAGTAATGGATCATGGGGGCGGG + Intergenic
1167926185 19:52822774-52822796 GAGTTTTACAACATGGAGGCAGG + Intronic
925615804 2:5743566-5743588 TAGTAGTAGAGCATGCAGGCAGG + Intergenic
926693275 2:15752234-15752256 CAGGATTGGATCAGAGAGGCAGG - Intergenic
932727471 2:74191911-74191933 CAGTATTTTATTATGCAGGCGGG - Intergenic
934085857 2:88508973-88508995 CAGAATTTGATGAGGGAGGCTGG - Intergenic
936407488 2:112219831-112219853 CAGTATTAGATCGTTGAGGTAGG - Intronic
938209982 2:129459245-129459267 CTGGATTAGATCATGGAAGGAGG - Intergenic
938492301 2:131767965-131767987 AATGATTAGATCATGAAGGCAGG - Intergenic
938495268 2:131794385-131794407 AATGATTAGATCATGAAGGCAGG + Intergenic
939436559 2:142184589-142184611 GATTATTGAATCATGGAGGCAGG - Intergenic
940561358 2:155301360-155301382 CAGTATCATATCCTGGAGGATGG - Intergenic
941034731 2:160555824-160555846 AAGTAATTGACCATGGAGGCCGG - Intergenic
941380075 2:164781621-164781643 CAGTAGTACACCTTGGAGGCAGG + Intronic
941724281 2:168844535-168844557 CATTATGAGAACATTGAGGCTGG + Intronic
945391380 2:209269178-209269200 AAGTATTAGGTCATTGAGGGTGG + Intergenic
946829675 2:223715405-223715427 CAGTTTTAGATAATTGTGGCTGG - Intergenic
1171107715 20:22450775-22450797 GATAATTGGATCATGGAGGCAGG - Intergenic
1174981577 20:55401388-55401410 AAGTATTGGATCATGGGGGCAGG + Intergenic
1176709584 21:10137766-10137788 AATGATTAGATCATGAAGGCAGG - Intergenic
1183805043 22:40201719-40201741 CTGTATTTGAAAATGGAGGCTGG - Intronic
949093265 3:54833-54855 CAGGATTAGGTCATAGAGACAGG + Intergenic
950020788 3:9786233-9786255 CAGAATAAGAGCAAGGAGGCCGG - Intronic
950948190 3:16972548-16972570 CAATGTTAGATCATCAAGGCAGG - Intronic
953414317 3:42706958-42706980 GAGCATTAGGTCATGGAGTCTGG - Intronic
953910241 3:46889105-46889127 CAGTAGTAGAACCTGGAGGAGGG + Intronic
956316333 3:67941909-67941931 AATAATTAGATCATGCAGGCAGG - Intergenic
957000311 3:74876704-74876726 CAGAATCAGAACATGGAGACTGG - Intergenic
957033518 3:75270901-75270923 CAGGATTAGGTCATAGAGACAGG + Intergenic
959879403 3:111425775-111425797 CAGTATTAGATCACTGAGGCAGG + Intronic
960421319 3:117448856-117448878 CAGAAATAGATCTTGGAGACAGG + Intergenic
963615057 3:147526454-147526476 CAGTATTAGATCATTAAGGCAGG - Intergenic
963925584 3:150947481-150947503 CAGTATTAGATCATGGAGGCAGG + Intronic
965570276 3:170165454-170165476 CAGAATTATATGATGAAGGCTGG + Intronic
966168570 3:177050648-177050670 CAGTATTACAACATGGTGGATGG + Intronic
966340608 3:178921717-178921739 CAGTCTAAGTGCATGGAGGCTGG - Intergenic
968780898 4:2580537-2580559 AAGTGTTGGATCATGGAGGTGGG + Intronic
973673877 4:53244165-53244187 CAGTATTAGATCATTGAGGCAGG + Intronic
974026252 4:56736038-56736060 GACAATTAAATCATGGAGGCAGG - Intergenic
977332663 4:95657267-95657289 CAGTATTAGATCATCAAGGCAGG - Intergenic
978611216 4:110542631-110542653 AAATATTAGCTCAAGGAGGCAGG - Intronic
978657100 4:111077138-111077160 CAGTGTTAGATCAATGAGACAGG + Intergenic
979390262 4:120119109-120119131 TATGATTAGATCATGGGGGCGGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
988087251 5:26487814-26487836 CAGTGGTAGAGTATGGAGGCTGG - Intergenic
988415519 5:30942207-30942229 CAGTTGAAAATCATGGAGGCTGG - Intergenic
993431088 5:87832628-87832650 GATTATTGAATCATGGAGGCAGG - Intergenic
995690711 5:114823563-114823585 AAGTATTGGATCATGAAGGTGGG - Intergenic
996488511 5:124065156-124065178 GAGTATGAGATCATGGAGACAGG + Intergenic
997655685 5:135552707-135552729 CAGTGGCAGATAATGGAGGCAGG - Intergenic
999127895 5:149259764-149259786 CATTTTGAGATCATGGAGGAAGG + Exonic
1000584538 5:163080595-163080617 CAGTATTTTGGCATGGAGGCAGG - Intergenic
1003516108 6:6820228-6820250 CAGAAATAGATCATGAAGCCAGG - Intergenic
1004510544 6:16280783-16280805 CATTATTAGGTAATGGAGACAGG - Intronic
1004593475 6:17076013-17076035 CAATATTAGATCAATGAGACAGG + Intergenic
1009991092 6:70843686-70843708 CAGTATTAAGTCATGGGGGTGGG + Intronic
1010561368 6:77355391-77355413 GAGTATTACATCATGGAGAATGG - Intergenic
1010974398 6:82296139-82296161 GGTTATTCGATCATGGAGGCAGG + Intergenic
1011755493 6:90494515-90494537 CAGTATTAGAGCCTGGAGCCAGG - Intergenic
1013698854 6:112738514-112738536 AGGTATTGGATCATGGGGGCAGG - Intergenic
1017253715 6:152309830-152309852 CAGTGTAACATCATGCAGGCAGG - Exonic
1019398460 7:836383-836405 CGGAATTGGCTCATGGAGGCTGG + Intronic
1019837332 7:3401277-3401299 GAGCATAATATCATGGAGGCAGG + Intronic
1021135327 7:16958227-16958249 AAGAATGAGATCATGTAGGCCGG - Intergenic
1022702107 7:32771264-32771286 CAGTATTAAATGATGTAGTCTGG - Intergenic
1024859358 7:53819507-53819529 TATTATTAGATCATAGAGGGAGG - Intergenic
1025779644 7:64589103-64589125 CACTAATAGATCACTGAGGCAGG - Intergenic
1026106897 7:67428544-67428566 AAGTACTACATCATTGAGGCAGG - Intergenic
1026382066 7:69809701-69809723 CAGTATGTGATCATGGACTCTGG - Intronic
1027535147 7:79390532-79390554 CAGTATGAGATGCTGGAGGAGGG + Intronic
1032560811 7:132891524-132891546 CAGGATTAGATCAAGGCAGCTGG + Intronic
1034128121 7:148692183-148692205 CTGTATTAAATTATGGAGGCTGG - Intergenic
1034593044 7:152160197-152160219 CATTTTTAGCTCATGGAGGGAGG + Intronic
1036095194 8:5716488-5716510 CACTATTAGATCCCGAAGGCGGG + Intergenic
1039785293 8:40829394-40829416 CAGTACTAGAGCAGGGAGTCTGG + Intronic
1047939284 8:129813273-129813295 CAGCATTAGATTATTGAGGCAGG - Intergenic
1047978642 8:130157377-130157399 CAGTTGTGGATAATGGAGGCAGG - Intronic
1048780675 8:137996539-137996561 GAGTATTAGAGCATGAAGGCAGG - Intergenic
1053646555 9:40123298-40123320 AATGATTAGATCATGAAGGCAGG - Intergenic
1053759159 9:41340253-41340275 AATGATTAGATCATGAAGGCAGG + Intergenic
1054327568 9:63721200-63721222 AATGATTAGATCATGAAGGCAGG - Intergenic
1054538015 9:66252675-66252697 AATGATTAGATCATGAAGGCAGG + Intergenic
1055035420 9:71813042-71813064 CAGTATAAGGTCTTGAAGGCTGG - Intronic
1059737472 9:117116710-117116732 AACTATTAGGCCATGGAGGCAGG - Intronic
1060591252 9:124818376-124818398 CCATCTCAGATCATGGAGGCTGG + Intergenic
1061654373 9:132077645-132077667 CAGTCTTTGATCCTGGGGGCTGG - Intronic
1202794343 9_KI270719v1_random:106733-106755 AATGATTAGATCATGAAGGCAGG - Intergenic
1185953429 X:4462107-4462129 CAGGCTTAGGTCATGTAGGCTGG - Intergenic
1186207792 X:7218017-7218039 CACTCTCAGATCATGGAGGTTGG + Intergenic
1186265418 X:7827800-7827822 GAGTATTAGATCTTGGGGCCAGG + Intergenic
1186641333 X:11458961-11458983 CAGTATTAGATAATGTGGTCAGG + Intronic
1191949528 X:66573131-66573153 CAGTATTAGATCATTGAGGCAGG - Intergenic
1192940000 X:75902146-75902168 CAGAATCAGAACATGGAGGTTGG - Intergenic
1194089289 X:89565459-89565481 GATAATTAAATCATGGAGGCAGG - Intergenic
1195097164 X:101514197-101514219 GAGCATAAGATCATGGAGGCAGG + Intronic
1195140749 X:101957000-101957022 CACTATTAGGTGATGGAGCCAGG + Intergenic
1196514460 X:116553168-116553190 CAGTGTTAGTTTGTGGAGGCAGG - Intergenic
1196600142 X:117592050-117592072 CAATATTAGATCATTGAGACAGG + Intergenic
1196715408 X:118806296-118806318 CAGTATTGAAACATGGAGTCTGG + Intergenic
1196931066 X:120682605-120682627 CAATATTAGACATTGGAGGCTGG - Intergenic
1200441951 Y:3221507-3221529 GATAATTAAATCATGGAGGCAGG - Intergenic