ID: 963927367

View in Genome Browser
Species Human (GRCh38)
Location 3:150965259-150965281
Sequence CTGTTTCTCTTGAAGAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963927367_963927372 30 Left 963927367 3:150965259-150965281 CCATATTTCTTCAAGAGAAACAG 0: 1
1: 0
2: 1
3: 33
4: 370
Right 963927372 3:150965312-150965334 GATAATACATACAAAATGCCTGG 0: 1
1: 1
2: 9
3: 85
4: 490
963927367_963927368 1 Left 963927367 3:150965259-150965281 CCATATTTCTTCAAGAGAAACAG 0: 1
1: 0
2: 1
3: 33
4: 370
Right 963927368 3:150965283-150965305 ATCATAATATGTCCCATGTAAGG 0: 1
1: 0
2: 1
3: 13
4: 145
963927367_963927369 2 Left 963927367 3:150965259-150965281 CCATATTTCTTCAAGAGAAACAG 0: 1
1: 0
2: 1
3: 33
4: 370
Right 963927369 3:150965284-150965306 TCATAATATGTCCCATGTAAGGG 0: 1
1: 0
2: 1
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963927367 Original CRISPR CTGTTTCTCTTGAAGAAATA TGG (reversed) Intronic
901269392 1:7939984-7940006 CTGTTTCCCATGATGAAATCTGG + Exonic
901293904 1:8146050-8146072 CTGTTTGGCTTGAGGGAATACGG + Intergenic
901591005 1:10342765-10342787 TTCTTTCTCTTGAAAAAACAGGG + Intronic
902655456 1:17864892-17864914 CTGTTTCTTTTTAAAAAATGTGG + Intergenic
903318751 1:22528990-22529012 CTGGTTCTCATCAAGAAAGAGGG + Exonic
903350178 1:22712201-22712223 CTACTTCTCTTGAACAGATAGGG + Intronic
904117453 1:28173279-28173301 CTGTGTCTCTTAAAAAAAAAGGG + Intronic
908548675 1:65187738-65187760 TTGTTGCTCTTGAAGTAATACGG + Intronic
908882854 1:68752101-68752123 TTGTTTCCCTTGAAGAACCAAGG + Intergenic
910238113 1:85056975-85056997 CTGTTTTTCTAGTGGAAATAGGG + Intronic
910425121 1:87113947-87113969 CTCTTTCTCTTAAAAAAAAAGGG - Intronic
910670574 1:89769011-89769033 CTGTATCTCAAGAGGAAATAAGG + Intronic
911842116 1:102696201-102696223 AAGTTTCTTTTAAAGAAATATGG - Intergenic
912740804 1:112195139-112195161 CTGTATCTATTAAAGAAATTTGG + Intergenic
915350401 1:155221267-155221289 CTGTATTTTTTGTAGAAATAGGG + Intergenic
915648063 1:157288017-157288039 CTGTATCTTTTGAAGACATGTGG - Intergenic
915890745 1:159771395-159771417 CTTTTTCTCTTGTGCAAATACGG - Intergenic
916851137 1:168705277-168705299 CTGTTTCACTTGGGGAAATTAGG + Intronic
918338541 1:183546745-183546767 CTGTTTCTCATGAATAAAAAGGG - Intronic
918801673 1:188980608-188980630 TTTTTTCTTTAGAAGAAATAAGG - Intergenic
919305703 1:195833873-195833895 CTGTTACTCTTTAAGACATGTGG - Intergenic
920923717 1:210321767-210321789 CTGCTTGTCTTGGAGAAGTAAGG - Intergenic
921277412 1:213533467-213533489 CTGTCTCTCTGGAAGGAACATGG + Intergenic
921938284 1:220814732-220814754 CTGTTTCTTTTTTAGAGATAGGG - Exonic
921944360 1:220876830-220876852 GTTTTTCTCCGGAAGAAATAAGG + Intergenic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
922925084 1:229341943-229341965 CCGTCTCTCTTGACAAAATAGGG - Intronic
922988651 1:229886389-229886411 CTGAGTTTCTTGAAGAAATGGGG + Intergenic
923415517 1:233754886-233754908 CAGTTTCTCTAGTAGACATAAGG - Intergenic
923573458 1:235137379-235137401 TTGTTTCTTTTTAAGAAACAGGG + Intronic
924034270 1:239920261-239920283 TTGGTTCTCTAGATGAAATAAGG - Intergenic
924357556 1:243198039-243198061 CTATTTATCTTGTAGAATTAGGG + Intronic
924905294 1:248445677-248445699 CTGTTTTTCATGAAGATCTAAGG - Intergenic
924922595 1:248646379-248646401 CTGTTTTTCATGAAGATCTAAGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1063667586 10:8073307-8073329 CTGTCTGCCTTGAAGAAATGAGG - Intronic
1065903830 10:30230817-30230839 CTCTTTGTCTTGAAGAAATAGGG - Intergenic
1066425387 10:35303466-35303488 CTCTTTCTTTTTAAGAAACATGG - Intronic
1067270812 10:44789986-44790008 CTGTGTCTCCAGAAGAGATACGG - Intergenic
1067665907 10:48279031-48279053 CTGTTTCTCTGGAAAACAAAAGG - Intergenic
1067754785 10:48996873-48996895 CTCTTTCTCTATAAGAGATAAGG + Intergenic
1067783311 10:49224975-49224997 CTGTTTCTACTGAATACATATGG + Intergenic
1068337088 10:55647792-55647814 CTATTTCTCTTCTAAAAATAAGG + Intergenic
1068982534 10:63076595-63076617 ATGTTCCTCTTGAAGACAGAAGG + Intergenic
1069003340 10:63290998-63291020 TTGTTTCTTTTTAAGAAACAGGG + Intronic
1069971364 10:72172516-72172538 CTTTTTCTTTTGTAGAAATGGGG + Intronic
1071119653 10:82262659-82262681 CTGTTTGTTTTTAATAAATATGG + Intronic
1072945020 10:99801987-99802009 CAGTATCTCCAGAAGAAATAAGG - Intronic
1073399981 10:103249428-103249450 TTGTTCTTATTGAAGAAATAAGG + Intergenic
1073498029 10:103911853-103911875 CTGTTTCCCTTGTAGACAAAGGG + Intronic
1073899119 10:108198717-108198739 CTGCTTTTCTGGAAGAAATCTGG - Intergenic
1073947448 10:108767375-108767397 CTGTGTTTCTTAAAGTAATAAGG + Intergenic
1074654452 10:115569116-115569138 CTGTTAGAGTTGAAGAAATATGG + Intronic
1074900578 10:117813093-117813115 CTGTATCTTTTGTAGAAATGGGG + Intergenic
1075118865 10:119650070-119650092 CTCTTTCTTTTAAAGAGATAGGG + Intergenic
1075749844 10:124757707-124757729 GTTTTTTTTTTGAAGAAATAAGG - Intronic
1078240240 11:9524422-9524444 CTGTTTTTCTTATAGAATTAGGG + Intronic
1078463579 11:11533648-11533670 CTGTTTCGTTTGTACAAATAAGG - Intronic
1078716015 11:13839661-13839683 GTATTTCTTTGGAAGAAATAAGG + Intergenic
1078767965 11:14317975-14317997 CTGATTCTCTTTTAGAAATGTGG - Intronic
1079597673 11:22271039-22271061 CTGTTTCTCTCGCAGAATTAAGG + Intronic
1079711508 11:23688905-23688927 CTGCTTGCCTTGAAGAAAGAAGG - Intergenic
1080002800 11:27369838-27369860 CAGTTTCTCTGGATGAAAAATGG - Intronic
1080179700 11:29410419-29410441 ATGTTTCATTTGAAAAAATAAGG - Intergenic
1081238843 11:40679264-40679286 CTGTTTCCCTTTAAAAAAAAAGG - Intronic
1081507853 11:43736702-43736724 CTGTTTGTCTTTAATAAAAATGG + Intronic
1082020415 11:47528240-47528262 GTATTTCTCTTGAGGAAATAAGG - Intronic
1082925989 11:58547922-58547944 ATGTTTGTTTTGAACAAATATGG - Intronic
1083763308 11:64830340-64830362 CTGTTTATCTTGAGGAAATGGGG + Intronic
1084227116 11:67723756-67723778 ATGTTTCTCTTAAAGAGAGAAGG - Intergenic
1087523387 11:99273642-99273664 CCTTTTTTCTTGAAGAAATTTGG + Intronic
1087574106 11:99968612-99968634 CTGTTTATCATAAAGGAATATGG + Intronic
1087816333 11:102663059-102663081 CTGTGTCTCTTGGTAAAATATGG + Intergenic
1087997248 11:104824620-104824642 CTGTATCTCTAGACTAAATAAGG - Intergenic
1088749312 11:112830554-112830576 GTGTTTCTCTGGGAGAAACAGGG + Intergenic
1088990811 11:114951774-114951796 TTGTTTCTCTTTAGGAAAGAAGG - Intergenic
1089193904 11:116679871-116679893 CTGTGTCTCTAAAAGAAATATGG - Intergenic
1090126170 11:124087152-124087174 GGCTTTCTCTTGATGAAATAGGG + Intergenic
1090659535 11:128871773-128871795 CTCTTTCTCTTAAAGAAGTTTGG + Intergenic
1092297036 12:7209007-7209029 CTCTTTCACTTCAAGAAACAGGG - Exonic
1092954401 12:13536572-13536594 CTATTTCTCTGGTATAAATACGG + Intergenic
1093296566 12:17399281-17399303 CAGTGTTTCTTGAACAAATAAGG + Intergenic
1093419150 12:18954643-18954665 CTGTTTCTCTAGAAAAGATGTGG + Intergenic
1094448367 12:30558300-30558322 GTTTTTCTCTTGAAGAAAAGGGG - Intergenic
1094600591 12:31905875-31905897 CTGTTTCTTTTTCAGAAACAGGG + Intergenic
1095312948 12:40722320-40722342 CAGTTTTTGCTGAAGAAATATGG + Intronic
1095794745 12:46206079-46206101 CTGTGTCTCTTGAAGAACTTAGG - Exonic
1096037654 12:48486674-48486696 CTGTTTTTCCTGTAGAAATAAGG - Exonic
1097109059 12:56644629-56644651 CAGTTTCACCTGAAGAAATTAGG - Intronic
1097920222 12:65064089-65064111 CTGTTTCTCTGGGAGATAGAAGG + Intronic
1098449751 12:70606974-70606996 GTGTGTCTCTTTAAGAAAAATGG + Intronic
1099049189 12:77762847-77762869 CTATTTATATTGAAGCAATATGG + Intergenic
1099270244 12:80499676-80499698 CTATTTCTCTTAAAAAGATAAGG - Intronic
1099445044 12:82742214-82742236 CTGTTTGTCTTGAAGGATTTGGG - Intronic
1099879183 12:88446135-88446157 TTGTTTATTTTGAAGTAATAAGG + Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1101167094 12:102049668-102049690 CTGTTTCTCTTTTAGAGAAATGG - Intronic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1103390413 12:120568775-120568797 CTGTTTGTTTTTAAGAGATAGGG + Intronic
1104627614 12:130371834-130371856 TTGTTTATTTTGAAGAAATGTGG + Exonic
1104652232 12:130543927-130543949 ATGTTTCTCTTGAAGGTATTTGG + Intronic
1107412080 13:40167160-40167182 CGATTTCTCTTGTGGAAATAAGG - Intergenic
1107681367 13:42855284-42855306 CTGTTTCTGTTTCAGAAATGTGG - Intergenic
1108005374 13:45941084-45941106 CATTTTCTCATGAAGAAACAGGG - Intergenic
1108746493 13:53400385-53400407 ATGTTTCTTTTGGAAAAATATGG + Intergenic
1109011956 13:56960775-56960797 TTATTTCTTTTGAAGAAAGAAGG + Intergenic
1109114444 13:58363486-58363508 GTGTTTATTTTGAACAAATATGG + Intergenic
1109157991 13:58935413-58935435 TTTTTTCTCTTGAAGTAAAAAGG - Intergenic
1110006959 13:70284521-70284543 CTGTTTCCTTAGAGGAAATAAGG + Intergenic
1111657305 13:91169811-91169833 TTTTTTCTCTTGGAGACATAAGG + Intergenic
1112133643 13:96551795-96551817 CTTTCTCACTTGAGGAAATAAGG + Intronic
1112660591 13:101503204-101503226 CTGGATCTCCTGAAAAAATATGG + Intronic
1112691024 13:101894040-101894062 CTTTTTATCTTGCAGAGATATGG + Intronic
1113089419 13:106601622-106601644 CTGCTTCTCTTTTAGGAATAAGG - Intergenic
1113700564 13:112383377-112383399 TTGTTTTTCTTTAAAAAATAGGG - Intronic
1114699041 14:24658399-24658421 TTGTTTTTCTTTTAGAAATAGGG - Intergenic
1114809230 14:25876880-25876902 TTGTTTCTCTTAAAAATATAAGG - Intergenic
1115568065 14:34642015-34642037 CTATTTCTCTTTAAGAATTTCGG + Intergenic
1115825398 14:37266631-37266653 TTTTTCCTTTTGAAGAAATATGG - Intronic
1115922632 14:38393438-38393460 CTGTCTCTCATGAAAAAAAATGG + Intergenic
1118327911 14:64793860-64793882 CTGGTACCCTGGAAGAAATAGGG + Exonic
1118791260 14:69095137-69095159 CATTTCCTCTTGAAGAAATGGGG + Intronic
1119321628 14:73734817-73734839 TTAGTTCTCTTGAAGAAATACGG + Intronic
1120383359 14:83811291-83811313 ATGTTTGTATTCAAGAAATAAGG + Intergenic
1124107971 15:26758751-26758773 CTTTTTCTCTTTCAGAAGTATGG - Intronic
1124451121 15:29791908-29791930 ATGTTTCTCAGGAAGACATATGG - Intronic
1124803408 15:32857347-32857369 CTGGATCTCTAGAAGAAAAATGG - Intronic
1126248074 15:46533907-46533929 CTTTCTCCCTTCAAGAAATAAGG - Intergenic
1126330699 15:47527938-47527960 CTTTTTATGTTGAAGTAATATGG - Intronic
1126719927 15:51567776-51567798 CTTTTTATCTGAAAGAAATATGG + Intronic
1126747899 15:51845449-51845471 CTTTTTCTCCTGAAGAATTTTGG + Intronic
1126921987 15:53537020-53537042 CTGTTTTTCATTAAGAAAAAAGG - Intronic
1127401621 15:58592574-58592596 CTGGTTCCCTTGAAGAAAAATGG + Exonic
1127600123 15:60527296-60527318 CTGTATCTCATGATGAAATTAGG + Intronic
1127759315 15:62122172-62122194 CTGTTTATTTTGAGGAAATTTGG - Intergenic
1128618869 15:69132148-69132170 CTGTTTTTCATGAAGAAGAAGGG - Intergenic
1129301341 15:74627346-74627368 CTGATTCTCATGCAGAACTAAGG - Exonic
1129433079 15:75515595-75515617 CTGTCTCTATTTAAAAAATAAGG + Intronic
1130098931 15:80877292-80877314 CTGTGTCTCTTGAGCAAAGAAGG - Intronic
1130985121 15:88839678-88839700 CTGTTTCTCTTAATGCAATATGG + Intronic
1131205971 15:90447594-90447616 CATTTTCTCTTCAAAAAATAAGG + Intronic
1131338030 15:91569123-91569145 AAGTAACTCTTGAAGAAATAAGG - Intergenic
1131936828 15:97515511-97515533 CTCCTTCTTTTGAAGAAAAAGGG + Intergenic
1132908636 16:2297328-2297350 CTGTTCCTCAAGCAGAAATACGG - Exonic
1133527772 16:6623083-6623105 CTGTGTCCCTTGAAGTATTATGG + Intronic
1133993358 16:10727993-10728015 GTGTTTCCCATGAATAAATACGG - Intergenic
1135411694 16:22239802-22239824 CTTTTTCTCTTAAAGAGACAGGG - Intronic
1135474771 16:22764429-22764451 AAGTTTCTCCTGAAGAAAGATGG - Intergenic
1137223158 16:46475943-46475965 CTCTTTTTCTTGAAGAAGTTTGG + Intergenic
1138116833 16:54367608-54367630 GTGTTTCTTTTGAAGAAACCAGG + Intergenic
1138217108 16:55214159-55214181 ATTTTTCTGTTGAAGAAATTAGG - Intergenic
1140532213 16:75676492-75676514 TTATTTCTTTTGTAGAAATAGGG + Intronic
1140591059 16:76353208-76353230 ATGATTCACTTGAAGAAAGATGG + Intronic
1140648557 16:77062437-77062459 CACTTTCTCTTGCACAAATAAGG - Intergenic
1144924316 17:18790601-18790623 TTATCTCTCTTGGAGAAATAAGG - Intronic
1145016044 17:19398916-19398938 CTCTTTCTCTTGCAGACACATGG - Intergenic
1145107596 17:20132427-20132449 CTTTTTTTCTGGAAGAAATTAGG + Intronic
1146320874 17:31845351-31845373 CTGTGCATCTTGAAGAAATCTGG - Intergenic
1147022001 17:37542384-37542406 CTCTTTCTTTTGAAGAATTGAGG + Exonic
1147403060 17:40192425-40192447 CTGTTTTTCTTGAAGGAAAGGGG + Intronic
1149396907 17:56254580-56254602 CTGATTCTCTGAAAGAAACAAGG + Intronic
1150045373 17:61907627-61907649 CTTTTTCTCTGAAAGAAATATGG + Exonic
1150508508 17:65724040-65724062 CTGCTTCTCTTGAAAAAATGGGG + Intronic
1151209236 17:72531804-72531826 CCTTTTATCATGAAGAAATACGG + Intergenic
1151446319 17:74166752-74166774 CTGTTTCTATTTAAGAATGAAGG - Intergenic
1153807568 18:8722384-8722406 CTTTTTTTCTTTAAGAAACAGGG - Intronic
1155638352 18:27981960-27981982 CAGTTTCTCTTGAAATTATATGG - Intronic
1155730173 18:29147322-29147344 TTGTTTCTTTTTAAGAGATATGG - Intergenic
1156179174 18:34582744-34582766 GGGATACTCTTGAAGAAATAGGG + Intronic
1156410701 18:36825814-36825836 CTGTCTCTTTTGTAGAAATCAGG - Intronic
1156586471 18:38436658-38436680 CTTTTTCACTTTAAGAAACATGG - Intergenic
1157250484 18:46091775-46091797 CTGTTGATCTTGAAGAAACTGGG - Exonic
1158816719 18:61107370-61107392 TTTTTTCTCTTGAATAAATTAGG - Intergenic
1159407123 18:68018702-68018724 ATGTTTCTTATAAAGAAATATGG - Intergenic
1160250705 18:77201553-77201575 CTGTCTCTATTGGAGAAATTGGG + Intergenic
1162863322 19:13524816-13524838 GGGTTTCTTTTGTAGAAATAGGG + Intronic
1163340507 19:16703469-16703491 CAGTTTCTGTTGAGGAAACATGG - Intergenic
926614474 2:14981987-14982009 GTGATTTTCTTGAACAAATATGG + Intergenic
927213405 2:20652162-20652184 ATGTATCTCTTGAATAAATACGG + Intergenic
927928657 2:27030057-27030079 CTGTTTCTCTTCCAAAAACATGG + Intergenic
928130795 2:28648704-28648726 TTGTTACAGTTGAAGAAATAGGG - Intergenic
928140164 2:28721604-28721626 CTTTTTGTTTTGAAGACATAGGG - Intergenic
928427247 2:31189429-31189451 GTGTTTCTCTGGAAGAACTCAGG + Exonic
928593649 2:32840866-32840888 TTGTTTCCTTTGTAGAAATATGG - Intergenic
930874747 2:56202410-56202432 ATGTTTATCTGGAAGGAATATGG - Intronic
931492674 2:62766409-62766431 ATGTTTCTCTTTGAGAAACATGG + Intronic
931631642 2:64307329-64307351 ATGTTTGTCTTGAAGATATGTGG + Intergenic
932511455 2:72297076-72297098 CTTTTCATCTTGAAGGAATAGGG - Intronic
933042953 2:77492265-77492287 TTGTTTCTCTTTTAGAGATAGGG + Intronic
933113463 2:78434681-78434703 CTGTTTTTATTGAAGAAAGAAGG - Intergenic
933792808 2:85896689-85896711 TTGTTTCTTTTGAATAAACATGG - Intergenic
935822404 2:106907337-106907359 CTGTTACTCTTTAGGAAATAGGG - Intergenic
936033378 2:109089597-109089619 CTGTTTCTCTTTTAGAGACAAGG - Intergenic
936760975 2:115782546-115782568 CTGTTTCTCTTACATACATAAGG - Intronic
937179867 2:119984791-119984813 CTGTTTCTCAAAATGAAATATGG - Intergenic
937290737 2:120780342-120780364 CTGCTTCTCTGCAAGAAAGAGGG - Intronic
938542336 2:132294523-132294545 CTTCAGCTCTTGAAGAAATAAGG + Intergenic
938861579 2:135375137-135375159 CAGTTTCTGTTAAAAAAATATGG + Intronic
939375008 2:141353462-141353484 ATGTTTCTCTTAATGAAATATGG - Intronic
939538632 2:143464220-143464242 CTATTTTTCTATAAGAAATAAGG + Intronic
939721421 2:145657838-145657860 CTGTATCTCTCTAAGAAATATGG + Intergenic
940627406 2:156192637-156192659 CACTTTCACTTGAAGAAATGAGG - Intergenic
940843401 2:158611809-158611831 CTGTTTCTCTTCTAAATATAAGG + Intronic
941284599 2:163593789-163593811 TTGTTTCTCTTGCAGCAACATGG - Intronic
941328674 2:164149265-164149287 GTGCTTCTCTTGAAAAAGTAGGG + Intergenic
941350739 2:164431426-164431448 CTGTTTCTCCATAAGAAATGTGG - Intergenic
943536960 2:189164732-189164754 CTCTTTCTTTTGAACCAATAAGG + Intronic
944199703 2:197092829-197092851 ATGTTTCTCTTGAATCAAGAGGG - Intronic
945767239 2:213996125-213996147 CTGCTTCACTGGAAAAAATAGGG + Intronic
947252514 2:228123507-228123529 CTGTTTCTCTCAAAGAAGCAAGG - Intronic
948042821 2:234917179-234917201 ATTTTTCTCTTGGAGAAAAAAGG - Intergenic
1170084377 20:12512784-12512806 CTGTTTCTAGTGAAGACCTAAGG + Intergenic
1170879350 20:20281487-20281509 ATATTTCTTTTTAAGAAATATGG - Intronic
1171871215 20:30527366-30527388 CTTCAGCTCTTGAAGAAATAAGG + Intergenic
1172825130 20:37776072-37776094 ATGTTTCACTTTAAGAAAAATGG - Intronic
1173207313 20:41005267-41005289 CAGTTCCTCCTGTAGAAATATGG + Intergenic
1173721237 20:45259875-45259897 CTGTTTCTCTGGAAGGTCTAGGG - Intergenic
1174140725 20:48411821-48411843 CTGTTTCCCTTAAAGCAATGAGG + Intergenic
1174144468 20:48441593-48441615 TTCTTTCTCTTAAAGAACTAAGG - Intergenic
1174876848 20:54235819-54235841 CTGTGCCTATTGAAGAAATGTGG + Intergenic
1177073292 21:16539544-16539566 CTATTTCTCCTGAAAAAATGAGG + Intergenic
1178081630 21:29072492-29072514 CTGATTCCCTTGAAAAAATCAGG - Intronic
1179211585 21:39329425-39329447 TTATTTCTCTTGGATAAATATGG - Intergenic
1179341961 21:40520286-40520308 TATTTTCTCTTGAAGAAAGATGG - Intronic
1180526819 22:16273771-16273793 CTGGTTCTCCTAAAGAAAGATGG - Intergenic
1181390811 22:22579570-22579592 CTTTCTCTCTTGAGGAAATTAGG + Intergenic
1181903231 22:26172168-26172190 CTTTTTCTCTTGAATTAATAAGG + Intronic
1182078668 22:27512989-27513011 CTTTTTCTCTGGAACAAGTAGGG + Intergenic
1182670921 22:31995294-31995316 TTTTTTCTCTTGAAGAGACAGGG + Intergenic
1183734546 22:39636583-39636605 CTGTGACTCCTGTAGAAATAAGG + Intronic
1183811159 22:40258812-40258834 CTGTTTCAACTGAAGAAATTTGG - Intronic
949332725 3:2940094-2940116 TTGTTACTTTTGAAGTAATAAGG + Intronic
951612228 3:24503243-24503265 CTGCCTCTCTTGAGGAAATTTGG - Intergenic
951708806 3:25569438-25569460 CTGGATCTCTTGAAGAGAGAAGG - Intronic
952209652 3:31216790-31216812 CTCTATCTCTTGAAGAGAGAAGG - Intergenic
955296669 3:57741747-57741769 ATTTTTCTTTTGTAGAAATAGGG - Intergenic
956547347 3:70419203-70419225 TTTTTTCTTTTGAAGAGATAGGG + Intergenic
956942234 3:74176523-74176545 CTGTTTCATTTGGGGAAATAGGG + Intergenic
957299576 3:78374499-78374521 CTATTTCTGTGTAAGAAATAAGG - Intergenic
958072713 3:88635390-88635412 CTGTTTTTTTAGAAGAAATAAGG - Intergenic
958213851 3:90533363-90533385 ATGTTTCATTTGAAGAAATCAGG + Intergenic
958847673 3:99284852-99284874 CTGTTTATTTTGAAGGAAAAGGG + Intergenic
959089054 3:101882894-101882916 CTGTTTCTCTTGAGGCACTTGGG + Intergenic
959146563 3:102553155-102553177 ATGTTCCTCTGGAAGAAATAGGG + Intergenic
959417052 3:106088117-106088139 CTGTATGTATTGGAGAAATAGGG + Intergenic
960325041 3:116285354-116285376 CTTTTTCTCTTATAGATATATGG + Intronic
960406904 3:117272335-117272357 CTTATTTTCTGGAAGAAATAAGG + Intergenic
960826768 3:121795063-121795085 CTGATTTTCCTGAATAAATATGG - Intronic
961611271 3:128141981-128142003 CTGTTTCCATTTAAAAAATATGG - Intronic
962068318 3:132007113-132007135 ATTCTTCTCTTGAAGAAATGAGG + Intronic
963554099 3:146764337-146764359 CTCTTTCTATTCAAGAAACATGG + Intergenic
963927367 3:150965259-150965281 CTGTTTCTCTTGAAGAAATATGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964742029 3:159976334-159976356 TTGTTTCTCTTGGAATAATAAGG - Intergenic
965360368 3:167732311-167732333 CTGTTTCTCTTAAGGATGTAAGG - Intronic
965966586 3:174498538-174498560 TTATTTCTCTTGAGAAAATAAGG + Intronic
966771658 3:183509791-183509813 CTGTTTCTGTGGGAGAACTATGG - Intronic
967759639 3:193208960-193208982 CTTCGTCTCTTGAGGAAATAAGG + Intergenic
969250111 4:5962114-5962136 CTGTTTCTCTGGAAGGTACACGG - Intronic
970034751 4:11720392-11720414 CTCATTCTCTTGGAGACATAAGG + Intergenic
972603463 4:40592840-40592862 CAGTTTCACAAGAAGAAATAAGG - Intronic
974620885 4:64352273-64352295 CAATTTCTCTTGAAGAAACTAGG + Intronic
977263532 4:94826833-94826855 CTGTTTCTCTTGGAAAGGTAGGG - Intronic
977583191 4:98747024-98747046 ATCCTTCTCTTGACGAAATAGGG - Intergenic
977710084 4:100114823-100114845 CTTTTTTTTTTGTAGAAATAAGG + Intergenic
978071590 4:104479202-104479224 ATGTTTCTCTTCAATAAAAAAGG - Intronic
978260012 4:106744436-106744458 CTGATTATCTAGGAGAAATAAGG + Intergenic
978296757 4:107214369-107214391 CTTTCTCTCAAGAAGAAATAGGG - Intronic
978644330 4:110911228-110911250 TTGTTTTTCTTGAAGTAATAGGG + Intergenic
978785842 4:112608646-112608668 TTTTTTCACTTGAAAAAATAAGG - Intronic
979244253 4:118481442-118481464 CTATTTATCTTGTAGAATTAGGG - Intergenic
979739878 4:124136153-124136175 CACTTTCTCTAGAAGAAATTGGG + Intergenic
982276849 4:153644611-153644633 CTCTGTCTCTATAAGAAATAAGG - Intergenic
982577138 4:157127605-157127627 CTGGTTCACTTGAAGAAACTGGG - Intronic
982962963 4:161863801-161863823 GTCCTTCTCTAGAAGAAATAAGG - Intronic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984406956 4:179344969-179344991 TTGTTTATCATGAAAAAATATGG + Intergenic
984994480 4:185415715-185415737 CTGTTGCTCCAGAAGAAACATGG - Exonic
985303485 4:188513958-188513980 CTGTTTCTCTTTGAGAATGATGG + Intergenic
985426894 4:189839985-189840007 CTGCTTCCCTGAAAGAAATACGG + Intergenic
986711573 5:10491763-10491785 CTGTTTCTCTCGCAGAAAATTGG - Intergenic
988105060 5:26734267-26734289 CTGTTTCCCATGTAGAAATTGGG + Intergenic
988112018 5:26834361-26834383 ATTTTTTTCTTCAAGAAATATGG - Intergenic
988708414 5:33748590-33748612 CTTTCTCTCTTGAAGCACTAGGG + Intronic
989241068 5:39203316-39203338 AAGTTTCACTTGAAAAAATATGG + Intronic
989950341 5:50290276-50290298 CAGTTTTTTTTAAAGAAATATGG - Intergenic
991919796 5:71644696-71644718 CTTTTTCTCTTGAAATAACAGGG + Intronic
992147967 5:73871256-73871278 CTGTTTCTCTTTAAAAGATAAGG + Intronic
992270464 5:75057528-75057550 CTGATTATCTTAAAGAAATAGGG + Intergenic
995013448 5:107283861-107283883 CTGTTTCCTTAGAGGAAATAAGG + Intergenic
995043560 5:107618190-107618212 CTGTTTCTTTTGAAAAAGTAAGG + Intronic
995101905 5:108321450-108321472 CTGTTTCACATGAAAAAAAATGG + Intronic
995145503 5:108784054-108784076 TTGTTTCTCTTGATGGAAAAGGG + Intronic
995215020 5:109585216-109585238 CTGCTTCCTTTGAAGAAATGTGG + Intergenic
995282470 5:110351732-110351754 CTGTTTCTACTGTTGAAATAGGG + Intronic
996855533 5:128001974-128001996 CTGCTTCTCTTTAAGAAACGAGG + Intergenic
999112779 5:149136646-149136668 CTGTTTCCCTTGAATAAAGCTGG - Intergenic
999551621 5:152693824-152693846 CTGTTTCTCTTCAAGATAGGTGG + Intergenic
999904734 5:156127703-156127725 CTATTTCTTTTGAAGTAATGTGG - Intronic
1000863140 5:166480489-166480511 ATATTTCTGTTGAAGAAATCCGG - Intergenic
1002320401 5:178372123-178372145 TGGTTCCTCTGGAAGAAATAAGG + Intronic
1002654835 5:180737555-180737577 CAGTTTCTTGTGAATAAATAGGG + Intergenic
1003176630 6:3757097-3757119 CTGTTTCTCTTCAAAACAAAAGG + Intergenic
1004169050 6:13281656-13281678 CTGTTTATCTGGAGTAAATATGG + Intronic
1004200658 6:13544661-13544683 CTGTTTCTCTAGAATAATAATGG + Intergenic
1005399018 6:25412567-25412589 CCTTTTCTCTTTAAGATATAGGG - Intronic
1006004589 6:30992223-30992245 CTGTTCCTCTCAAAAAAATAAGG + Intergenic
1007561023 6:42808428-42808450 CTGTTTATCTTAATGAAATGTGG + Intronic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1008812729 6:55524627-55524649 TTGCTTCACTTGAAGTAATAGGG + Intronic
1010534421 6:77010298-77010320 CTGTTTCTATTGAAAACCTATGG - Intergenic
1010772890 6:79852900-79852922 CTGTATTTATTGAAGAAATTGGG - Intergenic
1011654526 6:89538247-89538269 CTGTTTTTGTTGAAGCAATCAGG + Intronic
1011767446 6:90638159-90638181 TTATTTTTCTTCAAGAAATAAGG + Intergenic
1012368167 6:98468678-98468700 CTGTTTCTCATGAAGACTGATGG - Intergenic
1012779775 6:103543238-103543260 TTGTTTCTATTGAAAAACTAAGG + Intergenic
1012993657 6:105951252-105951274 TCATTTCTCTTTAAGAAATAAGG + Intergenic
1013269283 6:108530834-108530856 GTTTTTTTCTTGGAGAAATAAGG + Intergenic
1013847247 6:114467916-114467938 TTGTTTGTTTTGTAGAAATAGGG - Intergenic
1014833202 6:126126992-126127014 GTATATCTCTTGAAGAAATTAGG - Intergenic
1015004175 6:128258150-128258172 TTTATTCTCTTTAAGAAATAAGG + Intronic
1015098693 6:129448931-129448953 CTATATCTCTAGAAGAAATCAGG - Intronic
1015098694 6:129448966-129448988 CTGTATCTCTAGAAGAAATCAGG - Intronic
1016830081 6:148425315-148425337 CTGTGTCTGTTAATGAAATAAGG + Intronic
1017355921 6:153508066-153508088 CTGTTTTTTTTTAAGAAATGAGG - Intergenic
1017380799 6:153826896-153826918 ATGTTTCTGTTCCAGAAATAAGG - Intergenic
1017752358 6:157499771-157499793 ATATTTCACTTGAAGAAGTAGGG + Intronic
1019842444 7:3461699-3461721 CTGTTTCTCTGTAACATATAAGG - Intronic
1019964459 7:4487344-4487366 CTCTTTCTCTTTAAGAGACAAGG + Intergenic
1020285181 7:6673347-6673369 CTATTTTTCTTGAAGAAACTGGG - Intergenic
1020287150 7:6692542-6692564 CTATTTTTCTTGAAGGAACAGGG + Exonic
1020880423 7:13755371-13755393 TTGTTTCTCTTAAAGAGATGGGG + Intergenic
1023420043 7:39969507-39969529 TTGTTTCTCTTGAATAAGTTAGG + Intronic
1024448595 7:49512360-49512382 CTGCTGGCCTTGAAGAAATAAGG - Intergenic
1024644731 7:51361560-51361582 CTGCTTTTCTAGAAGAAATGAGG + Intergenic
1025888696 7:65624302-65624324 GTCTTTCTCTAGAAGAAAAAAGG + Intergenic
1027842495 7:83330741-83330763 CTGATTCCTGTGAAGAAATAAGG - Intergenic
1028504581 7:91557146-91557168 CTTAATCTCTTGAAGAAAAAAGG + Intergenic
1028538613 7:91917126-91917148 CTGAATCTCTTGAATAAATGCGG + Intergenic
1029585527 7:101468442-101468464 CCGTTTCTCTTCTGGAAATAGGG + Intronic
1029868902 7:103666888-103666910 CTGATACTCTTGTATAAATACGG - Intronic
1030371926 7:108710329-108710351 TTGTTTCTCAAGAAGAGATAAGG + Intergenic
1031703268 7:124951700-124951722 CTGTTTTTCTTGAAATATTAGGG - Intergenic
1031924892 7:127629783-127629805 CTTCTTCTCTTGAAAAAATGAGG + Intergenic
1032644453 7:133806969-133806991 CTGATTTTCTTAAATAAATACGG + Intronic
1033346491 7:140529151-140529173 GAGTTTCTCTTCAAGAAAAATGG + Intronic
1033883769 7:145919048-145919070 CTGTAACTTTTGAAGATATATGG + Intergenic
1034391926 7:150793769-150793791 ATTTTTCTCTTGAAGACAGATGG - Intronic
1034591764 7:152146457-152146479 CCGTTTCTCTTAGAGGAATAAGG - Intronic
1035310798 7:157967301-157967323 CTGTTTGTTCTGAAGAGATAGGG - Intronic
1035397004 7:158541182-158541204 ATGTTTGTCTTGAAGACATAGGG + Intronic
1035682655 8:1499621-1499643 CTGTTAGCCTTGAAGAAATGGGG + Intergenic
1035948616 8:3993696-3993718 ATGTTTCTTTTGAAGTCATAAGG + Intronic
1036565456 8:9934273-9934295 CTGTTGTTGTTGTAGAAATAGGG - Intergenic
1036978316 8:13440203-13440225 CGGTGTATCTTGTAGAAATAGGG + Intronic
1037250097 8:16882065-16882087 CTCTGTCTCTTAAAGAAAAAGGG + Intergenic
1037351988 8:17969665-17969687 CTGTTTTTCCTGAAGAATTCTGG - Exonic
1038374484 8:27024861-27024883 GTGCTGCTCTTTAAGAAATACGG - Intergenic
1038980824 8:32757746-32757768 GTTTTTATATTGAAGAAATAAGG - Intronic
1039957719 8:42220034-42220056 CCATGTCTCTTGAAGAAAAAGGG + Intergenic
1041093536 8:54326897-54326919 CTGTTTATCTTTTAAAAATAGGG + Intergenic
1041112723 8:54501528-54501550 TTGTTTCTCTGGATGTAATACGG + Intergenic
1042488890 8:69377015-69377037 CTCTTTCTCAGGAAGAAATACGG - Intergenic
1042516515 8:69664429-69664451 ATGTTTCTTTTTAAGAAATGAGG - Intergenic
1042637319 8:70893089-70893111 CTTTTTCTCTTGATCAAATCTGG + Intergenic
1043316771 8:78932511-78932533 CTGTTACTCTGGTAGAAAAAGGG - Intergenic
1044914329 8:97096320-97096342 CTCTTTCTCATAAAGTAATAAGG - Intronic
1044950391 8:97430325-97430347 AGGTTTCTCTTGAAGAAAAGTGG + Intergenic
1045193736 8:99908866-99908888 CTGTTGCTGAAGAAGAAATAGGG + Intergenic
1046058228 8:109104360-109104382 CTATTTCTCTTTCAGAAAAATGG - Intronic
1047856969 8:128921455-128921477 CTCTTTCTCCTGTAGAAAGATGG + Intergenic
1049094780 8:140542010-140542032 TAGTTTCTTTGGAAGAAATAGGG - Intronic
1049135832 8:140898527-140898549 CTTCTCCTCTTGAAGAAATAGGG + Intronic
1050002717 9:1095672-1095694 CTGCTTCTCTTGAAGGTGTAAGG + Intergenic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1052206218 9:25844268-25844290 CTCATTATCTTGAAGAAAAAGGG + Intergenic
1052334029 9:27301682-27301704 CTCTGCCTCTTGAAAAAATATGG - Intergenic
1052339147 9:27348350-27348372 ATTTCTCTCTTCAAGAAATATGG + Intronic
1052606217 9:30705480-30705502 CTGTTTCTTTTGTAGATAAATGG - Intergenic
1055550844 9:77431112-77431134 CTGTTACCCTTGGAGAAAAAGGG - Intronic
1058193083 9:101941828-101941850 CTATTTCTTTTGAACAAAGATGG + Intergenic
1058721222 9:107766300-107766322 CTGTATTTTTTGTAGAAATAGGG - Intergenic
1059064158 9:111065054-111065076 CTGTTTCTCTCAAAGAATAAGGG - Intergenic
1059168722 9:112104189-112104211 GGGTTTCTTTTGTAGAAATAGGG + Intronic
1059712259 9:116879295-116879317 CAGTTTCACTTTCAGAAATAAGG + Intronic
1186038463 X:5449628-5449650 TTATTTCTCTTGTAGAAATCTGG - Intergenic
1186067026 X:5777298-5777320 CTGTGCCACTTGAAGAAACATGG - Intergenic
1186566623 X:10669918-10669940 CTGTTCCAAATGAAGAAATATGG + Intronic
1186799738 X:13080801-13080823 CTTCTACTCTTGGAGAAATAGGG - Intergenic
1186815860 X:13237446-13237468 CTTTCTCTCTTGCAGAGATAAGG - Intergenic
1188647716 X:32591433-32591455 CTGTTTCTAATAAAGAAAGAAGG - Intronic
1189174973 X:38947342-38947364 CTATTTCTATTGAATAAATTTGG + Intergenic
1193200362 X:78682677-78682699 CTTTTTCTTTTGTAGAAATAGGG + Intergenic
1195523428 X:105857576-105857598 ATTTTTTTCTTTAAGAAATAAGG - Intronic
1196342927 X:114617129-114617151 ATGTTTTTCTTGAAGTAATTTGG - Intronic
1197027912 X:121777623-121777645 GTGTATCTCCTGAAGATATAAGG + Intergenic
1197369219 X:125605751-125605773 ATGATTTTCTTGGAGAAATAAGG + Intergenic
1197525138 X:127552165-127552187 CAGTTTCTCTTGAACAAGTATGG + Intergenic
1198152528 X:133924940-133924962 CTTTTCCTCTTTAAGGAATATGG - Intronic
1198664517 X:139005243-139005265 CCATTTCTTTGGAAGAAATAAGG + Intronic
1198703094 X:139418096-139418118 CTGGTTATCAGGAAGAAATAGGG + Intergenic
1198864781 X:141110116-141110138 CTGTTTCCCATGAATAAATAAGG + Intergenic
1198897909 X:141477275-141477297 TTGTTTCCCATGAATAAATAAGG - Intergenic
1201426903 Y:13861360-13861382 CTGTTTCACTTGAAAATAAAGGG + Intergenic
1201633024 Y:16091193-16091215 TTGTTTCTCTTGTAGAAATCTGG + Intergenic