ID: 963927495

View in Genome Browser
Species Human (GRCh38)
Location 3:150966382-150966404
Sequence CAGTTTAAGAAGTTAGATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 417
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 377}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963927493_963927495 -4 Left 963927493 3:150966363-150966385 CCTAACTTCTTGCCATTATCAGT 0: 1
1: 0
2: 0
3: 13
4: 191
Right 963927495 3:150966382-150966404 CAGTTTAAGAAGTTAGATTTAGG 0: 1
1: 0
2: 2
3: 37
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963927495 Original CRISPR CAGTTTAAGAAGTTAGATTT AGG Intronic
902573596 1:17362676-17362698 AAATTTAAAAATTTAGATTTGGG - Intronic
904459865 1:30669969-30669991 AACTTTAAGGAGTTAGATATTGG + Intergenic
905348703 1:37329558-37329580 CAGTTTAAAAAGGCTGATTTAGG - Intergenic
906653563 1:47531882-47531904 GAGTGAAAGAAGTTAGTTTTAGG + Intergenic
907165480 1:52406979-52407001 AAATTTAAGTAGTTAGATATAGG + Intronic
907837494 1:58124675-58124697 CAGTTTAAGAATGTAGATTGCGG + Intronic
908574690 1:65447215-65447237 TAGTTTAAAATTTTAGATTTAGG + Intronic
909008461 1:70304697-70304719 TAGTTTAAAAAGTTAGTTTTAGG - Intronic
909220007 1:72945737-72945759 CCTTTCAAGAAGTTGGATTTAGG + Intergenic
911850524 1:102813518-102813540 CAGTTACATGAGTTAGATTTTGG + Intergenic
913046993 1:115082556-115082578 CAGTTTAAAAAGTTAATTTCAGG - Intronic
913415716 1:118604481-118604503 ACATTTAAGAAATTAGATTTTGG + Intergenic
914390512 1:147217634-147217656 CAGTTAAAGAAATGAGATGTTGG - Intronic
914708524 1:150191471-150191493 CAGTTTTAGAGGTTAGATGATGG - Intergenic
915017602 1:152749727-152749749 AATTTTGAGAAGTTAGATGTAGG + Intronic
915126561 1:153669749-153669771 CAGTTAATGAAGTTAGATGGTGG - Intronic
916662010 1:166931241-166931263 AAGTTTTACAAGTTGGATTTTGG - Intronic
919354325 1:196501816-196501838 CATTTTAAAAAGGTAGTTTTGGG + Intronic
919527642 1:198674082-198674104 CATTTTAAGAAGATAAATCTGGG - Intronic
921283856 1:213591620-213591642 AAGTTTAAGAAGTGAGAAGTTGG - Intergenic
921407324 1:214795017-214795039 TAGTTTCAGATGTTACATTTAGG + Intergenic
921538584 1:216383999-216384021 CAGTTTAAAAATTTATATGTAGG - Intronic
922552316 1:226504890-226504912 CAGTTTAAGGAGATAGAAGTGGG + Intergenic
923839078 1:237648141-237648163 GAGTTTTAGAAAGTAGATTTTGG + Intronic
924726007 1:246671597-246671619 CAGTTTAAAAATTTAAAATTTGG + Intergenic
1063498008 10:6527863-6527885 CAGTTTTAGAAGTTAAGCTTAGG - Intronic
1065767667 10:29046628-29046650 CAGTTTAAAAAATAATATTTGGG + Intergenic
1066364631 10:34764960-34764982 AAGTTTACGAAGTTAGGATTAGG + Intronic
1066931015 10:41758832-41758854 GAGTCTAAGAAGTGATATTTTGG + Intergenic
1067153925 10:43759124-43759146 CACTTTAAAAAATTAGTTTTTGG + Intergenic
1069130447 10:64694926-64694948 GAGTTTAAGTAATCAGATTTGGG + Intergenic
1070200703 10:74203073-74203095 TAGTTTAAGGTCTTAGATTTAGG + Intronic
1070465288 10:76716295-76716317 CAGTTTCAGATCTTAGATTTAGG - Intergenic
1071065737 10:81633771-81633793 GAGTTTAAGAATTTAGATGGAGG + Intergenic
1071143162 10:82536469-82536491 CACTTTAAGAACTTATATGTGGG + Intronic
1071258552 10:83897285-83897307 CATTTTAAGAAATTAAATGTTGG + Intergenic
1071780908 10:88843605-88843627 CAGTGTAACAAGTAAGTTTTTGG + Intronic
1071928611 10:90440230-90440252 CAGAGTAAGAAGTTTGATTTTGG + Intergenic
1072124044 10:92429956-92429978 CAGTTTAAGAAGTTCCTTTTTGG + Intergenic
1074227661 10:111502678-111502700 CATTTTTAGCAGTTTGATTTTGG + Intergenic
1074419670 10:113297938-113297960 TAGTTGAAGAAGCCAGATTTGGG - Intergenic
1074689408 10:115990860-115990882 CAGATTAAAAATGTAGATTTGGG + Intergenic
1077808083 11:5609620-5609642 GACTTTAAGAAGTTAAATCTTGG + Intronic
1078142363 11:8701747-8701769 CAGTTTAGGAAGTAAGAAGTCGG - Intronic
1078343243 11:10517193-10517215 CATTTCTAGAAGTTTGATTTGGG - Intronic
1079625602 11:22613052-22613074 TAGTTTAAGATATTAGATTTAGG + Intergenic
1079866437 11:25741164-25741186 CCATTTAAGAAGTTAGCTATTGG + Intergenic
1080001862 11:27359405-27359427 CAGATTAAGAGCTTAGATTTGGG + Intronic
1080480334 11:32641214-32641236 GAGTTTATGAAGCTATATTTTGG - Intronic
1080529757 11:33163298-33163320 GTGCTTAAAAAGTTAGATTTTGG + Intergenic
1081089348 11:38843677-38843699 CATTGAAAGAACTTAGATTTTGG + Intergenic
1081201963 11:40227414-40227436 CTGTTTGTGAAGTTAGAATTAGG + Intronic
1081518972 11:43863048-43863070 CATTTTAAAAAGTTCTATTTGGG + Intergenic
1082687129 11:56253652-56253674 CAGTTTATGAAGGCACATTTAGG - Intergenic
1082739608 11:56896017-56896039 GAGGTTAAGAGCTTAGATTTTGG - Intergenic
1083019099 11:59488154-59488176 GTGTTTAACAAGATAGATTTGGG - Intergenic
1085155079 11:74286162-74286184 GAGTTTGAGAAGCTAGAATTGGG - Intronic
1085215943 11:74832014-74832036 TAGTTTAAGCACTTACATTTAGG - Intronic
1085673718 11:78494587-78494609 AAGCTTAGGAAGTTATATTTTGG + Intronic
1085924488 11:80999304-80999326 CATTTTAAGAAATTTGCTTTTGG - Intergenic
1086105438 11:83141906-83141928 CATTTTAAGAACTGAGACTTAGG - Intergenic
1086773376 11:90797588-90797610 CTGTTTAAGAACTTGGACTTTGG - Intergenic
1087031281 11:93707461-93707483 TCTTTTAAGAAGTTACATTTTGG + Intronic
1087058463 11:93956058-93956080 CAGATTAAGTAGTTAGATTATGG - Intergenic
1087957092 11:104302137-104302159 CAGTTGAAGATGATAAATTTAGG - Intergenic
1088987448 11:114922139-114922161 CTGTTGGAGAAGTTATATTTGGG + Intergenic
1089166621 11:116482454-116482476 CATTTTTAAAAGGTAGATTTGGG + Intergenic
1089937731 11:122382978-122383000 TAGTTTAAGGTCTTAGATTTAGG - Intergenic
1089997526 11:122922964-122922986 TAGTTTTAAAATTTAGATTTAGG - Intronic
1090321909 11:125852651-125852673 CAGTTTCAGGTATTAGATTTAGG + Intergenic
1092493609 12:8969692-8969714 CACTTTAAAAAACTAGATTTTGG - Intronic
1093859291 12:24143509-24143531 CATATCTAGAAGTTAGATTTGGG - Intergenic
1094398522 12:30035224-30035246 TAATTTAGGAATTTAGATTTTGG - Intergenic
1094402461 12:30076651-30076673 CACTTTAGGAAGTTTTATTTAGG + Intergenic
1096671716 12:53202947-53202969 TAGTTTTAGTAGTTATATTTAGG - Intronic
1097210670 12:57366454-57366476 CGTTTTTAAAAGTTAGATTTTGG + Intronic
1098887945 12:75979220-75979242 CAGCTCAAGAAGGAAGATTTGGG + Intergenic
1099354199 12:81612459-81612481 CAATTTTAGCAGTTAGATATTGG + Intronic
1099420537 12:82453443-82453465 CAGATTATGAAGTCAGATGTTGG + Intronic
1099494721 12:83332810-83332832 CAGTGTAAGAAGTAAGGTTAAGG + Intergenic
1099618279 12:84967104-84967126 CACTTTAAAATGTTAGGTTTTGG - Intergenic
1101178264 12:102180271-102180293 CTGTTTAACAAGTTTGCTTTTGG + Intronic
1102424345 12:112829161-112829183 CAGTTTAAGAGTTTAAATTCTGG + Intronic
1103312702 12:120024308-120024330 CATTTCTAGAAGTTCGATTTAGG - Intronic
1103429499 12:120870865-120870887 CAGTTTAAGAAGATGAACTTTGG + Intronic
1103463955 12:121127242-121127264 AATTTTAAGGAGTTAGATATGGG - Intergenic
1105419907 13:20242780-20242802 CAGTTTAAAGATTTAGATTTTGG + Intergenic
1107004024 13:35586461-35586483 CATTTTTAAAAGTAAGATTTGGG - Intronic
1108263590 13:48681886-48681908 CAGTTTAAGAAGTTAGAGAAGGG - Intronic
1108636049 13:52335365-52335387 CAATTTAAGATGTTAGATAAAGG - Intergenic
1108651761 13:52487884-52487906 CAGTTTAAGATGTTAGATAAAGG + Intergenic
1109192514 13:59342259-59342281 AAATATCAGAAGTTAGATTTTGG + Intergenic
1109646071 13:65258524-65258546 CATTTTGAGATGTTATATTTAGG - Intergenic
1110548449 13:76782987-76783009 CAGTTTAAGAAAAAATATTTAGG + Intergenic
1110622625 13:77615032-77615054 CAGTTTAATATATTACATTTTGG + Intronic
1110800625 13:79689823-79689845 CAATTTAAGATGGGAGATTTGGG + Intergenic
1111953303 13:94728476-94728498 CAGTTTAAGAAATAGCATTTTGG - Intergenic
1112383140 13:98912170-98912192 CACTTTAAGAAGTTTTTTTTAGG - Intronic
1112666306 13:101578452-101578474 GAGTATAAGAAGTAAAATTTGGG + Intronic
1112700934 13:102007042-102007064 CACTCTAAGAAGTAAGATTTTGG - Intronic
1112731384 13:102367079-102367101 CATTTTAAGAAGCTAAGTTTTGG - Intronic
1113359683 13:109618853-109618875 TGGCTTAACAAGTTAGATTTTGG + Intergenic
1114494854 14:23125721-23125743 CAGTTTAAGCAGACAGAATTCGG + Exonic
1115056937 14:29139948-29139970 CAGTTTAAGATTTTTCATTTAGG + Intergenic
1116220681 14:42083416-42083438 CAGTATAAAATGTTAGAATTAGG + Intergenic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116292515 14:43061875-43061897 CAATTTAAGCACTTAGACTTTGG - Intergenic
1116530206 14:45962537-45962559 CATCTTTAGAAGTTTGATTTGGG + Intergenic
1117503559 14:56377907-56377929 CTGTTTTAGAAGTTTGCTTTGGG + Intergenic
1117835618 14:59802769-59802791 CATTTTAGCAAGTGAGATTTTGG - Intronic
1117894608 14:60470007-60470029 AAGCATAAGAAGTTAAATTTGGG - Intronic
1118236046 14:64006170-64006192 CAGTTTAGCAATTTAGATTTAGG + Intronic
1118526011 14:66644137-66644159 CTGTTTAATTATTTAGATTTGGG + Intronic
1118640619 14:67788855-67788877 CAGTATATGAAGGTAGAATTAGG - Intronic
1118790597 14:69088454-69088476 CATTTCAAGAAATTAGACTTGGG - Intronic
1119630081 14:76222654-76222676 CTGTTTAAGAAGTTGAATCTGGG + Intronic
1119828041 14:77674362-77674384 CAGTTTAAAAAGGAGGATTTGGG - Intronic
1120301162 14:82708717-82708739 AATTTTCTGAAGTTAGATTTTGG + Intergenic
1120667921 14:87329245-87329267 CTGCTGAGGAAGTTAGATTTGGG - Intergenic
1123626819 15:22232849-22232871 TAGGTTTAGGAGTTAGATTTAGG - Intergenic
1123674282 15:22693194-22693216 CAGAATAAGATGTTAAATTTAGG - Intergenic
1124025420 15:25961122-25961144 CTGTTTAAGCAGTGACATTTTGG - Intergenic
1124326293 15:28766184-28766206 CAGAATAAGATGTTAAATTTAGG - Intergenic
1125006019 15:34819074-34819096 GAGTTTGAGATGTTTGATTTAGG + Intergenic
1126081364 15:44966801-44966823 TGGTTTAAGAAATTAAATTTGGG + Intronic
1127879849 15:63147229-63147251 CATTTTAAGCTATTAGATTTGGG + Intronic
1128872393 15:71170853-71170875 CATCTCAAGAAGTTAGATTTGGG - Intronic
1130358636 15:83159349-83159371 CAGTTTGAGAAGTAAGCTCTAGG - Intronic
1130852780 15:87813050-87813072 CAGTTTAACTAGTTAGTTTATGG - Intergenic
1130957396 15:88637406-88637428 CAGTACAAGAGATTAGATTTTGG + Intronic
1131112484 15:89774191-89774213 CAGGTTAAGGAGTTGGTTTTGGG - Intronic
1131798309 15:96043483-96043505 CACCTTGAAAAGTTAGATTTTGG - Intergenic
1131828313 15:96337250-96337272 CAGATTAAGAGGTTTGAATTGGG - Intronic
1137741357 16:50778951-50778973 CATTTTAAGAAAATAGCTTTTGG + Intronic
1137999385 16:53259064-53259086 CATTTTAAGAAGAAAAATTTAGG + Intronic
1138833484 16:60404561-60404583 CAGATTAAGAAGTTAGACTGTGG + Intergenic
1139791435 16:69439852-69439874 ATGTTTAAGATGGTAGATTTTGG - Intronic
1141977164 16:87524556-87524578 TAGGTTTAGGAGTTAGATTTAGG + Intergenic
1142560316 17:805574-805596 CGGTTAAAGAACTTAGAGTTTGG + Intronic
1142568755 17:858317-858339 CATTTTAAAAATTTAGATTTAGG - Intronic
1143695387 17:8611542-8611564 CAGTTTTAGAATTTTCATTTGGG - Intronic
1145363776 17:22235122-22235144 CAGTTTACAAAGTGACATTTCGG - Intergenic
1146202409 17:30871201-30871223 CATTTCTAGAAGTTTGATTTGGG + Intronic
1149473116 17:56935527-56935549 CAGGTTTTGAAGTCAGATTTGGG - Intergenic
1149526644 17:57361177-57361199 TAGGTTAAGTAGTTACATTTTGG - Intronic
1149747217 17:59110132-59110154 TAGTGGAAGAAGTTATATTTAGG + Exonic
1149824292 17:59813090-59813112 CAGTTTATAATCTTAGATTTTGG + Intronic
1153119470 18:1703903-1703925 CAGTTTAAGGAGTTTTTTTTTGG - Intergenic
1155163167 18:23211759-23211781 CAGTTAAAGCATTTAGAATTTGG + Intronic
1155265750 18:24091527-24091549 CAGTTTTAGATCTTACATTTAGG - Intronic
1155492713 18:26415985-26416007 AAATTTAAGAATTCAGATTTTGG - Intergenic
1155608516 18:27635777-27635799 CATTCTAAGAAGTTTGGTTTAGG + Intergenic
1155905593 18:31447404-31447426 CTCTTTTACAAGTTAGATTTTGG + Intergenic
1156567466 18:38209722-38209744 AATTTTCAGAAGTTTGATTTTGG - Intergenic
1156626327 18:38914283-38914305 CTGTTTAAGAAGATAATTTTTGG - Intergenic
1157268494 18:46249781-46249803 CAGTTTAAGAAGTTTGGCTATGG - Intronic
1157644334 18:49251866-49251888 TAGATTATGAATTTAGATTTGGG + Intronic
1159784941 18:72702215-72702237 CAGTTTTGGATGTTTGATTTTGG - Intergenic
1163164549 19:15486566-15486588 CAGTTTAAAATGGTAAATTTTGG - Intronic
1164220275 19:23187188-23187210 AAGTGTAAGAAAATAGATTTTGG - Intergenic
1165279620 19:34785070-34785092 AAGTATCAGAAGTTAGGTTTTGG - Intergenic
1168320412 19:55506045-55506067 GAGTTTAAGGACTTAGATTGGGG + Intronic
927190895 2:20516270-20516292 CACTCTAATAAGTTAGAGTTAGG - Intergenic
927328643 2:21835970-21835992 CAGTTTAATATGTTTGCTTTGGG + Intergenic
927411887 2:22835531-22835553 CAATATTAGAATTTAGATTTTGG - Intergenic
928350757 2:30551593-30551615 CAGTTTTAGAGGTTTGATGTGGG + Intronic
928708771 2:33981070-33981092 GAATTTAAGAAGATTGATTTAGG - Intergenic
928929215 2:36606507-36606529 CAGTGTAGGAAGCTAGAATTTGG - Intronic
929185162 2:39086483-39086505 CAGTTTAACATATTAGATATTGG + Intronic
929566393 2:42988629-42988651 CAGTTTTAGATTTTACATTTAGG + Intergenic
929893293 2:45936747-45936769 GAGTTAAAGAAGTGTGATTTTGG + Intronic
931917492 2:66973508-66973530 CAGTTTAAGGAGCTAGAAGTAGG - Intergenic
932931422 2:76044569-76044591 TAGTGTAAGAAGTAAAATTTGGG - Intergenic
933087416 2:78073315-78073337 CAATTTATGGAGTGAGATTTAGG + Intergenic
933331787 2:80901409-80901431 CACATTATGAAGTTAAATTTTGG + Intergenic
935001103 2:99016510-99016532 TGGTTTCAGATGTTAGATTTAGG - Intronic
935081384 2:99799942-99799964 CAGTTTTAGACTTTACATTTGGG - Intronic
938682779 2:133709206-133709228 CAATTTAAGATGCTATATTTAGG - Intergenic
941805078 2:169703985-169704007 CAGTTTCTGAAATTAGATTGAGG + Intronic
942889435 2:180970065-180970087 CAGTTTAAAGAGATTGATTTGGG - Intronic
943056255 2:182984402-182984424 AAGTTTTAGAATTTAGATTGGGG + Intronic
943816030 2:192256382-192256404 TAGTATAAGATGTGAGATTTAGG + Intergenic
944325368 2:198398045-198398067 CAGTTAAAGAAGTGGGTTTTAGG + Intronic
944850037 2:203709518-203709540 AAGTTAAAGAAGTGTGATTTAGG + Intronic
945208403 2:207356823-207356845 CTCTTTAAGAAGTTAGAGTGTGG - Intergenic
945568861 2:211438857-211438879 GAGCTTAAGAACTTAGATTTTGG + Intronic
946138618 2:217668920-217668942 CTGTTTAAGATGTTAAAATTAGG + Intronic
946540586 2:220680248-220680270 CAGAATAAGAAGTTGTATTTAGG - Intergenic
947304276 2:228726100-228726122 CATTTTCAGAAATTAAATTTTGG + Intergenic
948617671 2:239211765-239211787 CAGTTTAAGATGCTGGATTCTGG - Intronic
1169534175 20:6519350-6519372 CATTTTAAAAAGTTAAATCTAGG - Intergenic
1170355307 20:15486023-15486045 GAGTTTAAGAAGTTTCCTTTGGG + Intronic
1173211782 20:41039450-41039472 CATTTTAAGAAATAAGAGTTTGG - Intronic
1173436407 20:43035735-43035757 CAGTTTAAGAAAACAGAATTTGG + Intronic
1173884311 20:46443959-46443981 GATTTTAAGGAGTTAGATGTGGG - Intergenic
1177900533 21:26909313-26909335 AAGTTTAAGAATGTATATTTTGG + Intergenic
1178002059 21:28172961-28172983 CATATTAAGAAGTAAGATTAAGG + Intergenic
1178189634 21:30265617-30265639 CATTTTAAGACCTGAGATTTTGG - Intergenic
1178232784 21:30805990-30806012 CACTTTTATGAGTTAGATTTGGG - Intergenic
1178436716 21:32566544-32566566 CAGTTCAAGAAGTTCAATTTTGG + Intergenic
1178447946 21:32662511-32662533 CAGTTTTTGAAGTAAGATTAAGG + Intronic
1178787705 21:35668758-35668780 CACATTTAGAAGTTAGTTTTGGG - Intronic
1182403499 22:30102968-30102990 AAGTATAAAAAGGTAGATTTCGG + Intronic
1182530003 22:30947861-30947883 CAGTTAGAGAAGTGATATTTGGG - Intronic
949494195 3:4616308-4616330 CAGTCTAATAAGTTTGAATTGGG + Intronic
951589854 3:24252581-24252603 GTGTTTAAGAAGTGAGATTGTGG - Intronic
951958056 3:28279634-28279656 CAGTTTTAGAATTTATATTTGGG - Intronic
951992313 3:28689044-28689066 CAGCTTAAGGAGGGAGATTTTGG + Intergenic
952643994 3:35634042-35634064 CAGGCCAAGAAGTTAGAATTCGG - Intergenic
953309953 3:41867194-41867216 CAGTTTAAGAAGCTAGAAAAAGG - Intronic
953763543 3:45714428-45714450 TAATTTAAAAAGTTAGACTTAGG + Intronic
953892292 3:46760870-46760892 CATTTTTAGAAGTTTGATTTGGG - Intronic
954029635 3:47809542-47809564 TACTTTAAGAAGTTACATTCCGG - Intronic
954181150 3:48882260-48882282 AACTTTAAGAAGTTGGATTTGGG - Intronic
954589436 3:51768830-51768852 AATTTTAAGGAGTTAGATGTGGG + Intergenic
956113344 3:65893737-65893759 TAGTTTAAGCCGTTATATTTTGG - Intronic
957546502 3:81644827-81644849 CAGTTGAAGCAGCCAGATTTGGG + Intronic
957638718 3:82820699-82820721 CACTTTAAGAATGTAAATTTTGG + Intergenic
957889542 3:86338266-86338288 CAGTTAAATAATTTAGAGTTTGG - Intergenic
959426844 3:106200621-106200643 CAAATTAAGAAGTAAGATCTGGG - Intergenic
959780221 3:110223114-110223136 CAGTTTAAGATGGCAGATTGTGG - Intergenic
959865473 3:111264614-111264636 CAGTTTTAGAACTTATGTTTAGG - Intronic
960041353 3:113152725-113152747 CAGTTTTAGAATTAAGAGTTGGG - Intergenic
960335816 3:116416408-116416430 CAGTTTAAGATACTACATTTGGG + Intronic
960900794 3:122552218-122552240 TATCTTAAGAAGTTTGATTTAGG - Intronic
961320855 3:126074145-126074167 CACTTTAAAAAGTTAGCTTTGGG + Intronic
961615763 3:128179522-128179544 AAGTTTTAAAAGTTTGATTTGGG + Intronic
963130110 3:141850061-141850083 CATTTTAAAAATTTAAATTTTGG + Intergenic
963927495 3:150966382-150966404 CAGTTTAAGAAGTTAGATTTAGG + Intronic
964225480 3:154395242-154395264 CAAGTTAAGAAGGCAGATTTTGG + Intronic
964743851 3:159993242-159993264 CTACTTCAGAAGTTAGATTTGGG + Intronic
966332708 3:178833098-178833120 CAGTTTATGAAGTCAGAATGAGG - Intronic
966905102 3:184517020-184517042 CACCATAAAAAGTTAGATTTCGG + Intronic
967276717 3:187783113-187783135 CAGTCTAAGAAGTCAGATAAAGG + Intergenic
968251521 3:197220619-197220641 CAGTTTAAGAAAGGAGTTTTTGG + Intronic
968281482 3:197480265-197480287 CAGTTGTAGAGGTTAGATGTTGG + Intergenic
970313595 4:14808373-14808395 TAGTTTTAGATGTTTGATTTTGG - Intergenic
972544595 4:40068438-40068460 AAGTTTAAGGTCTTAGATTTAGG + Intronic
972746709 4:41940512-41940534 CAGTATAAGAACTTGAATTTAGG + Intronic
973331753 4:48916280-48916302 CAATATAAGAAGTAAGATTTTGG - Intergenic
974228037 4:59073684-59073706 CACTTTTAGAAGTTTCATTTGGG - Intergenic
974322783 4:60373437-60373459 CAGTTTTAGGACTTACATTTAGG + Intergenic
974478199 4:62410226-62410248 AAGTTTCAGAAGTTAGAGTTGGG + Intergenic
974695299 4:65360415-65360437 CTGTTTAAGAGTTTGGATTTTGG + Intronic
975115085 4:70671235-70671257 CATGTGAAGAAGTTAGATCTTGG + Intronic
975292988 4:72698670-72698692 GAGTTTGAGAAGTTGGTTTTGGG + Intergenic
975556263 4:75668478-75668500 AATTATAAGAAGGTAGATTTGGG + Intronic
975975923 4:80096744-80096766 CAGTTTAGCAAGAAAGATTTGGG + Intronic
976514788 4:85953026-85953048 CTGTTCAAGAAGATACATTTTGG + Intronic
976679215 4:87736448-87736470 CAGTTTAGGAAGTTACACTTTGG + Intergenic
976997372 4:91451688-91451710 CAGCTTTAGAAATTAAATTTGGG - Intronic
977129449 4:93217215-93217237 TAGTTTAATAATTTAGAGTTTGG - Intronic
977937573 4:102825377-102825399 CAGTTTAAGAGTTTGAATTTAGG + Intronic
979658947 4:123230220-123230242 CAGTTTTAAAAGTTATATTGTGG - Intronic
980418018 4:132518963-132518985 TCGTTTAAGAATTAAGATTTGGG - Intergenic
980816247 4:137950422-137950444 CAGATAAAGAATTTAGATTCTGG - Intergenic
981105762 4:140878876-140878898 CAGTTTCAGGTCTTAGATTTAGG + Intronic
981164339 4:141539786-141539808 AATTTTAAGAAGGTAGATATTGG + Intergenic
982343079 4:154325070-154325092 CAGTCTAAGAAGTGATACTTTGG - Intronic
982916700 4:161219564-161219586 CAGTTTAAGATTTTAAGTTTTGG - Intergenic
982999261 4:162391286-162391308 CAGTATAAGTAATTAAATTTTGG - Intergenic
983074585 4:163310327-163310349 CAGATTAATAAGTGAGACTTTGG + Intergenic
983116471 4:163823392-163823414 CAGTTTATTAGGTTTGATTTGGG - Intronic
983160325 4:164405574-164405596 CAGGTTAAGAAATGAGAATTTGG - Intergenic
983735532 4:171054057-171054079 CATTTTAAGATGTCAGAATTTGG + Intergenic
983767474 4:171503193-171503215 ATGTTTAAGAAGTTAGGTATAGG + Intergenic
984067275 4:175063405-175063427 CAGCTTAAGAAGTTCAGTTTGGG - Intergenic
984110427 4:175606191-175606213 AAGCTGTAGAAGTTAGATTTTGG + Intergenic
985410467 4:189678604-189678626 CACCTTAAGATGTAAGATTTAGG - Intergenic
985566682 5:622072-622094 CAGTTTAAAATGTTAGAATTTGG - Intronic
986858250 5:11897450-11897472 CAGTATAAATAATTAGATTTTGG - Intronic
987615137 5:20263695-20263717 AAGTTTAATAAGGTAGCTTTAGG + Intronic
989475871 5:41871775-41871797 CATTTTAAGAAGTTGGATTGGGG + Intergenic
989552615 5:42753547-42753569 AAAATTAAGAAGTTAGAGTTAGG + Intergenic
990159601 5:52923106-52923128 AATTTTAAGGAGTTAGATGTGGG + Intronic
991213697 5:64136540-64136562 CATCTCTAGAAGTTAGATTTTGG + Intergenic
992225416 5:74615510-74615532 CAGTTTTGGAAGTGAGGTTTGGG - Intergenic
992877801 5:81075171-81075193 CAGTATAAGTAGTTGGATTCTGG + Intronic
993258290 5:85621893-85621915 CAATCTAAGGAGTTAAATTTTGG + Intergenic
993276162 5:85861659-85861681 CAGTTTAAGAAATTTTACTTAGG - Intergenic
995396760 5:111695196-111695218 GAGATTAAGAAATTAGATGTAGG - Intronic
995440348 5:112184862-112184884 CACTTTAAGAATCCAGATTTGGG - Intronic
998652519 5:144136868-144136890 ATGTTTAAGAACATAGATTTTGG + Intergenic
999930292 5:156425068-156425090 GAGTTTGGGAAGTTGGATTTTGG - Intronic
1000114928 5:158145008-158145030 CAGTGAAAGAAGCTTGATTTTGG + Intergenic
1001766137 5:174248603-174248625 GAGTTTAAGAAGTATCATTTAGG + Intergenic
1003151620 6:3556543-3556565 CAGTTTTAGTACTTACATTTAGG - Intergenic
1005944658 6:30586506-30586528 CTCTTTAAGAACTTGGATTTTGG + Exonic
1006235262 6:32625393-32625415 AAGTTTAAGACATTAGATTTAGG - Intergenic
1006605512 6:35254048-35254070 CAGTTCTAGAAGTGTGATTTTGG - Intergenic
1006759778 6:36449859-36449881 CTGTTTAAGAAGTTATGTGTTGG + Intronic
1007364753 6:41383546-41383568 CAGCTTAGGAAGGGAGATTTGGG + Intergenic
1008180315 6:48320217-48320239 TATTTTAAGAATTTAGTTTTTGG - Intergenic
1008224499 6:48897510-48897532 ACTTTTAGGAAGTTAGATTTTGG - Intergenic
1008592521 6:53008730-53008752 CAGCTTAAGAAGTCAAACTTTGG - Intronic
1008721995 6:54365685-54365707 CATTTTAATGAGTTATATTTTGG + Intronic
1009034307 6:58097933-58097955 CAGCTTAAAAAGTTTAATTTGGG - Intergenic
1009209911 6:60849637-60849659 CAGCTTAAAAAGTTTAATTTGGG - Intergenic
1009425736 6:63511662-63511684 AATTTTAATACGTTAGATTTGGG - Intergenic
1009442341 6:63696034-63696056 AAGTTTCAGATTTTAGATTTGGG - Intronic
1010806878 6:80247594-80247616 CTGTTTTAGAAATAAGATTTTGG - Intronic
1011330082 6:86194814-86194836 CAGTTTCAGATGTTACATTTAGG - Intergenic
1013217080 6:108037463-108037485 CATTTTAAAAAGTAAGACTTTGG + Intergenic
1014076713 6:117244126-117244148 CATTTTAAGAGATTAGATTTTGG - Intergenic
1014361611 6:120483693-120483715 CTGTTTTATAAGTTAGATTATGG + Intergenic
1014575199 6:123060872-123060894 GTGTTTAAGAAACTAGATTTCGG - Intronic
1015968867 6:138723348-138723370 CAGTGCAAGATGTTAGATTATGG + Intergenic
1015991506 6:138949424-138949446 CATTTTAAGAAGTTTTATTGTGG + Intronic
1016484280 6:144518929-144518951 CTGTTTCAGGAATTAGATTTGGG - Intronic
1016629358 6:146210255-146210277 CAGTTCAAGAACATAGATTTAGG - Intronic
1016694905 6:146981703-146981725 CAGATTAAGAAGTTTGACTCTGG + Intergenic
1017352411 6:153458286-153458308 CAGCTCAAGAAGTTTAATTTGGG + Intergenic
1018622963 6:165749685-165749707 AAGTTTAAAAAATTAGATTGGGG - Intronic
1020489103 7:8757074-8757096 CAGTTTAAAAAGTCAGTTTCTGG - Intergenic
1020687843 7:11317664-11317686 CAATTTCACAAGTTAGAATTTGG - Intergenic
1021102338 7:16598366-16598388 AACTTTAAGGAGTTAGATGTTGG - Intergenic
1021644758 7:22778175-22778197 CATTTTGAGAAAATAGATTTAGG + Intergenic
1022304183 7:29130928-29130950 CAGTTTCAGAAATTACTTTTTGG + Intronic
1024534644 7:50420144-50420166 GTGTGTAAGAAGTTACATTTTGG + Intergenic
1030684898 7:112475802-112475824 CAGTGTAAGAAATTAAACTTTGG - Exonic
1031502171 7:122532114-122532136 CATTGCAAAAAGTTAGATTTGGG + Intronic
1031624735 7:123979151-123979173 AAGTTTAACAATTTAGAATTAGG - Intergenic
1032187435 7:129739106-129739128 CAGATTTAGATGTTAGGTTTTGG - Intronic
1032211488 7:129918590-129918612 AATTTTAAGAATTTGGATTTTGG - Intronic
1032776517 7:135119531-135119553 CATTTTCAGAAGTTAAATTTTGG - Intronic
1034646984 7:152656435-152656457 AAGTTGAAGTAGTAAGATTTAGG - Intronic
1036963837 8:13274919-13274941 AAGTTTAAGATGTAAGATTTGGG - Intronic
1037012247 8:13857769-13857791 CAGTTTAATCTGTTACATTTAGG - Intergenic
1039818701 8:41117472-41117494 CATTTCAAAAAGTTGGATTTTGG - Intergenic
1041198784 8:55429244-55429266 TTGTATAAGAAGTGAGATTTAGG - Intronic
1041594133 8:59626506-59626528 TAATTTAAAAAGTTATATTTGGG + Intergenic
1041775838 8:61522131-61522153 CAATTTAAAAAGTTATTTTTGGG + Intronic
1042037981 8:64558272-64558294 CAATATAAGAAGTAAGATGTGGG - Intergenic
1043538547 8:81232992-81233014 CAGTTCCAGAAGTCAGAATTTGG - Intergenic
1043925594 8:86032474-86032496 CAATTTTGGAAGATAGATTTGGG + Intronic
1044160280 8:88905101-88905123 CAGTTTGAGGTCTTAGATTTAGG - Intergenic
1044917121 8:97127034-97127056 TAGTTTAAGATTTTACATTTAGG - Intronic
1045067027 8:98458055-98458077 CACTTAAAGAACTAAGATTTAGG - Intronic
1046051536 8:109028789-109028811 CAGTTTAAGAATAAAGAGTTGGG + Intergenic
1046274161 8:111935388-111935410 CAGATTAATAAATTAGGTTTTGG - Intergenic
1046926595 8:119796655-119796677 CAGTTTATAAGGTAAGATTTTGG - Intronic
1047163123 8:122404273-122404295 CAGTTTAAAAAGTTATAATTGGG - Intergenic
1047310967 8:123691660-123691682 CAGTTTAAGAAGTCAGCTTTAGG - Intronic
1049701318 8:144014515-144014537 CTGTTTAAGAAGCTAGACTCTGG + Intronic
1050210915 9:3255151-3255173 CAGTTTAAGAAATAAGAATATGG + Intronic
1050522518 9:6516132-6516154 CAGTTTAAAAAATTATGTTTGGG - Intergenic
1053620302 9:39808311-39808333 GAGGTTAAGAGGTTAGATTGGGG - Intergenic
1053626395 9:39875623-39875645 GAGGTTAAGAGGTTAGATTGGGG + Intergenic
1054217493 9:62375078-62375100 GAGGTTAAGAGGTTAGATTGGGG - Intergenic
1054263852 9:62899132-62899154 GAGGTTAAGAGGTTAGATTGGGG + Intergenic
1054824145 9:69554439-69554461 TACTTGAAGAAGTTAGATATAGG + Intronic
1055148084 9:72960350-72960372 CAGTTTAAGAAGTTAAAATCTGG - Intronic
1055235831 9:74122242-74122264 CAGCTTAATAAATTAGTTTTTGG + Intergenic
1055810835 9:80145872-80145894 CAGTGGTAAAAGTTAGATTTTGG + Intergenic
1056945249 9:90989537-90989559 CACTTTAAAAAAATAGATTTAGG + Intergenic
1058406091 9:104675717-104675739 GAGTCCAAGCAGTTAGATTTGGG - Intergenic
1058855295 9:109056086-109056108 CAGTTTTAGATGTTATCTTTTGG - Intronic
1059067164 9:111097477-111097499 CAGTTAAAGATTTTAGGTTTTGG - Intergenic
1059185604 9:112267440-112267462 CATTTTAAGAAGGTGGTTTTTGG - Intronic
1059191956 9:112334557-112334579 CAGTTTAGGGGGTTACATTTTGG - Intergenic
1060081164 9:120647005-120647027 CATTTTATTAAGTTAGTTTTAGG - Intronic
1060143607 9:121232154-121232176 CATTATAACAAGTTAGGTTTGGG - Intronic
1060351120 9:122861188-122861210 CCTTTTAAGAAGTCAAATTTCGG + Intronic
1203672292 Un_KI270755v1:26821-26843 CACCTTAAGATGTAAGATTTAGG + Intergenic
1186725913 X:12358574-12358596 CACCTTAAGAACTGAGATTTTGG - Intronic
1186745331 X:12562108-12562130 CAGTTTAATAATTATGATTTAGG + Intronic
1186780865 X:12910730-12910752 CAATTTCAGAAGAAAGATTTGGG + Intronic
1186788986 X:12978678-12978700 CAGTTGAAGAAGGAACATTTAGG + Intergenic
1187841877 X:23497370-23497392 CAGTTGAAGATGTCATATTTTGG + Intergenic
1188261326 X:28028056-28028078 CAATCTAAGAAAATAGATTTTGG + Intergenic
1188273071 X:28166479-28166501 CAGTTTAAGTACCTAGATTCTGG + Intergenic
1188534532 X:31181925-31181947 CAGTTTCAGAATTAGGATTTAGG + Intronic
1188812116 X:34663323-34663345 AAGTTGAATTAGTTAGATTTCGG + Intergenic
1191596837 X:62954045-62954067 CAGTTTAAGGAGATTGTTTTAGG - Intergenic
1191917735 X:66220792-66220814 CAGTTTTTGAAGTAAGATTAAGG - Intronic
1192290673 X:69791477-69791499 GTGATTAAGAAGATAGATTTTGG - Intronic
1192300892 X:69901422-69901444 CAGGTTAAGAAGATAGATGGAGG + Intronic
1192489872 X:71566634-71566656 CAGTTCAAGAAGAGAGATTTGGG + Intronic
1192506435 X:71687234-71687256 GAGTCTTAGAAGTCAGATTTGGG + Intergenic
1192520262 X:71794313-71794335 GAGTCTTAGAAGTCAGATTTGGG - Intergenic
1192745911 X:73938510-73938532 TAGTTTAAGCATTTACATTTAGG - Intergenic
1193741178 X:85219413-85219435 TAGTTAATGAAGTTAGATATTGG - Intergenic
1194123111 X:89984797-89984819 TAGTTTTAGAACTTACATTTAGG + Intergenic
1194282077 X:91965735-91965757 CACTTTAAGAAGTTAAACATTGG + Intronic
1194428421 X:93769502-93769524 CATCTTTAGAAGTTTGATTTTGG + Intergenic
1195303198 X:103552603-103552625 CAGTTTTAGGAGTTAAACTTAGG - Intergenic
1197446820 X:126560935-126560957 TTGTTTAAGAAGTGAGGTTTGGG - Intergenic
1198243810 X:134809463-134809485 TAGTTTAAGAAGTAAGATTTAGG - Intronic
1198248306 X:134853415-134853437 CATTTTTAGAAGTGAGATTTTGG + Intronic
1198397586 X:136236124-136236146 CAGTCTAAGAAGGAATATTTTGG + Intronic
1198578210 X:138034502-138034524 CAGATTAAAAATTAAGATTTGGG + Intergenic
1198646920 X:138818398-138818420 CAATTGAAGGAGATAGATTTGGG - Intronic
1198817421 X:140607202-140607224 CTGTATAAGATGTGAGATTTAGG + Intergenic
1199674830 X:150179582-150179604 CATTTTTAGAAGTTCAATTTGGG + Intergenic
1199969490 X:152848971-152848993 CAGGTTGGGAAGTTAGTTTTGGG + Intronic
1200475969 Y:3642243-3642265 TAGTTTTAGAACTTACATTTAGG + Intergenic
1200599673 Y:5190396-5190418 CACTTTAAGAAGTTAAACATTGG + Intronic
1200683498 Y:6240661-6240683 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1200686087 Y:6261271-6261293 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1200691624 Y:6310691-6310713 AAGTTTAAGAAGTTGGAATAGGG - Intergenic
1200991623 Y:9352519-9352541 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1200994279 Y:9372795-9372817 AAGTTTAAGAAGTTGGAATAGGG + Intronic
1200996943 Y:9393135-9393157 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1200999458 Y:9461687-9461709 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1201002113 Y:9481993-9482015 AAGTTTAAGAAGTTGGAATAGGG + Intronic
1201004778 Y:9502279-9502301 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1201007431 Y:9522605-9522627 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1201043648 Y:9864033-9864055 AAGTTTAAGAAGTTGGAATAGGG + Intergenic
1201049136 Y:9913724-9913746 AAGTTTAAGAAGTTGGAATAGGG - Intergenic
1201580727 Y:15509711-15509733 CAGTATAAGATGTCATATTTTGG - Intergenic
1201791160 Y:17841809-17841831 CAGGTTTAGCTGTTAGATTTAGG + Intergenic
1201810394 Y:18064180-18064202 CAGGTTTAGCTGTTAGATTTAGG - Intergenic
1201855206 Y:18534074-18534096 CAGGATTAGAAGTTAGGTTTGGG + Intergenic
1201878115 Y:18786310-18786332 CAGGATTAGAAGTTAGGTTTGGG - Intronic
1202037545 Y:20649692-20649714 CAGTTTTTGAAGTAAGATTGAGG + Intergenic
1202352769 Y:24011457-24011479 CAGGTTTAGCTGTTAGATTTAGG + Intergenic
1202518010 Y:25658658-25658680 CAGGTTTAGCTGTTAGATTTAGG - Intergenic