ID: 963927542

View in Genome Browser
Species Human (GRCh38)
Location 3:150966914-150966936
Sequence CTCTGTGATCTATACAACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963927542 Original CRISPR CTCTGTGATCTATACAACGA GGG (reversed) Intronic
903698311 1:25226226-25226248 CTCTTTGATCTGTACAGTGAAGG - Intronic
906772171 1:48494920-48494942 CTCTGTTCTCCATACAACAAGGG + Intergenic
908839437 1:68263774-68263796 CTCTGTGATTTAAACAAACAAGG + Intergenic
909746734 1:79107142-79107164 CTCTGTTATCTATAGAAATATGG + Intergenic
921170101 1:212539459-212539481 CTCTGTGATCTTTACATAGCTGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1062806357 10:422713-422735 CTCTGTGCTCTTTCCACCGAGGG + Intronic
1062862212 10:819523-819545 CTCTGTAATCAATACAACACTGG + Intronic
1088756770 11:112891477-112891499 CTCTCTGATCAATAAAACAAAGG + Intergenic
1092699362 12:11210203-11210225 CTTTATGATCTTTACAAGGAAGG + Intergenic
1092809154 12:12256082-12256104 CTTTCTGATTTATAAAACGAAGG + Intronic
1093293900 12:17364300-17364322 CTCTGTCCTCTAAACAATGATGG - Intergenic
1094225130 12:28036689-28036711 TTCTGAGATCTACACAATGATGG + Intergenic
1111933434 13:94535232-94535254 CTCTGTGATACATACAACTGAGG - Intergenic
1115187957 14:30713702-30713724 CTCTTAGATCTATACAATGGAGG - Intronic
1120594193 14:86413907-86413929 CTCTATAATCTATACAACTGTGG - Intergenic
1121292056 14:92783906-92783928 CTCTGTGCTCTATAAAAGAAAGG + Intergenic
1121957668 14:98228872-98228894 CTCTCTGATCAACACAAAGAAGG + Intergenic
1123463867 15:20499165-20499187 CTCATTTATCCATACAACGAAGG - Intergenic
1123654196 15:22501263-22501285 CTCATTTATCCATACAACGAAGG + Intergenic
1124308103 15:28596459-28596481 CTCATTTATCCATACAACGAAGG + Intergenic
1133427011 16:5701421-5701443 CTCTGTGATCTCTACAAAGCTGG - Intergenic
1134427004 16:14159260-14159282 CTCTGTGTTCTAGACTACCAAGG - Intronic
1139136863 16:64215323-64215345 CTCTGTGATCTGTACAAGATTGG + Intergenic
1139309686 16:66018024-66018046 CTCTGTGAAATATTTAACGAAGG - Intergenic
1147475187 17:40704564-40704586 CTCTTTTATCTTTAAAACGAAGG - Intergenic
1150838615 17:68587239-68587261 CTCTGTGAGCTGTACAGCCAAGG - Intronic
1154219359 18:12438535-12438557 CTCTTTGACCTATTCAAAGATGG + Intergenic
1155869388 18:31006728-31006750 CTCTGTTATATATAAAATGAAGG - Intronic
1161747365 19:6069264-6069286 CTATGTTATCTATACATTGATGG - Intronic
1162787866 19:13046849-13046871 CTCTGTGATTTAGACCAAGAAGG - Intronic
1167417271 19:49381507-49381529 CTCTCTGATATATACACAGAGGG + Intergenic
927154846 2:20215600-20215622 CTCTGTGCTCTAGGCAAGGAAGG + Intronic
937248177 2:120507170-120507192 CTCTGTTATCTGTAAAACGGGGG - Intergenic
937302331 2:120850915-120850937 CTATCTGATCTATATAAGGAAGG - Intronic
937516603 2:122662523-122662545 CTCTGTGATCTAGCCAACACAGG - Intergenic
942588057 2:177508237-177508259 GTCTGTGATCCAAAGAACGAAGG + Intronic
944990513 2:205230123-205230145 CTTTGTGCTCTATACCACTACGG + Intronic
946549119 2:220780848-220780870 CTCTGAGATCCATACAACCTTGG + Intergenic
1171120445 20:22563936-22563958 CTTTGCTATCTATACAACGTTGG - Intergenic
1175461553 20:59155514-59155536 CTCTGTGATCTTTAGAATGAGGG + Intergenic
1177560059 21:22739237-22739259 CTCTTTGTTCCATACAAGGAAGG - Intergenic
1178066518 21:28909946-28909968 ATCTGTGATATAAACAACAACGG + Intergenic
1179123500 21:38570525-38570547 CACTGTGATCTATAAAATGAGGG - Intronic
1181783919 22:25212213-25212235 CTCTCTGCTCCATACAACTACGG - Intergenic
1183255737 22:36760715-36760737 GTCTGTCATCTATACAACACAGG + Intronic
951441945 3:22733487-22733509 CTCTGTGACCTCCACAAGGAAGG - Intergenic
952184195 3:30951157-30951179 TTCTGTGATCTTTATAAAGAAGG + Intergenic
953428785 3:42819610-42819632 CTCTGTGGGCAATACAAAGAAGG - Exonic
955527727 3:59838314-59838336 CTCTGCCATCTAGACAATGAAGG - Intronic
958622823 3:96583673-96583695 CTATGTGGTCTATAAAAAGATGG - Intergenic
960011831 3:112842072-112842094 CTCAGTGATCTAGACACAGAAGG + Intronic
963927542 3:150966914-150966936 CTCTGTGATCTATACAACGAGGG - Intronic
967806602 3:193719679-193719701 CTCTGTGTACTATTCAAGGATGG - Intergenic
972064202 4:34919311-34919333 CTTTGTGATCTTTGCAACGATGG + Intergenic
976013098 4:80516396-80516418 TTCTGTGGGCTATACAAGGATGG + Intronic
978360118 4:107922572-107922594 CAATGTGATATATACAACAATGG + Intergenic
982322831 4:154097539-154097561 ATGTGTGATCTCTAAAACGAAGG + Intergenic
984576996 4:181462376-181462398 CTCTGTGTTCTATACCAGTAAGG + Intergenic
985697116 5:1346830-1346852 CTCTGTGATCTTTCCCAAGATGG - Intergenic
987638190 5:20574585-20574607 ATCTGTGACCTATAAAACTAAGG + Intronic
990174770 5:53095333-53095355 CTCTGCCATCTGTACAGCGATGG - Intergenic
999826252 5:155276323-155276345 CTCTGTGATCTCTGCAGAGAAGG - Intergenic
1011163340 6:84417875-84417897 CTCTGTGATTTAAAAAACTATGG - Intergenic
1034080322 7:148271205-148271227 CTCCTTATTCTATACAACGAGGG - Intronic
1034616836 7:152425179-152425201 CTCAGTTATCTATAAAATGAGGG + Intronic
1037782106 8:21876905-21876927 CTCTCTCATCTGTAAAACGAGGG - Intergenic
1039926492 8:41938217-41938239 CTCTGACATCTATAGAATGAAGG - Intronic
1040122611 8:43699848-43699870 CTCTGGGACTTATACAAGGAAGG - Intergenic
1042769234 8:72361059-72361081 CTATCTGATCTATACACCAAAGG + Intergenic
1042794178 8:72642436-72642458 CTCTGTGTTCTTTATAATGATGG - Intronic
1047195742 8:122719798-122719820 CTCTGTGAACTATAAAATGACGG + Intergenic
1059586086 9:115608176-115608198 TTTTGTGATCTATAAAATGAAGG + Intergenic
1060077734 9:120608417-120608439 ATCTGTCATCTATAAAAAGAAGG - Intronic
1062171609 9:135137865-135137887 CCCTATGATCTATACCACGAGGG - Intergenic
1187024601 X:15421055-15421077 ATCTGTGATCTATATAGTGAGGG + Intronic
1187413529 X:19072027-19072049 CTCTTTCATCTGTAGAACGAGGG - Intronic
1187927669 X:24264750-24264772 CTCTGTGATTTGTTCAACCAAGG + Intergenic
1188571840 X:31596261-31596283 CTCTAAGATTTATACAAAGAAGG + Intronic
1189220273 X:39365836-39365858 CTCTGTGATACATACAACCTTGG + Intergenic
1189630560 X:42948102-42948124 CTCTGTGACCAATACAAAGTAGG + Intergenic
1195401782 X:104468575-104468597 CTCTGTAATCTGTGCAAAGAGGG + Intergenic
1197669293 X:129258357-129258379 CTTTGTGATCTTTAGAATGATGG + Intergenic