ID: 963932843

View in Genome Browser
Species Human (GRCh38)
Location 3:151022149-151022171
Sequence CTGGGAGACCTAGAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963932843_963932848 -6 Left 963932843 3:151022149-151022171 CCAACTTCCTCTAGGTCTCCCAG No data
Right 963932848 3:151022166-151022188 TCCCAGGAGCCAGGGAGATGTGG No data
963932843_963932853 8 Left 963932843 3:151022149-151022171 CCAACTTCCTCTAGGTCTCCCAG No data
Right 963932853 3:151022180-151022202 GAGATGTGGCACACTCATGTGGG No data
963932843_963932852 7 Left 963932843 3:151022149-151022171 CCAACTTCCTCTAGGTCTCCCAG No data
Right 963932852 3:151022179-151022201 GGAGATGTGGCACACTCATGTGG No data
963932843_963932854 15 Left 963932843 3:151022149-151022171 CCAACTTCCTCTAGGTCTCCCAG No data
Right 963932854 3:151022187-151022209 GGCACACTCATGTGGGATTGAGG No data
963932843_963932855 16 Left 963932843 3:151022149-151022171 CCAACTTCCTCTAGGTCTCCCAG No data
Right 963932855 3:151022188-151022210 GCACACTCATGTGGGATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963932843 Original CRISPR CTGGGAGACCTAGAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr