ID: 963940437

View in Genome Browser
Species Human (GRCh38)
Location 3:151091379-151091401
Sequence TCTAAGATTCAGTAGGTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 953
Summary {0: 1, 1: 2, 2: 18, 3: 188, 4: 744}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963940432_963940437 10 Left 963940432 3:151091346-151091368 CCCTGAAGGCTGGTTGAAACAGA 0: 1
1: 0
2: 1
3: 39
4: 285
Right 963940437 3:151091379-151091401 TCTAAGATTCAGTAGGTCTGAGG 0: 1
1: 2
2: 18
3: 188
4: 744
963940433_963940437 9 Left 963940433 3:151091347-151091369 CCTGAAGGCTGGTTGAAACAGAT 0: 1
1: 0
2: 2
3: 16
4: 147
Right 963940437 3:151091379-151091401 TCTAAGATTCAGTAGGTCTGAGG 0: 1
1: 2
2: 18
3: 188
4: 744

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963940437 Original CRISPR TCTAAGATTCAGTAGGTCTG AGG Intronic
900723744 1:4200327-4200349 TGTAAGTTTCAGTAGGTTTTTGG - Intergenic
901587518 1:10310260-10310282 TTTCTGATTCACTAGGTCTGGGG + Intronic
902182039 1:14696708-14696730 TTTCTGATTCAGCAGGTCTGGGG + Intronic
902186136 1:14726789-14726811 TTTCTGATTCAGCAGGTCTGGGG - Intronic
902212550 1:14914144-14914166 TTTCTGATTCAGGAGGTCTGGGG + Intronic
902586810 1:17444510-17444532 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
903008197 1:20312188-20312210 ACTCAGATTCAGTAGCTCTGGGG - Intronic
903488634 1:23710433-23710455 TCTCTGATTCAGTAAATCTGGGG + Intergenic
903573519 1:24323310-24323332 TTTCTGATTCAGTAGGTCTAGGG - Intronic
903759034 1:25684936-25684958 TTTTTGATTCAGCAGGTCTGGGG - Intronic
903813504 1:26047497-26047519 TCCAGGATTCAGTAGGTCTGGGG + Intergenic
903860815 1:26363456-26363478 TTTTTGATTCAGCAGGTCTGGGG - Intronic
904494501 1:30879035-30879057 TCAGTGGTTCAGTAGGTCTGGGG + Intronic
904683615 1:32245654-32245676 TTTCAGATTCAGTATGTATGGGG - Intergenic
904844315 1:33397371-33397393 ATTCAGATTCAGCAGGTCTGGGG - Intronic
904976316 1:34459668-34459690 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
905091201 1:35432765-35432787 TTTCTAATTCAGTAGGTCTGGGG - Intergenic
905461397 1:38125212-38125234 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
905556414 1:38888748-38888770 TTTCTGGTTCAGTAGGTCTGGGG - Intronic
905588470 1:39141315-39141337 GTTCTGATTCAGTAGGTCTGGGG + Intronic
905839123 1:41159122-41159144 AATAAAATTCAGTAGATCTGTGG - Intronic
906124493 1:43419346-43419368 GTTAAAATGCAGTAGGTCTGGGG - Intronic
907233788 1:53025930-53025952 TCTATAATACAGTAGGTGTGGGG - Intronic
907284373 1:53370641-53370663 TCTAAGAATCAGTCTGTCTGAGG - Intergenic
907399123 1:54213658-54213680 TTTCTGATTCAGCAGGTCTGGGG - Intronic
907553974 1:55328740-55328762 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
907634906 1:56124658-56124680 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
907724998 1:57011580-57011602 TCTGTGATTCAGTAGATCTGGGG - Intronic
907936362 1:59045848-59045870 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
907942792 1:59105519-59105541 GATAAGATTCAGGAGGTCTGAGG - Intergenic
908078327 1:60545546-60545568 TTTAATATTCTCTAGGTCTGCGG - Intergenic
908098336 1:60763885-60763907 TCTAAGAGTCAGATGTTCTGAGG + Intergenic
908197160 1:61756421-61756443 TTACTGATTCAGTAGGTCTGAGG - Intronic
908436180 1:64108989-64109011 ACTGTGATTCAGTAGCTCTGGGG - Intronic
908443283 1:64177078-64177100 ATGCAGATTCAGTAGGTCTGAGG + Intronic
909347891 1:74614083-74614105 TTTCTGATTCAGTACGTCTGTGG + Intronic
909430805 1:75585509-75585531 TTTCTGATTCAGTAGGTCTGAGG + Intronic
909490649 1:76222512-76222534 TCTAATATTCAGTATGTATAAGG + Intronic
909569040 1:77087377-77087399 ATTCTGATTCAGTAGGTCTGAGG + Intergenic
909600859 1:77459566-77459588 TTTCTGATTCAATAGGTCTGAGG + Intronic
909688353 1:78376624-78376646 AGTAAAATTTAGTAGGTCTGTGG + Intronic
910060943 1:83090760-83090782 GTTTTGATTCAGTAGGTCTGGGG + Intergenic
910728812 1:90368044-90368066 ACTCAGATTCAGTAAGTCTGTGG + Intergenic
910806585 1:91194428-91194450 TTTCTGATTCAGTAGGTCTAGGG - Intergenic
911477591 1:98392363-98392385 TTTCAAATTCAGTAGGTATGGGG + Intergenic
911478560 1:98405963-98405985 TTGAAAATTCAGTATGTCTGAGG + Intergenic
911659023 1:100478910-100478932 TCTCTGATTCAGCAGGTCTGAGG + Intronic
911698658 1:100924925-100924947 TCTACGATTAAGTAGGTGAGAGG - Intronic
912208929 1:107537579-107537601 TCTCTGATTCAGTAGGTCTGGGG - Intergenic
912324046 1:108741047-108741069 TTTCTGATTCAATAGGTCTGTGG - Intronic
913062210 1:115218918-115218940 ATTCAGATTCAGTAGGTCTGGGG + Intergenic
913070831 1:115297159-115297181 TTTCTGATTCAGTAGGTTTGTGG - Intronic
913318642 1:117573838-117573860 TTTCTAATTCAGTAGGTCTGAGG + Intergenic
913400382 1:118425345-118425367 ACTCTGATTCAGTAGGTCTAGGG + Intergenic
913439954 1:118886744-118886766 TCTCTGATTCTGTAAGTCTGGGG + Intronic
914390423 1:147216791-147216813 GTTCTGATTCAGTAGGTCTGAGG - Intronic
915458615 1:156056034-156056056 TGTAAGATTTATTAGGGCTGGGG - Intronic
916007508 1:160675624-160675646 ACTTTGAATCAGTAGGTCTGGGG - Intergenic
916196911 1:162233116-162233138 TTTCTGCTTCAGTAGGTCTGAGG + Intronic
916213026 1:162373772-162373794 TTTCTGATTCAGTAGGTCTGAGG + Exonic
917057332 1:170997470-170997492 ATTCTGATTCAGTAGGTCTGAGG - Intronic
917510824 1:175668013-175668035 CCTCTGATTCAGTAGATCTGGGG - Intronic
917640925 1:176982471-176982493 TGTCTGATTCAGTAGGTCTGGGG + Intronic
917772572 1:178295669-178295691 TTTCTGATGCAGTAGGTCTGGGG + Intronic
917795744 1:178531733-178531755 ATTCTGATTCAGTAGGTCTGGGG - Intronic
917924806 1:179780603-179780625 TTTCTGATTCAGCAGGTCTGGGG - Intronic
918264058 1:182823478-182823500 TCTTAGCTTCACTTGGTCTGAGG - Intronic
918455618 1:184709993-184710015 CTTAAGATTCAGTAGCTCTTTGG + Intronic
918468092 1:184842314-184842336 TTTCTGATTCAATAGGTCTGGGG + Intronic
918474822 1:184912931-184912953 TTTCTGATTCAGTAGGCCTGGGG - Intronic
918858023 1:189783652-189783674 TTTTTGATTCAGTAGGTTTGGGG + Intergenic
919167671 1:193916524-193916546 TCTAAAATTTAGTCAGTCTGAGG - Intergenic
919780936 1:201220654-201220676 ACCCTGATTCAGTAGGTCTGGGG - Intronic
920086325 1:203420366-203420388 CCAAAGATTCAGGAGCTCTGAGG - Intergenic
920243208 1:204568825-204568847 TCTGAGATTCAGGAATTCTGGGG + Intergenic
921286265 1:213612151-213612173 ATTCAGATTCAGTAGGTCTGGGG - Intergenic
921424131 1:214982872-214982894 TTTCTGATTCAGTAGGTCTGAGG - Intergenic
921834013 1:219759453-219759475 TTTCAGATTAAGTATGTCTGGGG - Intronic
921863770 1:220067051-220067073 ATTTTGATTCAGTAGGTCTGGGG + Intronic
922033086 1:221823300-221823322 TTTCTGATTCAGTAGGTCTTGGG + Intergenic
922063054 1:222109902-222109924 TTTCAGATTCAGTAGGTCTGGGG - Intergenic
922307717 1:224358371-224358393 TCTGAGTTTTAGTAGGTTTGGGG + Intronic
922408300 1:225341995-225342017 GTTCAGATTCAGTAAGTCTGTGG - Intronic
923124168 1:231021054-231021076 ACTCTGATTCAGTGGGTCTGGGG + Intronic
923607899 1:235461345-235461367 CTAAAGATTCAGTAGGTCTGGGG + Intronic
923815076 1:237368590-237368612 ATTTTGATTCAGTAGGTCTGGGG - Intronic
924154913 1:241165967-241165989 TCTCAGATTCAGTAGATCTGAGG - Intronic
924612460 1:245585148-245585170 TTTCTGATTCAGTGGGTCTGGGG - Intronic
924737720 1:246773484-246773506 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1063480993 10:6376312-6376334 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
1063547583 10:6997421-6997443 ACTTAGATTCAGTAGGTATGGGG + Intergenic
1063797653 10:9531296-9531318 TTTCAAATTCAGCAGGTCTGTGG - Intergenic
1064423986 10:15213967-15213989 TCATACATTCAGTGGGTCTGCGG + Exonic
1064460409 10:15529586-15529608 CCAAATATTCAGTAGGTCTGGGG - Intronic
1064818517 10:19295853-19295875 TTTCTGATTTAGTAGGTCTGGGG + Intronic
1065308837 10:24394958-24394980 TTTCTGATTCAGTAGGTCTAGGG + Intronic
1065315403 10:24459015-24459037 TGTCTGATTCAGTAGGTCTCGGG - Intronic
1065409509 10:25408551-25408573 TCAAGGATTCAGAAGGTCTGAGG - Intronic
1065636437 10:27741006-27741028 TTTCGGATTCAGCAGGTCTGGGG - Intronic
1065779306 10:29151912-29151934 GTTCAGATTCAGTGGGTCTGGGG + Intergenic
1066112530 10:32210115-32210137 TGTCCGCTTCAGTAGGTCTGAGG - Intergenic
1066125643 10:32339268-32339290 TGTAAGATGCAGTAGGCCTATGG - Intronic
1066317961 10:34267838-34267860 ATTTTGATTCAGTAGGTCTGAGG - Intronic
1067176762 10:43955490-43955512 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
1067674057 10:48354570-48354592 TGTAAGATTCAGTAGGTCTGGGG + Intronic
1067740477 10:48891678-48891700 TTTCTAATTCAGTAGGTCTGGGG + Intronic
1067743903 10:48918961-48918983 TGTCAGATTCAGTTGGTCAGTGG - Intronic
1067938679 10:50634011-50634033 TTTCTGATTCAGTAGGTCCGGGG - Intergenic
1067974303 10:51006902-51006924 GTTCTGATTCAGTAGGTCTGGGG + Intronic
1068020213 10:51572642-51572664 CCAGAGTTTCAGTAGGTCTGGGG - Intronic
1068811647 10:61261787-61261809 TTTAAGAGTAAGTAGGTCAGGGG + Intergenic
1069271953 10:66539824-66539846 GCTCTGATTCAGTAGGTCTGGGG - Intronic
1069539238 10:69281221-69281243 TTTTCCATTCAGTAGGTCTGTGG + Intronic
1070225553 10:74500478-74500500 TTTCTGATTCAGTAAGTCTGGGG + Intronic
1070324172 10:75377078-75377100 TCTCTTATTCAGTAGGTCTGGGG - Intergenic
1070501174 10:77073743-77073765 TTTCTGATTCAGTAGATCTGGGG + Intronic
1070644081 10:78189386-78189408 TTTCTGATTCAGTAGATCTGGGG - Intergenic
1070804373 10:79262282-79262304 TTTCTGATTCAGTGGGTCTGGGG - Intronic
1070829031 10:79407507-79407529 TCTCAGAATCAATAGGTCTGGGG + Intronic
1070935154 10:80288344-80288366 TTTCTGATTCAGTAGGTCTTGGG - Intronic
1071886646 10:89958517-89958539 GATCTGATTCAGTAGGTCTGGGG - Intergenic
1072026322 10:91462553-91462575 TTTCAGATTCAGTAGGTCTTGGG + Intronic
1072109541 10:92305543-92305565 TTTCTGATTCTGTAGGTCTGGGG + Intronic
1072479129 10:95793618-95793640 TTTCTGATTCAGTAAGTCTGAGG - Intronic
1072487792 10:95873074-95873096 TAAATAATTCAGTAGGTCTGGGG + Exonic
1072499390 10:95997727-95997749 TTTCTAATTCAGTAGGTCTGGGG + Intronic
1072989542 10:100178600-100178622 TTTCTGATTCAATAGGTCTGGGG - Intronic
1074011619 10:109487659-109487681 GCTTTGATTGAGTAGGTCTGGGG + Intergenic
1074167598 10:110898074-110898096 TCTTATATTCAGTAGCTCTCTGG - Exonic
1074310844 10:112322065-112322087 TTTCTGACTCAGTAGGTCTGGGG - Intergenic
1074685131 10:115954910-115954932 TTTCTCATTCAGTAGGTCTGGGG + Intergenic
1075437379 10:122455052-122455074 TTTCTGATTCAATAGGTCTGGGG - Intronic
1078370735 11:10742627-10742649 TTTCTGATTCAGTAGGTATGGGG - Intergenic
1078655669 11:13236492-13236514 ATTATGATTCAGTAGGTCTGGGG + Intergenic
1078949590 11:16115305-16115327 TTTCTGATTCAGTAGGTATGGGG - Intronic
1078949609 11:16115475-16115497 TCTTTGAATCAGTAGATCTGAGG + Intronic
1079015753 11:16867255-16867277 TCTCTGATTCAGTAGGCCTGGGG + Intronic
1079909074 11:26286605-26286627 GTTAAGATTCAGTAGGTCTGGGG + Intergenic
1079989440 11:27231478-27231500 TCTCTGATTAAGTAAGTCTGGGG + Intergenic
1080612358 11:33915529-33915551 AGTTTGATTCAGTAGGTCTGGGG + Intergenic
1080629983 11:34065464-34065486 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1080757378 11:35215087-35215109 TTCCTGATTCAGTAGGTCTGGGG + Intronic
1080873103 11:36253973-36253995 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
1081277424 11:41166924-41166946 TCTAAGCTTCAGTTTGTATGGGG - Intronic
1081641607 11:44759371-44759393 TTCCAGAGTCAGTAGGTCTGAGG - Intronic
1082842430 11:57700172-57700194 TCTAAAATGCAGTAGGCTTGGGG + Exonic
1083097304 11:60264804-60264826 TGTCTGATTCAATAGGTCTGGGG + Intergenic
1083184501 11:61009293-61009315 ATTCTGATTCAGTAGGTCTGAGG + Intronic
1083977804 11:66138042-66138064 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1084069676 11:66726364-66726386 TTTACGATTCAGTACTTCTGGGG + Intronic
1084925938 11:72511250-72511272 GCTAGGATTCTGGAGGTCTGTGG + Intergenic
1084955283 11:72687952-72687974 TCTGTGATTCAGTAGGAATGGGG + Intronic
1085617954 11:78016004-78016026 ATTCTGATTCAGTAGGTCTGAGG + Exonic
1085916998 11:80902472-80902494 TTTTTGATTCAGTAGGTCTGGGG + Intergenic
1085997645 11:81939812-81939834 TCTAAAATTCAGGAGATTTGGGG - Intergenic
1086259980 11:84927892-84927914 TTTTTGATTCAGTAGGTCTGGGG - Intronic
1086446510 11:86876626-86876648 ACTCTGATTCAGTAGGTCTGTGG - Intronic
1086482772 11:87260878-87260900 ATTAAGATTCAGTAGGTCTGGGG + Intronic
1087971046 11:104484568-104484590 ATTTTGATTCAGTAGGTCTGGGG - Intergenic
1087991889 11:104754468-104754490 TGCATGATTCAGTAGGTGTGGGG + Intergenic
1088001706 11:104889586-104889608 TTTCTTATTCAGTAGGTCTGGGG - Intergenic
1088230746 11:107671317-107671339 ATTATCATTCAGTAGGTCTGGGG - Intergenic
1088527871 11:110776188-110776210 TCTCAGATACAGTACGTCTTAGG - Intergenic
1088567664 11:111189873-111189895 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1089154032 11:116386776-116386798 TTTCTGACTCAGTAGGTCTGGGG + Intergenic
1089412734 11:118260456-118260478 TTTCTAATTCAGTAGGTCTGGGG - Intronic
1089951601 11:122533375-122533397 ACTCTGATTCAGTAGATCTGGGG + Intergenic
1090344182 11:126054677-126054699 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1090479361 11:127054630-127054652 ATTCTGATTCAGTAGGTCTGAGG - Intergenic
1091228202 11:133970807-133970829 GCTGTGATTCAGCAGGTCTGGGG - Intergenic
1091960311 12:4688669-4688691 ACTCTGATTCAGTAGGTCTGGGG - Exonic
1092234381 12:6797083-6797105 TTTCTGATTCAGCAGGTCTGGGG + Intronic
1092661454 12:10742948-10742970 TTTCCGATTCACTAGGTCTGGGG - Intergenic
1093162759 12:15768027-15768049 TCTAATATTCTGTAAGTCTTTGG - Intronic
1093315193 12:17640731-17640753 TTTAAGATTCATTCTGTCTGAGG - Intergenic
1093365379 12:18289641-18289663 TTTCTGATTCAGTAGATCTGTGG - Intronic
1094175747 12:27539053-27539075 TCTAAGTATCAGTAGTGCTGAGG + Intronic
1094255903 12:28425814-28425836 TTTTTGATACAGTAGGTCTGGGG - Intronic
1094697930 12:32840127-32840149 TTTCTGATTCAGAAGGTCTGGGG + Intronic
1095659234 12:44709712-44709734 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1096585539 12:52617385-52617407 TCTCTGATTCAGTTGCTCTGGGG + Intronic
1096908654 12:54960659-54960681 ACTGTGATTCATTAGGTCTGGGG + Intronic
1097283015 12:57857004-57857026 TTTCTGATTCAGTAGGTGTGAGG - Intergenic
1097972602 12:65650579-65650601 TTTTTGATTCAGTAAGTCTGGGG - Intergenic
1098114551 12:67161251-67161273 TTTCTGATTCAGTAGGTTTGTGG + Intergenic
1098301265 12:69056310-69056332 TCCAAGATTTCCTAGGTCTGAGG - Intergenic
1098326939 12:69312774-69312796 TTTCAGATGCAGTAGGTCTTGGG - Intergenic
1099277625 12:80597776-80597798 TTTTTGATTCAGTAAGTCTGGGG + Intronic
1099543383 12:83944279-83944301 TTTCTGATTCAGCAGGTCTGGGG + Intergenic
1099937034 12:89138667-89138689 TTTCAGATTCAGTAAGCCTGGGG - Intergenic
1100064791 12:90629066-90629088 TTTATGATTAAGTAGGTATGAGG - Intergenic
1100559555 12:95734377-95734399 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1100611098 12:96193161-96193183 TCCCAGATTCAGTAGGTCGGGGG - Intergenic
1100789974 12:98119742-98119764 TCTCTGATTCAGCAGGTCAGGGG + Intergenic
1101400043 12:104379300-104379322 TTTCTCATTCAGTAGGTCTGGGG + Intergenic
1101540815 12:105663549-105663571 TCTCAGATTCAGTATGCCTGGGG + Intergenic
1101760220 12:107652229-107652251 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1102922714 12:116804314-116804336 TTTCTGAATCAGTAGGTCTGGGG - Intronic
1102977616 12:117217870-117217892 TTTCAGATCCAGCAGGTCTGGGG + Intronic
1103290328 12:119840354-119840376 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1103618486 12:122170912-122170934 CTTCCGATTCAGTAGGTCTGGGG + Intronic
1104036443 12:125100708-125100730 TGTCCGATTCATTAGGTCTGGGG + Intronic
1104423547 12:128656622-128656644 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1104427444 12:128689842-128689864 TCTCAGATTCAGCAGGTCTGGGG - Intronic
1105054205 12:133081914-133081936 TTTCTGATTCAGAAGGTCTGGGG - Intronic
1105495734 13:20929247-20929269 TCTAAATTTTAGTAGGTCTATGG - Intergenic
1105622165 13:22078818-22078840 TCTAAGATTCTGTGAGTCTATGG + Intergenic
1105796681 13:23861003-23861025 TTTTTGATTCAGTGGGTCTGAGG + Intronic
1105904794 13:24796680-24796702 CCTGAGATTCAGGAGGCCTGTGG + Intronic
1106114837 13:26808428-26808450 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
1106478364 13:30117210-30117232 TTTCAGATTCAGTAGTTCTGGGG - Intergenic
1106506780 13:30377256-30377278 TTTCTGATTCAGCAGGTCTGGGG - Intergenic
1106527831 13:30558821-30558843 TTTCTGATTCAGTGGGTCTGGGG - Intronic
1106708012 13:32302063-32302085 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1106949152 13:34863412-34863434 TTTCTGATTCAGTAGATCTGTGG + Intergenic
1107095485 13:36530762-36530784 TATCTGATTGAGTAGGTCTGGGG + Intergenic
1107261343 13:38494989-38495011 AATATGATTCAGTAGGTTTGGGG - Intergenic
1107317523 13:39149804-39149826 ACTTGGATTCAGTAGGTCTATGG - Intergenic
1107594833 13:41952163-41952185 TTTCTAATTCAGTAGGTCTGAGG - Intronic
1108117553 13:47146087-47146109 ATTCCGATTCAGTAGGTCTGGGG + Intergenic
1108225109 13:48281308-48281330 TTTCTGATTCAGCAGGTCTGGGG + Intergenic
1108460478 13:50662301-50662323 TCTAAGCTTCAGTTCTTCTGAGG + Intronic
1108674941 13:52728441-52728463 TTTCCCATTCAGTAGGTCTGGGG + Intronic
1109018980 13:57060398-57060420 TCTAAGAGAAAGAAGGTCTGGGG - Intergenic
1109116637 13:58396738-58396760 TCTAAGATTCAGTGGCTCTGTGG - Intergenic
1109204368 13:59465406-59465428 ATTCAGATTCAGTGGGTCTGGGG - Intergenic
1109218107 13:59613366-59613388 TATCTGATTCAGTAGGTCTGGGG + Intergenic
1109478843 13:62920379-62920401 TTTGTGATTCAGTAGATCTGGGG - Intergenic
1109513792 13:63414450-63414472 TTTCTGATTCAGTAGGCCTGAGG + Intergenic
1110370253 13:74731895-74731917 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1110422821 13:75332606-75332628 TTTCTGATTAAGTAGGTCTGGGG + Intronic
1110648554 13:77917755-77917777 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1111684434 13:91485058-91485080 ACTCTGATTCAGTAGTTCTGGGG - Intronic
1111804947 13:93029364-93029386 TCTCTAATTCAGTAGGTCTGGGG + Intergenic
1111888667 13:94054429-94054451 TTTCTAATTCAGTAGGTCTGGGG + Intronic
1111958041 13:94779678-94779700 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1111981395 13:95019354-95019376 TTTCTGATTCAGTAGATCTGCGG + Intergenic
1113333740 13:109357744-109357766 TTTCTGATTCACTAGGTCTGGGG + Intergenic
1115301149 14:31886972-31886994 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
1115316977 14:32035235-32035257 ATTCAGATTCAGTTGGTCTGGGG - Intergenic
1116334281 14:43637649-43637671 ATTTGGATTCAGTAGGTCTGAGG + Intergenic
1116868447 14:50050087-50050109 GCTCTGATTCAGTAGGGCTGGGG - Intergenic
1116934902 14:50729829-50729851 TCCAAGTTTCAGTGGGTCTGGGG - Intronic
1117012702 14:51487040-51487062 TTTCTGATGCAGTAGGTCTGGGG - Intergenic
1117045772 14:51811640-51811662 ACTCTGATTCAGTAGGTCTAGGG + Intergenic
1117210278 14:53490314-53490336 TCTAATATTTGGTAGTTCTGAGG + Intergenic
1117759934 14:59015846-59015868 TTTAGGATTCAGGAGGTGTGTGG + Intergenic
1117762885 14:59050741-59050763 CCTAAGATTGAGTAAGTTTGGGG - Intergenic
1118001480 14:61527356-61527378 TCTTAAATCCAGTAGGTTTGTGG - Intronic
1118626990 14:67668766-67668788 TTTCTGATTCAATAGGTCTGGGG + Intronic
1118998248 14:70857238-70857260 ATTTTGATTCAGTAGGTCTGGGG - Intergenic
1119131826 14:72179821-72179843 TTTTTGATTCAGTAGGTCTGGGG - Intronic
1119661201 14:76453044-76453066 TCTCAGATTCAGTAGGTCTGGGG - Intronic
1119893472 14:78200479-78200501 TGTCAGATTCAGGAAGTCTGGGG - Intergenic
1120472283 14:84940662-84940684 TTTCTGATTCATTAGGTCTGAGG + Intergenic
1120895910 14:89532066-89532088 TTTCTGATTCAGGAGGTCTGGGG - Intronic
1121134576 14:91484649-91484671 TTTTTGATCCAGTAGGTCTGGGG + Intronic
1121179954 14:91921558-91921580 TTTCTGACTCAGTAGGTCTGGGG - Intronic
1121205234 14:92159366-92159388 TCTAAAACTAAGTGGGTCTGTGG + Intronic
1121331628 14:93053248-93053270 TCTCTGAACCAGTAGGTCTGAGG - Intronic
1121838308 14:97111922-97111944 TCTCTGATTCAGTAGGTCTCAGG - Intergenic
1124019765 15:25909605-25909627 CCTGGGATTCAGTAGGTCTGGGG - Intergenic
1124256285 15:28145331-28145353 TCTAAGATCCTGTAGATCTTAGG - Intronic
1124815156 15:32982830-32982852 CCTGAGATTCAGGAGGGCTGGGG - Intronic
1124914641 15:33957963-33957985 TTTCAGATTTAGTAGATCTGGGG - Intronic
1125599365 15:40906971-40906993 TCGAAGAATCAGTAGGGCTGGGG - Intergenic
1125983845 15:44029772-44029794 ATTCCGATTCAGTAGGTCTGGGG + Intronic
1126048701 15:44668143-44668165 TCAGTCATTCAGTAGGTCTGGGG - Intronic
1126168348 15:45672953-45672975 TTTCTGATTCAGTAGGTCTAGGG + Intronic
1126356585 15:47802384-47802406 ACTCTGATTCAGGAGGTCTGGGG + Intergenic
1126375503 15:47992912-47992934 TTTCTGATTCAATAGGTCTGGGG + Intergenic
1126393805 15:48190195-48190217 ACTCTGATTCAGTAGGTGTGGGG - Intergenic
1126415258 15:48411695-48411717 TTTCTGATTCAGTAGTTCTGGGG - Intronic
1126437981 15:48655368-48655390 ATGCAGATTCAGTAGGTCTGAGG + Intergenic
1126646609 15:50881316-50881338 TTTCTGCTTCAGTAGGTCTGGGG + Intergenic
1126734694 15:51719048-51719070 ATTCATATTCAGTAGGTCTGGGG - Intronic
1126808651 15:52378848-52378870 TTTCTGATTCAGTAGGTCTGAGG - Intronic
1127386094 15:58468388-58468410 TTTCTGATTCATTAGGTCTGGGG - Intronic
1127455225 15:59150824-59150846 TTTCTGATTCTGTAGGTCTGGGG - Intronic
1127499484 15:59543228-59543250 TTTTGGATTCCGTAGGTCTGCGG - Intergenic
1127619106 15:60716089-60716111 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1127620994 15:60734262-60734284 TTTCTGATTCAGTAGGACTGGGG - Intronic
1127634870 15:60859442-60859464 ATTCAGATTCAGTAAGTCTGGGG - Intronic
1127738347 15:61869827-61869849 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1128287227 15:66447347-66447369 GTTCTGATTCAGTAGGTCTGGGG + Intronic
1128804956 15:70523824-70523846 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1129448375 15:75634730-75634752 TTTCTGATTCAGGAGGTCTGGGG - Intergenic
1129486997 15:75883668-75883690 TTTCTGATTCAGTAGGTCTGTGG + Intronic
1129618026 15:77115222-77115244 TTTAACATTCAGCAGGACTGTGG - Exonic
1129623879 15:77176484-77176506 TTTTTTATTCAGTAGGTCTGGGG - Intronic
1129626008 15:77200488-77200510 ATTATGATTCAGTAGGTCTGGGG - Intronic
1130072412 15:80658876-80658898 GTTCTGATTCAGTAGGTCTGGGG - Intergenic
1130434814 15:83887111-83887133 TTTCTGACTCAGTAGGTCTGTGG - Intronic
1130505218 15:84533911-84533933 TTTCAGATTCAGTAGGTCTGTGG - Intergenic
1131156013 15:90076035-90076057 TTTCTGATTCAGTAGATCTGGGG + Intronic
1131428415 15:92366456-92366478 AATCCGATTCAGTAGGTCTGGGG + Intergenic
1131446482 15:92502209-92502231 TTTCTGATTCAGCAGGTCTGGGG + Intergenic
1131538772 15:93258704-93258726 TCTCTAATTCAGTATGTCTGGGG + Intergenic
1131576112 15:93592955-93592977 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1131643714 15:94319481-94319503 TCTCTGATTCAGTGTGTCTGGGG + Intronic
1132034624 15:98472148-98472170 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1132286255 15:100665257-100665279 TCTAAGATCCAGGAGGTCTCAGG - Intergenic
1132796994 16:1729520-1729542 TCCAAGATGCAGCAGGTCGGAGG + Exonic
1133486302 16:6222637-6222659 TCAGTGATTCAGTAGGTCTTGGG + Intronic
1133966012 16:10532177-10532199 ACTCTGATTCTGTAGGTCTGGGG + Exonic
1134801790 16:17091403-17091425 ATTTTGATTCAGTAGGTCTGGGG + Intergenic
1135018924 16:18947385-18947407 CCTCAGATTCAGCAGCTCTGGGG + Intergenic
1135490071 16:22901420-22901442 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1135649391 16:24192780-24192802 TGTCTGATTCAGGAGGTCTGGGG - Intronic
1135833572 16:25801058-25801080 TTTATGATTCAGTAGGGTTGGGG + Intronic
1135981139 16:27148356-27148378 ACTAAGATTCAGTCAGTTTGTGG - Intergenic
1137923952 16:52521786-52521808 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1138238560 16:55407102-55407124 AATATGATTTAGTAGGTCTGGGG + Intronic
1138645158 16:58419304-58419326 TGGAGGACTCAGTAGGTCTGGGG - Intergenic
1139172418 16:64647977-64647999 GCTAGGATTCTGGAGGTCTGTGG - Intergenic
1140077738 16:71717850-71717872 TCTAAGATTTAGAAGGTCAGTGG - Intronic
1140134844 16:72196976-72196998 ACTCTGACTCAGTAGGTCTGAGG + Intergenic
1140580263 16:76223200-76223222 TCTAAGAATAGGGAGGTCTGTGG + Intergenic
1140733231 16:77874971-77874993 TCTTTGATCCTGTAGGTCTGTGG - Intronic
1141004825 16:80342221-80342243 ATTCAGATTCAATAGGTCTGGGG - Intergenic
1141048361 16:80737718-80737740 TTTCCGATTCAGTAGGTCTGGGG + Intronic
1141237077 16:82228658-82228680 CGTATGATTCAGTAGGTCTGGGG + Intergenic
1141240894 16:82264270-82264292 TTTCTGATTCAGTAGATCTGGGG - Intergenic
1141327244 16:83072801-83072823 ACTCTGATTCAGTAGATCTGGGG - Intronic
1141335320 16:83149111-83149133 TCCAAGATACAGTAGTTCTATGG + Intronic
1141879738 16:86849932-86849954 TCTCTGATTCAGCAGGTCTAGGG - Intergenic
1142908761 17:3069088-3069110 TCTGAGAATAAGGAGGTCTGAGG + Intergenic
1142925806 17:3235157-3235179 TCTGAGAATAAGGAGGTCTGAGG - Intergenic
1143311024 17:5989336-5989358 TTTCTGATTCAGTAGGTCTGTGG - Intronic
1143351225 17:6289683-6289705 CTTCTGATTCAGTAGGTCTGAGG - Intergenic
1143444728 17:7000781-7000803 TTTCTGATTCAGTATGTCTGGGG + Intronic
1143877102 17:10000211-10000233 TTTCTGATTTAGTAGGTCTGGGG + Intronic
1143902267 17:10183229-10183251 ATTTGGATTCAGTAGGTCTGGGG - Intronic
1143970051 17:10788965-10788987 TTTCTGATTAAGTAGGTCTGCGG + Intergenic
1143970639 17:10792706-10792728 ATTCAGATTCAGTAGGTCTGGGG - Intergenic
1144024655 17:11267338-11267360 CTTCAGATTCAGTAGGTTTGAGG - Intronic
1144366191 17:14547205-14547227 TTTCTGATTCAGTAGCTCTGGGG + Intergenic
1144394536 17:14831399-14831421 TTTCTGATTCTGTAGGTCTGGGG + Intergenic
1144637625 17:16920361-16920383 TTTCTGATTCAGCAGGTCTGTGG + Intergenic
1146314390 17:31795760-31795782 ATTCAGATTCAGTGGGTCTGGGG - Intergenic
1146719504 17:35113830-35113852 TTTCTGATTCAGTAGGTCTTGGG - Intronic
1146909564 17:36639843-36639865 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1147900905 17:43783626-43783648 TATAAGATTCAGTCAGTATGCGG + Intronic
1148479114 17:47948618-47948640 GGTCAGATTCAGTGGGTCTGGGG - Intergenic
1148539325 17:48467234-48467256 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1149332116 17:55594838-55594860 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1149462101 17:56837243-56837265 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1149910592 17:60563505-60563527 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1150998739 17:70349632-70349654 TCTCTGATTTAGTAGGTCTGTGG + Intergenic
1151035490 17:70793749-70793771 TTTCACATTCAGTAGATCTGGGG + Intergenic
1151413349 17:73945828-73945850 TTTCTGATTCAGTAGTTCTGGGG - Intergenic
1151557313 17:74852993-74853015 ATTCAGATTCAGTTGGTCTGGGG - Intronic
1152922124 17:83071357-83071379 TCTCAGAGTCAGGAGGGCTGGGG + Intergenic
1152993709 18:386454-386476 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1153101436 18:1474756-1474778 GTTTGGATTCAGTAGGTCTGGGG + Intergenic
1153340397 18:3967469-3967491 TCTGGGATTCAGTAGGTCTGGGG - Intronic
1154336681 18:13471506-13471528 CCTGAGATTCAGAAGGTCTGGGG + Intronic
1155300280 18:24422889-24422911 ATGCAGATTCAGTAGGTCTGAGG + Intergenic
1155656699 18:28201227-28201249 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1155879505 18:31126338-31126360 ACTCTGATTCAATAGGTCTGAGG + Intergenic
1156318036 18:35989384-35989406 CTTCTGATTCAGTAGGTCTGGGG - Intronic
1156386780 18:36612231-36612253 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1156576640 18:38324624-38324646 TCTTAGGATCAGTAGGTCTGGGG - Intergenic
1157021939 18:43793457-43793479 ACTTTGATTCAGTAAGTCTGGGG - Intergenic
1157108088 18:44793523-44793545 TCTCTAATTCAGTATGTCTGGGG - Intronic
1157239498 18:45996384-45996406 TTTCTGATTCGGTAGGTCTGAGG + Intronic
1158681558 18:59571842-59571864 TTGCAGATTCAGTAGGTCTTGGG - Intronic
1159011572 18:63063300-63063322 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1159143385 18:64424225-64424247 TTTCTGATTCAATAGGTCTGGGG + Intergenic
1161990994 19:7684158-7684180 CCTCAGATTCAGCAGCTCTGGGG - Exonic
1163272916 19:16264987-16265009 TATATGATTCAGTGGGTTTGGGG + Intergenic
1164702445 19:30295471-30295493 TTTCAGATTCAGAAGGTCTTGGG + Intronic
1164784260 19:30917236-30917258 GCCAAGCTTCAGTTGGTCTGAGG - Intergenic
1165168079 19:33871166-33871188 TTTCTGATTCAGTAGGTCTGCGG + Intergenic
1165310525 19:35026873-35026895 TTTCTGGTTCAGTAGGTCTGGGG + Intergenic
1166164290 19:40976317-40976339 TTTCTGATTTAGTAGGTCTGGGG + Intergenic
1166186492 19:41142709-41142731 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1166202087 19:41244246-41244268 TCTAAGATCCAATGGCTCTGAGG - Intronic
1167220172 19:48194212-48194234 TTTCAGACTCAGTGGGTCTGAGG + Intronic
1168083360 19:54026920-54026942 TGACTGATTCAGTAGGTCTGGGG - Intergenic
1168178905 19:54646208-54646230 TTTAAGTTTCAGTAGTTTTGGGG - Intronic
1168445572 19:56409432-56409454 ACCATGATTCAGGAGGTCTGGGG - Intronic
925561950 2:5205630-5205652 TCTCAGATTCAGTAGATCTAGGG + Intergenic
926976937 2:18524925-18524947 TGTCTGATTCAGCAGGTCTGGGG - Intergenic
927274226 2:21248290-21248312 TTTCTGATTCAGTATGTCTGAGG + Intergenic
927719802 2:25375351-25375373 TCTCGGATTCAGCAGGTCTTGGG - Intergenic
928258883 2:29749195-29749217 TTTCTGATTCAGTAGGTCTGGGG + Intronic
929038265 2:37718021-37718043 CTTCTGATTCAGTAGGTCTGGGG - Intronic
929174612 2:38963748-38963770 ATTCTGATTCAGTAGGTCTGGGG - Intronic
929419575 2:41777176-41777198 TTTCTGATTCAGTAAGTCTGAGG - Intergenic
929752453 2:44729876-44729898 TTTCCGATTCAGCAGGTCTGAGG - Intronic
929979236 2:46663470-46663492 TTTCTGATTCAGTTGGTCTGGGG + Intergenic
929985639 2:46728989-46729011 TTTCTGATTCAGTAGATCTGAGG - Intronic
930107973 2:47654946-47654968 GCTCTGATTCAGTAGGCCTGGGG + Intergenic
930169133 2:48233172-48233194 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
930527951 2:52554814-52554836 TTTTTGATTTAGTAGGTCTGAGG - Intergenic
930579482 2:53193293-53193315 ACTTTGATTCAGTAGGTCTATGG - Intergenic
930802192 2:55454359-55454381 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
931243338 2:60471852-60471874 TTTCTGATTCAGTAAGTCTGAGG - Intronic
931288841 2:60854900-60854922 TCCATGATTGAGTAGGTCTGGGG + Intergenic
931381562 2:61758144-61758166 TTATTGATTCAGTAGGTCTGGGG + Intergenic
931629445 2:64285696-64285718 ACTCAGAGTCAGGAGGTCTGGGG + Intergenic
931745299 2:65286680-65286702 TTTAAGATTATTTAGGTCTGTGG - Intergenic
931936842 2:67207848-67207870 AATCTGATTCAGTAGGTCTGGGG - Intergenic
932631399 2:73346324-73346346 TTTTTGATTCAGTAGTTCTGGGG - Intergenic
932734440 2:74244751-74244773 TTTCCGATTCAGCAGGTCTGGGG + Intronic
932896292 2:75643840-75643862 TTTTAAATTCAGTAAGTCTGGGG + Intergenic
933200236 2:79439636-79439658 ATTCAGATTCAGTAAGTCTGGGG + Intronic
933200248 2:79439791-79439813 TTTTGGATTTAGTAGGTCTGGGG - Intronic
933219672 2:79674071-79674093 TTTCTGATTCAGTAGGTCTGGGG + Intronic
933319689 2:80757851-80757873 GCTAGGATTCTGGAGGTCTGTGG + Intergenic
933843381 2:86305587-86305609 TGTCTGATTCAGCAGGTCTGAGG + Intronic
934046126 2:88173853-88173875 ATTCTGATTCAGTAGGTCTGGGG + Intronic
934578917 2:95422659-95422681 TTTGTGATTCAGTAGGTCTTAGG + Intergenic
934600530 2:95654044-95654066 TTTGTGATTCAGTAGGTCTTAGG - Intergenic
935057321 2:99578892-99578914 TCTGGGATTCAGCAGGGCTGGGG + Intronic
935719070 2:105963901-105963923 TCTAAGATTCTGTGTTTCTGAGG - Intergenic
935727630 2:106037596-106037618 TCTCTGATCCAGGAGGTCTGGGG + Intergenic
935787278 2:106560566-106560588 TCCTTGATTCAGTAGGTCTGGGG + Intergenic
936628853 2:114178344-114178366 ATTCTGATTCAGTAGGTCTGAGG + Intergenic
936658509 2:114516067-114516089 TCTCTGATTCAGTGGATCTGAGG + Intronic
936730012 2:115370797-115370819 TTTCTGATTCAGTAGGTTTGGGG + Intronic
937011132 2:118563704-118563726 TTTTTGATTCAGTAGGTCTGGGG + Intergenic
937294698 2:120802917-120802939 ACTCAGATTCAGTAGGTCTAAGG - Intronic
937890891 2:126937825-126937847 TTTCTGATTCAGAAGGTCTGTGG - Intergenic
938403925 2:131016715-131016737 TTTCTGATTCAGTGGGTCTGGGG + Intronic
938566556 2:132524011-132524033 TTTCTGATTCAGCAGGTCTGGGG - Intronic
938670526 2:133582247-133582269 TCCCTGATGCAGTAGGTCTGGGG - Intergenic
938672201 2:133597264-133597286 TCTCTGATTCAGTAGGTCTGGGG - Intergenic
938771867 2:134507475-134507497 TTTCTGATTCAGTAGGTCTGGGG - Intronic
938831510 2:135054197-135054219 TTTCTGATTCTGTAGGTCTGAGG + Intronic
938921833 2:136002288-136002310 TTTCTGATTCAGTAGGTCTGTGG - Intergenic
940018482 2:149131909-149131931 TCTAAGATTCTGTGGTTCTGTGG - Intronic
940446097 2:153778965-153778987 TCTAAAATTCACTAGCTGTGTGG + Intergenic
941432198 2:165426566-165426588 TTTCTGATTTAGTAGGTCTGAGG - Intergenic
941498029 2:166231508-166231530 TTTCTGACTCAGTAGGTCTGGGG + Intronic
941740879 2:169033785-169033807 TTTCTGATTCAGTAGGTCTCAGG - Intergenic
942106925 2:172642513-172642535 TTTGTGATTCAGTAGGTCTGGGG - Intergenic
942499963 2:176579082-176579104 TCCAAGATGCAGTAAGTCTGAGG - Intergenic
943015973 2:182511446-182511468 GCTAGGATTCTGGAGGTCTGTGG - Intronic
943057726 2:183004162-183004184 ATTCAGATTCAGTAGATCTGAGG - Intronic
943481871 2:188429200-188429222 TTTAAGATTCAGTAGGAGTTGGG + Intronic
943598355 2:189884783-189884805 TCTCTGATTAAGTAGGTCTGGGG + Intronic
943617488 2:190109997-190110019 CTTCTGATTCAGTAGGTCTGGGG + Intronic
943736878 2:191365971-191365993 TGTTTGATTCAGTGGGTCTGGGG + Intronic
943755593 2:191553771-191553793 TTTCTGATTCAATAGGTCTGGGG - Intergenic
943759612 2:191593585-191593607 ATTCAGATTCAGTAGATCTGTGG + Intergenic
944658992 2:201904737-201904759 TTCCAGATTCAGTAGGTCTGAGG - Intergenic
944795520 2:203180608-203180630 TTTAAGATTCATTCTGTCTGTGG + Intronic
944845505 2:203664113-203664135 TTTTTGATTTAGTAGGTCTGAGG + Intergenic
945010844 2:205461730-205461752 TTTCTGATTCAATAGGTCTGGGG + Intronic
945235875 2:207630872-207630894 TATAACATTGAATAGGTCTGAGG - Intergenic
945250359 2:207760839-207760861 ATTGAGATTCAGTAGCTCTGGGG - Intronic
945412479 2:209527784-209527806 TTTCTGATTCACTAGGTCTGGGG - Intronic
945661964 2:212697526-212697548 TTTCTGATTCAGTAGCTCTGGGG + Intergenic
946548831 2:220777744-220777766 TTTCCGATTCAGTAAGTCTGGGG + Intergenic
947834951 2:233168768-233168790 TTTCAGATTCAGTAGGTCTGGGG + Intronic
947908102 2:233780365-233780387 TTTCTGATTCAGTAAGTCTGGGG + Intronic
948052195 2:234987142-234987164 TTTCTGATTCTGTAGGTCTGGGG - Intronic
948165499 2:235858498-235858520 TTTAAGATGCAGTAGGTTAGGGG + Intronic
1169542420 20:6614480-6614502 TTTCAGATTCAGTAGATCTGGGG - Intergenic
1169558804 20:6776617-6776639 GCTCTGATTCAGTAGGTCTGGGG - Intronic
1169727275 20:8749183-8749205 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1169782110 20:9320851-9320873 TTTCTGATTCTGTAGGTCTGGGG - Intronic
1169959045 20:11138453-11138475 TCTCAAATACAGTAGCTCTGCGG + Intergenic
1170393742 20:15903562-15903584 TCTCTGATTCAGTAGGTTTGGGG + Intronic
1170409067 20:16068771-16068793 CATCTGATTCAGTAGGTCTGAGG - Intergenic
1170468662 20:16646433-16646455 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1170634792 20:18094757-18094779 TCTCTGATTCATTAGGTCTCAGG + Intergenic
1170898548 20:20437885-20437907 TCTGAGACTCTGTAGGTATGGGG - Intronic
1171135087 20:22688476-22688498 TCTCTGATTTAGCAGGTCTGGGG - Intergenic
1172367352 20:34360225-34360247 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1172672919 20:36646611-36646633 GCTCTGATTCAGAAGGTCTGGGG + Intergenic
1172893580 20:38284019-38284041 TCCTTGATTTAGTAGGTCTGGGG - Intronic
1173063489 20:39684406-39684428 TCAGAGTTTCTGTAGGTCTGTGG - Intergenic
1173191398 20:40879044-40879066 TTTAAATTTCAGTAGGTTTGGGG - Intergenic
1173245697 20:41335956-41335978 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1173339118 20:42138101-42138123 TTTCTGATTCAGTAAGTCTGGGG + Intronic
1173344940 20:42190641-42190663 TTTTGGGTTCAGTAGGTCTGAGG + Intronic
1173436847 20:43041023-43041045 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1173551041 20:43933430-43933452 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1173576844 20:44117601-44117623 TTTCTGATTCAGTAGGTCTCAGG - Intronic
1173885837 20:46458079-46458101 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1174262339 20:49305691-49305713 TTTCTAATTCAGTAGGTCTGGGG - Intergenic
1174658740 20:52192381-52192403 TTTCTGCTTCAGTAGGTCTGGGG + Intronic
1174683144 20:52427549-52427571 TTTATGACTCAGTAGGTCTGGGG - Intergenic
1174685631 20:52452389-52452411 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1174732836 20:52934947-52934969 TTTCTGACTCAGTAGGTCTGGGG + Intergenic
1174741787 20:53021322-53021344 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1174794862 20:53513589-53513611 ATTCACATTCAGTAGGTCTGGGG - Intergenic
1174891856 20:54403734-54403756 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1175002874 20:55648781-55648803 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1175010494 20:55729708-55729730 TCTAAGATAAAGGAGGTGTGAGG - Intergenic
1175101844 20:56584879-56584901 TTTCTGATTCAGTGGGTCTGGGG - Intergenic
1177647070 21:23913148-23913170 TTTCTAATTCAGTAGGTCTGGGG - Intergenic
1177799040 21:25809258-25809280 ATTATGATTCAGTAGGTCTGGGG + Intergenic
1178609618 21:34069442-34069464 TGGAAGATGCAGTGGGTCTGGGG + Intergenic
1179007861 21:37530706-37530728 TCACAGATTCAGCAGGTCTGGGG + Intergenic
1179283212 21:39952749-39952771 TTTTTGATTCAGTAGGTCTGGGG + Intergenic
1180942949 22:19671672-19671694 TCTAAAATTCAGTGGATCTGTGG + Intergenic
1181829880 22:25551708-25551730 TCAAAGTTTCTGTAGGTCAGGGG - Intergenic
1181966958 22:26663487-26663509 CTTAAGATTCAGGAGGTCTCAGG - Intergenic
1182170518 22:28224245-28224267 GTTAAAATGCAGTAGGTCTGGGG + Intronic
1182948033 22:34343514-34343536 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1183038421 22:35157986-35158008 CCTCTGATTCAGTAAGTCTGGGG - Intergenic
1183098042 22:35566104-35566126 ACTCTGATTCAATAGGTCTGAGG + Intergenic
1183139290 22:35921376-35921398 TTTCTGATTCAGTAAGTCTGGGG + Intronic
1183779863 22:39992424-39992446 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1184246833 22:43240127-43240149 TCTGAGATTCTGCAGGGCTGAGG + Intronic
949194627 3:1290075-1290097 TCTGTGATTCAGTAAGTCTGGGG - Intronic
949520073 3:4843515-4843537 TTTCTGACTCAGTAGGTCTGGGG - Intronic
949626357 3:5870872-5870894 TCTCTGATTCAATAGGTCTGGGG - Intergenic
949745079 3:7281761-7281783 ACTCTGATTCAGTAGGTCTGGGG - Intronic
949951502 3:9232752-9232774 ATTCTGATTCAGTAGGTCTGGGG + Intronic
949963565 3:9335666-9335688 TATAAGAATCAGTAGGTCTGGGG - Intronic
950165903 3:10798819-10798841 ACTCTGACTCAGTAGGTCTGAGG + Intergenic
950169261 3:10826250-10826272 ACTATGATTCAGTAGGCCTGGGG - Intronic
950236682 3:11327847-11327869 ACTCTGATTCAGCAGGTCTGGGG + Intronic
950809280 3:15635918-15635940 ATTCTGATTCAGTAGGTCTGGGG - Intronic
950888372 3:16380648-16380670 TTTCTGACTCAGTAGGTCTGTGG - Intronic
951372412 3:21866579-21866601 TTTCTGATTCAGTAGGTATGGGG + Intronic
951482682 3:23178499-23178521 ACTCTGACTCAGTAGGTCTGTGG - Intergenic
951574725 3:24101885-24101907 TTTCTGATTCAGTAGGCCTGGGG + Intergenic
951581858 3:24173115-24173137 TTTACGATCCAGTTGGTCTGGGG - Intronic
951594684 3:24305245-24305267 TTTCTGATTCAGTAGGTCTCAGG - Intronic
951801441 3:26600996-26601018 TGCAAGATTCAGTAGGTCAACGG + Intergenic
951981410 3:28571117-28571139 ACACTGATTCAGTAGGTCTGGGG + Intergenic
952055291 3:29436780-29436802 ATTATGATTCACTAGGTCTGGGG + Intronic
952076092 3:29699852-29699874 ATTATGATTCAGTAGGTCTGAGG + Intronic
952122278 3:30259880-30259902 ATTCAGATTCAGTAGGTCTTGGG - Intergenic
952831845 3:37571600-37571622 TTTCTGATTCAGTGGGTCTGGGG + Intronic
953204874 3:40817254-40817276 TTTCTGATTCAGTATGTCTGGGG - Intergenic
953370132 3:42380579-42380601 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
953484599 3:43283561-43283583 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
953619820 3:44523536-44523558 TTTATGATTGAGTAGGTCTATGG + Intergenic
953749341 3:45597246-45597268 TTTCTGATTCAGTAGGTCTTGGG - Intronic
954837671 3:53484192-53484214 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
954957556 3:54535211-54535233 TATTTGATTCAGTAGATCTGGGG - Intronic
955248704 3:57255001-57255023 AATATGATTCAGTATGTCTGGGG + Intronic
955254859 3:57320727-57320749 TCTCTAATTCAGTGGGTCTGGGG - Intronic
955500590 3:59578902-59578924 TCTTAGAAGCAGTAGGTTTGGGG + Intergenic
955591521 3:60540973-60540995 TTTCTGGTTCAGTAGGTCTGGGG - Intronic
956094291 3:65699935-65699957 TTTTTGATTCAGTAGGTCTGGGG - Intronic
956345076 3:68269486-68269508 ATTCTGATTCAGTAGGTCTGAGG + Intronic
956435942 3:69234756-69234778 TTTCTGATCCAGTAGGTCTGGGG - Intronic
956525036 3:70149490-70149512 TTTCTGCTTCAGTAGGTCTGGGG - Intergenic
956660090 3:71588817-71588839 TATTTGATTCACTAGGTCTGAGG - Intergenic
956663904 3:71624391-71624413 GCTCTGATTCAGTAGGTCCGAGG - Intergenic
956871907 3:73426769-73426791 TTTCTGATTCAGTAGCTCTGGGG + Intronic
957139338 3:76332982-76333004 GTTTTGATTCAGTAGGTCTGGGG + Intronic
958898280 3:99854949-99854971 ACTCCAATTCAGTAGGTCTGGGG + Intronic
958917429 3:100065186-100065208 ATTCAGATTCAGTAAGTCTGGGG - Intronic
958919107 3:100083406-100083428 TTTCTGATTCAGTAGGCCTGGGG - Intronic
959533704 3:107462124-107462146 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
959762440 3:109982340-109982362 TTTCTGATTCAGTTGGTCTGGGG + Intergenic
959878465 3:111415170-111415192 ATTCTGATTCAGTAGGTCTGGGG + Intronic
960522372 3:118670210-118670232 TTTCTAATTCAGTAGGTCTGGGG + Intergenic
960631305 3:119734112-119734134 TTTCCGATTCAGTAGGTCTGAGG + Intronic
960788477 3:121399952-121399974 TTTCTGATTCAGTAGGTCTGAGG + Intronic
961061833 3:123835183-123835205 TTTCTGATTCAGCAGGTCTGGGG - Intronic
961871817 3:129993891-129993913 TTTCTGATTCAGTAGTTCTGGGG - Intergenic
961925678 3:130477665-130477687 TTTCGGATTCGGTAGGTCTGGGG - Intronic
962036296 3:131655239-131655261 TCTCTGATTCAGTAGGTCTAGGG - Intronic
962181234 3:133208185-133208207 TTTCTGATTCAGTGGGTCTGAGG + Intronic
962364528 3:134769276-134769298 ATTCTGATTCAGTAGGTCTGAGG - Intronic
962633104 3:137299830-137299852 TTTATGATTCAGTAGATCTAAGG - Intergenic
962747685 3:138409615-138409637 TTTCTGATTCATTAGGTCTGGGG - Intergenic
962748101 3:138412467-138412489 TTTATGATTTAGCAGGTCTGGGG + Intergenic
963054571 3:141175139-141175161 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
963709510 3:148730744-148730766 TTTCTGATTCAGTAGGTCTGTGG + Intronic
963924782 3:150939594-150939616 TTTCTGATTCAGTGGGTCTGGGG + Intronic
963940437 3:151091379-151091401 TCTAAGATTCAGTAGGTCTGAGG + Intronic
964283694 3:155094973-155094995 CCACAGATTCAGTAGGTCTGAGG - Intronic
964437362 3:156668363-156668385 TCTGAGATTCAGGAGGACTACGG + Intergenic
964920992 3:161895609-161895631 ATTCAGATTCAGTAGGTCTAGGG + Intergenic
964993152 3:162840590-162840612 TATACCATTCAGTATGTCTGTGG + Intergenic
965168327 3:165225796-165225818 GTTCAGATTCAGTATGTCTGGGG - Intergenic
965294844 3:166931638-166931660 TTTTTGATTCAGTAGGTTTGGGG - Intergenic
965368284 3:167826890-167826912 TTTATCATTCAGTAGGTCTAGGG + Intergenic
965615725 3:170590404-170590426 AATTAGATTCAGTAGGACTGGGG + Intronic
965814077 3:172618946-172618968 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
965866208 3:173207048-173207070 ACTTTGATTCAGTAGTTCTGTGG + Intergenic
966068197 3:175841986-175842008 TTTCATATTCAGTAGGTTTGAGG - Intergenic
966434265 3:179865764-179865786 ACTCCGATTCAGTAGGTCTGAGG + Intronic
966486948 3:180481713-180481735 TTTCTGATTGAGTAGGTCTGGGG + Intergenic
966557065 3:181274494-181274516 ATTCAGATTCAGTAAGTCTGGGG - Intergenic
966567881 3:181403388-181403410 ACTCTGATTCAGTAGGTCTGGGG - Intergenic
966584330 3:181604717-181604739 TTTCTGATTCGGTAGGTCTGTGG + Intergenic
966692907 3:182759961-182759983 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
966960509 3:184933045-184933067 TTTCTGATTCAGGAGGTCTGAGG - Intronic
967014527 3:185469754-185469776 ACTTTGATTTAGTAGGTCTGGGG - Intronic
967079540 3:186036630-186036652 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
967113202 3:186313633-186313655 ACTGTGAATCAGTAGGTCTGGGG - Intronic
967348261 3:188482937-188482959 ATTCTGATTCAGTAGGTCTGGGG - Intronic
967505895 3:190252230-190252252 TTTCTGATTCAGTAGGTTTGGGG - Intergenic
967610390 3:191499221-191499243 CGTAAGATTCAGTAGGTCTCAGG - Intergenic
967690128 3:192464142-192464164 TTTTAGTTTCAGTAGGTCTGGGG + Intronic
968177297 3:196562201-196562223 TTTCAGATTCAGTAGATCTAGGG - Intronic
968193746 3:196690150-196690172 TTTCTGATTCAGTAAGTCTGGGG - Intronic
968609350 4:1550072-1550094 TCTAAGACTCGGGAGGTTTGGGG + Intergenic
969092774 4:4707819-4707841 GCTGAGATTCAGAAGGCCTGGGG + Intergenic
970150576 4:13085272-13085294 TTTCTGATTCAGTAGTTCTGAGG + Intergenic
970321326 4:14878428-14878450 GTTCTGATTCAGTAGGTCTGGGG + Intergenic
972064283 4:34920592-34920614 TCTCAGAGTCAGTAAGTGTGAGG + Intergenic
972308053 4:37851241-37851263 TTTCCGATTCAGTAGGTCTGGGG + Intronic
972440826 4:39089762-39089784 TTTCATATTCAGTAGGTGTGGGG - Intronic
972660503 4:41111354-41111376 ATTATGATTCAGTATGTCTGTGG + Intronic
972747614 4:41953676-41953698 TCAAAGAATAGGTAGGTCTGAGG + Intronic
973583898 4:52371958-52371980 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
973662658 4:53123837-53123859 TTTCTGATTCAGTAGGTCTAGGG + Intronic
973691472 4:53437601-53437623 TTTCTGATTCAGTAAGTCTGGGG - Intronic
974121047 4:57639725-57639747 ACTCAGATTCAGTGAGTCTGAGG - Intergenic
974259109 4:59501986-59502008 TCTAAGATTTAGTCAGGCTGAGG + Intergenic
974411587 4:61548160-61548182 TCTAATATTCAGAATGTATGAGG - Intronic
974942907 4:68490041-68490063 GCTAAGATTCTGGAGGTCTGTGG + Intronic
975412118 4:74065524-74065546 TCTATGATTGAATAGCTCTGAGG + Intergenic
975781387 4:77843866-77843888 TTTCTAATTCAGTAGGTCTGAGG - Intergenic
976103472 4:81590826-81590848 TTTAAAATTCACTAAGTCTGGGG + Intronic
976576595 4:86679488-86679510 TATCTGATTCAATAGGTCTGGGG - Intronic
977269065 4:94892306-94892328 ATTCAGATTCAGTGGGTCTGGGG - Intronic
978530666 4:109709236-109709258 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
978791748 4:112670006-112670028 TTTCTGATTCAATAGGTCTGGGG + Intergenic
978924590 4:114227592-114227614 TTTCTGTTTCAGTAGGTCTGAGG + Intergenic
979431288 4:120634904-120634926 TTTCTGATTCAGTAGGTCTGAGG - Intergenic
979472302 4:121113776-121113798 TCTAAGGTTCTGAAGGTCTAAGG + Intergenic
979632213 4:122916179-122916201 TTTCTGATTCAGTAGGTCTATGG - Intronic
979960391 4:127013159-127013181 TCTAAGATTCTGCTGATCTGTGG - Intergenic
980129376 4:128804029-128804051 TTTCTGTTTCAGTAGGTCTGGGG + Intergenic
980688384 4:136260256-136260278 GCTAAGATTCCAGAGGTCTGTGG - Intergenic
981143567 4:141299731-141299753 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
981244816 4:142523202-142523224 TTTCTGATTTAGTAGGTCTGGGG - Intronic
981691569 4:147514961-147514983 TTCCTGATTCAGTAGGTCTGGGG - Intronic
981811739 4:148783411-148783433 ACTACGATTCAGTAGGTCTGGGG + Intergenic
982138551 4:152295728-152295750 TTTTGGATTCAGTAGGTCTGGGG + Intergenic
982673378 4:158348591-158348613 TTTCTGATTCAGTAGGTCTGGGG - Intronic
983256752 4:165408675-165408697 AGTTTGATTCAGTAGGTCTGAGG + Intronic
983391953 4:167143226-167143248 CCTATGATTCAGTAGGAATGTGG - Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
983924872 4:173389603-173389625 TTTCTGATTCAGTAGGTCTGGGG + Intronic
984152632 4:176153079-176153101 TTTCTGATTCTGTAGGTCTGAGG - Intronic
984258824 4:177419735-177419757 TTTCTGATTCAGTAGGTGTGGGG + Intergenic
984594568 4:181653269-181653291 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
984795595 4:183657887-183657909 ATTCTGATTCAGTAGGTCTGGGG + Intronic
985176122 4:187203537-187203559 CCTAAAATTCAGTATGTATGAGG + Intergenic
985714764 5:1449335-1449357 ACGCAGGTTCAGTAGGTCTGAGG + Intergenic
986638430 5:9847961-9847983 TTTCTGATTCAGTAAGTCTGAGG - Intergenic
987002932 5:13679088-13679110 TCTAAGGTTCAGTCAATCTGAGG + Intergenic
987146050 5:14992873-14992895 ACTCGGATTTAGTAGGTCTGAGG - Intergenic
987278099 5:16383769-16383791 TGTAGGATTCAGATGGTCTGTGG - Intergenic
987287977 5:16478380-16478402 TTTCTGATTCAGTAGGTCTAGGG - Intronic
988116035 5:26892339-26892361 AGTTTGATTCAGTAGGTCTGGGG + Intronic
988689979 5:33562120-33562142 ATTCTGATTCAGTAGGTCTGGGG + Intronic
988900223 5:35723373-35723395 TTTCAGATTTAGTAGGTCTCGGG - Intronic
988993567 5:36693578-36693600 TTTATGATTCAGTAGGTCTAGGG - Intergenic
989108688 5:37886921-37886943 TTTCTGATCCAGTAGGTCTGGGG - Intergenic
989114497 5:37939255-37939277 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
989164504 5:38421441-38421463 TTTGAGATTCAGGGGGTCTGCGG + Intronic
990003523 5:50921758-50921780 TCTAAGACTCGGGAGGTTTGGGG - Intergenic
990173269 5:53079058-53079080 TTTCTGATTCAGTAGGTCTAGGG + Intronic
990533563 5:56697653-56697675 TTTCTGATTCAGTAGGACTGGGG + Intergenic
990542264 5:56785569-56785591 TTTTTGATTCAGTAGGTCTTGGG - Intergenic
990633627 5:57698093-57698115 TCTAAGATTCAGTGAGTCTTAGG - Intergenic
990980547 5:61599035-61599057 TTTCTGATTCAGTAAGTCTGGGG + Intergenic
991503739 5:67303287-67303309 TTCCTGATTCAGTAGGTCTGGGG - Intergenic
992202220 5:74395676-74395698 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
992326910 5:75668873-75668895 GTTTGGATTCAGTAGGTCTGGGG - Intronic
992519854 5:77539427-77539449 ATTGTGATTCAGTAGGTCTGGGG + Intronic
992599329 5:78382127-78382149 TTTCTCATTCAGTAGGTCTGGGG - Intronic
992827197 5:80562248-80562270 GCTGTGATTCAGTAGCTCTGGGG - Intronic
993386187 5:87266447-87266469 TTTCTGATTCAGAAGGTCTGAGG + Intergenic
993865745 5:93192906-93192928 ATTCAGATTCAGTAGGTGTGGGG - Intergenic
993913175 5:93708915-93708937 TATAAGATTTATTAGTTCTGGGG + Intronic
995531025 5:113091950-113091972 TCTCAGGTTCTGTGGGTCTGTGG + Intronic
995890113 5:116941404-116941426 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
995900016 5:117054495-117054517 TTTCTGATTCAGTAAGTCTGAGG - Intergenic
996536505 5:124583376-124583398 TTTCTGATTGAGTAGGTCTGGGG - Intergenic
996856121 5:128009462-128009484 TTTCTGATTCAGCAGGTCTGGGG - Intergenic
996972594 5:129390120-129390142 ACTCTGATTTAGTAGGTCTGGGG + Intergenic
997021447 5:130007565-130007587 GCTAGGATTCTGGAGGTCTGTGG - Intronic
998194397 5:140055164-140055186 TATAAGATTAAATAGGTCTCAGG - Intergenic
998390023 5:141781234-141781256 TTTCTGATTCAGTAGGTTTGGGG + Intergenic
998615252 5:143733413-143733435 TTTCTGATTCAGTAGATCTGAGG + Intergenic
999496764 5:152106804-152106826 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
999664071 5:153894441-153894463 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
999892208 5:155991001-155991023 TTTATGATTCAGTGGTTCTGGGG + Intronic
1000045379 5:157517938-157517960 TCTGGGATTCAGGAGGTCGGGGG + Intronic
1000254457 5:159524781-159524803 TATCTAATTCAGTAGGTCTGGGG + Intergenic
1000312169 5:160055592-160055614 TCTCTGATTCAGTAGGTCTGGGG - Intronic
1000370521 5:160531433-160531455 TTTCTGATTCAGTAGATCTGAGG + Intergenic
1001012325 5:168109586-168109608 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1001083303 5:168682456-168682478 TTTTGGATTCAGTAGTTCTGGGG + Intronic
1001127079 5:169029419-169029441 TCTCTGATGCAGTAGGTCCGAGG - Intronic
1001716574 5:173821245-173821267 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1001717937 5:173832310-173832332 TCCTTGATTCAGTAGGTCTGGGG - Intergenic
1001780483 5:174364687-174364709 TTTCAGATTCAGTAGATTTGGGG - Intergenic
1001860647 5:175051835-175051857 TCTCCGATTCAGTAGGTCTGGGG + Intergenic
1001947690 5:175794075-175794097 GTTCAGATTCAATAGGTCTGGGG + Intergenic
1002060883 5:176625329-176625351 TTTCTGATTCAGTAGGTCTGAGG - Intronic
1002173572 5:177388686-177388708 TTCCAGATTCAGTAGGTCTAGGG - Intronic
1003188475 6:3852631-3852653 ACATTGATTCAGTAGGTCTGGGG - Intergenic
1003453718 6:6261532-6261554 CCTCAGGTTGAGTAGGTCTGAGG - Intronic
1003652027 6:7969546-7969568 TCTTAGATTCAGGAGGGCTGAGG + Intronic
1004025452 6:11813890-11813912 ATGCAGATTCAGTAGGTCTGAGG + Intergenic
1004120171 6:12813899-12813921 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1004132300 6:12932025-12932047 TTTCTGATTCAGTAGGTCTTGGG - Intronic
1004480822 6:16017914-16017936 ACTTTGATTCAGTAGGTTTGGGG - Intergenic
1004645364 6:17555142-17555164 ATTCTGATTCAGTAGGTCTGGGG - Intronic
1004729316 6:18342427-18342449 TCTCTGATTCAGTAGGTCTGGGG - Intergenic
1004767932 6:18752471-18752493 TTTCTGATTCATTAGGTCTGAGG - Intergenic
1005169557 6:22967238-22967260 TCTCTAATTCAGTAGATCTGGGG - Intergenic
1005195454 6:23278007-23278029 ACTCTGATTCAATAGGTCTGTGG - Intergenic
1005415387 6:25594726-25594748 CTTTTGATTCAGTAGGTCTGGGG - Intronic
1005488038 6:26319888-26319910 TTTCTGATTCAGTAGGTGTGGGG - Intergenic
1005497878 6:26404842-26404864 TCTAAGATTCACAAGCTCTTTGG - Intronic
1005530478 6:26699900-26699922 TCTTAGATTTAGGAAGTCTGAGG + Intergenic
1005540318 6:26801746-26801768 TCTTAGATTTAGGAAGTCTGAGG - Intergenic
1005595193 6:27372472-27372494 TTTTTGATTCAGTAGGTCTGGGG - Intergenic
1005872667 6:29986683-29986705 TTTCTGATTCAGTAGGTCTGAGG + Intergenic
1005890134 6:30130599-30130621 TCTCAGATTCAGGAGGCATGGGG - Intergenic
1006184569 6:32173846-32173868 TTTCTGATTCAGTAGATCTGGGG - Intronic
1006844381 6:37052160-37052182 TGGCAGATTCACTAGGTCTGGGG + Intergenic
1007108617 6:39300069-39300091 TTTCTGATCCAGTAGGTCTGGGG - Intronic
1007949559 6:45859341-45859363 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1008036457 6:46749969-46749991 TTTCAGATTCTGTAAGTCTGGGG + Exonic
1008051273 6:46902538-46902560 AGTGTGATTCAGTAGGTCTGGGG + Intronic
1008064357 6:47031675-47031697 TCCAAGATTTAGTAGGTTTAGGG - Intronic
1008341183 6:50366241-50366263 TTTCCGATTCAGTAGGTCTTGGG + Intergenic
1008617876 6:53243636-53243658 TCTCAGGTTCAGCAGGTCTAGGG + Intergenic
1009011132 6:57843846-57843868 TCTTAGATTTAGGAAGTCTGAGG - Intergenic
1009225082 6:61014072-61014094 TCTAATAATCAGTAGGTAGGAGG - Intergenic
1009288925 6:61860103-61860125 TTTAAGATTGACTAGATCTGTGG - Intronic
1009588960 6:65641327-65641349 TCTGAGATGGAGTAGGCCTGAGG - Intronic
1009598778 6:65771516-65771538 GCTAGGATTCTGGAGGTCTGTGG - Intergenic
1009923867 6:70096848-70096870 TTCTGGATTCAGTAGGTCTGGGG - Intronic
1010208092 6:73341027-73341049 TTTCTGACTCAGTAGGTCTGAGG + Intergenic
1010308948 6:74359993-74360015 TTTCTGATTCAGTAGGTGTGGGG + Intergenic
1010828730 6:80504649-80504671 TTTCTGATTCAGTAGGTCTAAGG + Intergenic
1010935920 6:81861277-81861299 ATTCTGATTCAGTAGGTCTGTGG + Intergenic
1011452170 6:87505019-87505041 TTTATGGTTCAGTAGGTCTGGGG + Intronic
1011739989 6:90349940-90349962 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1012551789 6:100469829-100469851 TTTATGATTCAGTAGATCTGGGG + Intergenic
1012797432 6:103780363-103780385 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1013042985 6:106454542-106454564 TGCAAGATTCAGCAGGTTTGCGG + Intergenic
1013301806 6:108810929-108810951 TCTCTGATTCAGTAAGTCTCGGG + Intergenic
1013987611 6:116214590-116214612 TTTCTGATTCAGTAGGTTTGGGG - Intronic
1014015328 6:116523010-116523032 TGTCTGATTCAGTAGGTCTGGGG + Exonic
1014122115 6:117737750-117737772 ACTCTGATTCAGTAGGTCTGGGG - Intergenic
1014356369 6:120415962-120415984 TCAAAGATACAGGTGGTCTGAGG + Intergenic
1014974144 6:127857704-127857726 GTTCTGATTCAGTAGGTCTGGGG - Intronic
1015659521 6:135559754-135559776 AGTATGATTCAATAGGTCTGGGG - Intergenic
1016547867 6:145244536-145244558 TTTCTGATTCAGTAGATCTGGGG + Intergenic
1016577419 6:145584637-145584659 GCTAGGATTCCATAGGTCTGTGG + Intronic
1016878711 6:148889138-148889160 TGTCTGATTCAGTGGGTCTGGGG + Intronic
1017795067 6:157836544-157836566 TTTCTGATTCAGGAGGTCTGGGG + Intronic
1017951647 6:159140311-159140333 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1018140500 6:160829348-160829370 TCTAGCGTTCAGCAGGTCTGGGG - Intergenic
1018197725 6:161369293-161369315 ATTGGGATTCAGTAGGTCTGTGG + Intronic
1018252478 6:161885176-161885198 GTTCAGATTCAGTAGGTCCGGGG - Intronic
1018678522 6:166243552-166243574 TTTCTGGTTCAGTAGGTCTGGGG + Intergenic
1018832645 6:167456432-167456454 TTTCCAATTCAGTAGGTCTGGGG - Intergenic
1019792481 7:3025225-3025247 GTTAAAATGCAGTAGGTCTGGGG + Intronic
1021195293 7:17667580-17667602 TTTAAGATTCAATATGTCTGTGG - Intergenic
1021937857 7:25648797-25648819 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1022403681 7:30065930-30065952 TGTCTGATTCAGCAGGTCTGGGG - Intronic
1022463355 7:30633247-30633269 TTTATGATGCAGTAGGTCTGGGG - Intronic
1022538450 7:31113254-31113276 TTTCTGATTCAGCAGGTCTGAGG + Intergenic
1023225504 7:37964868-37964890 TTTCAGATTCAGTAGACCTGGGG + Intronic
1023395691 7:39749856-39749878 TTTCTGATTCAGTAGATCTGGGG - Intergenic
1023676463 7:42635300-42635322 TTTCTGATTCAGTGGGTCTGGGG - Intergenic
1023951790 7:44852072-44852094 TGTCAGATTCAGCAGGTCTGGGG - Intergenic
1024314654 7:48004275-48004297 TATAATATTCAGTATGTCTAGGG - Intronic
1024442283 7:49434438-49434460 TGTAGGGTTCAGTAGGTCTCGGG + Intergenic
1026110409 7:67454927-67454949 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1026240742 7:68572981-68573003 TCCAAGATTCAGTCAGTCTTTGG - Intergenic
1026366663 7:69655504-69655526 TTTCTGGTTCAGTAGGTCTGGGG - Intronic
1026597894 7:71749834-71749856 TCTCGGATTCAGTGGGTCTGAGG - Intergenic
1027377535 7:77567588-77567610 TTTCTGATTCAGTAGGTCTGAGG - Intronic
1027584103 7:80035326-80035348 ATTATGATTCAGTAGGTCTAGGG - Intergenic
1027842707 7:83334110-83334132 GTTCTGATTCAGTAGGTCTGAGG + Intergenic
1028550287 7:92053832-92053854 CCTCAGTTTCAGTAGGTCTGGGG - Intronic
1028663901 7:93317605-93317627 TATCTGATTCAGTAGGTCTAGGG + Intronic
1028673399 7:93430759-93430781 TTTCCTATTCAGTAGGTCTGGGG - Intronic
1029031492 7:97472270-97472292 GCTCTGATTCAGTAGGTCTTGGG - Intergenic
1029417543 7:100452542-100452564 TTTTTGATTCAGTAGGTCTGCGG + Intergenic
1029849553 7:103447616-103447638 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1030215302 7:107039061-107039083 TTTCAGATTCAGTAAGTCTGAGG - Intergenic
1030714747 7:112794320-112794342 TTCCTGATTCAGTAGGTCTGGGG - Intergenic
1030851962 7:114499038-114499060 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1031179598 7:118397435-118397457 ATGAAGATTCAGTAGGTCTTGGG + Intergenic
1031278499 7:119764069-119764091 TCAACGATTCAGTATGTCAGAGG - Intergenic
1031485945 7:122324494-122324516 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1032310362 7:130780498-130780520 GCTAGGATTCTGGAGGTCTGTGG + Intergenic
1032362156 7:131265884-131265906 TCTCATATTCAGAAGTTCTGTGG + Intronic
1032732985 7:134662379-134662401 TTTCGGAATCAGTAGGTCTGGGG + Intronic
1033251808 7:139767203-139767225 TCTCTAATTCAGTAGGTCTGTGG - Intronic
1034020937 7:147641491-147641513 TTTCTGATTCAGTAGGTCTCAGG + Intronic
1034067051 7:148147146-148147168 TCTTAGATTCAGTAAGTTAGTGG - Intronic
1034068488 7:148159673-148159695 TCTATGACTCAGTAATTCTGGGG - Intronic
1035198102 7:157240019-157240041 TTCCAGATTCAGAAGGTCTGGGG - Intronic
1035465783 7:159075691-159075713 TCATTGATGCAGTAGGTCTGTGG - Intronic
1036132033 8:6124484-6124506 TAGAAGATTCAGTAGTTCTATGG - Intergenic
1036235249 8:7034357-7034379 TTTCTGATTCAATAGGTCTGAGG - Intergenic
1036727253 8:11231152-11231174 TTTCAGATCCAGTAGGTCTGGGG - Intergenic
1038141085 8:24845760-24845782 TTTAATATTCACTAGGTGTGTGG + Intergenic
1038204448 8:25452538-25452560 ATTAATATTCAGTAGGTCTGGGG - Intronic
1038561976 8:28588688-28588710 TTTTTGACTCAGTAGGTCTGCGG + Intergenic
1038887765 8:31684148-31684170 TTTCTGATTCAATAGGTCTGGGG - Intronic
1038935097 8:32241123-32241145 TTTCTGATTCACTAGGTCTGGGG + Intronic
1039072920 8:33662426-33662448 TTTCTGATTAAGTAGGTCTGGGG + Intergenic
1039297749 8:36175399-36175421 TTTCTGATTCAGTATGTCTGGGG - Intergenic
1039344063 8:36684545-36684567 TATCTGATTCAGGAGGTCTGAGG - Intergenic
1039392808 8:37195483-37195505 TGTCCGATTCAGCAGGTCTGGGG - Intergenic
1040454023 8:47577822-47577844 ACTTTGATTCAGCAGGTCTGGGG - Intronic
1041006776 8:53503339-53503361 TTTCTGACTCAGTAGGTCTGGGG - Intergenic
1041642059 8:60213995-60214017 TTGCTGATTCAGTAGGTCTGGGG - Intronic
1041762527 8:61382509-61382531 GCTCTGATTCAGTATGTCTGGGG - Intronic
1042314189 8:67408137-67408159 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1042349918 8:67766621-67766643 ACTCTGATTCAGTAGATCTGAGG - Intergenic
1043356822 8:79423462-79423484 ACTTTGATTCCGTAGGTCTGGGG - Intergenic
1044541820 8:93416948-93416970 TTTCTGTTTCAGTAGGTCTGGGG + Intergenic
1044683502 8:94805097-94805119 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1044804500 8:95991390-95991412 TCTGTCATTCAGTAGGTTTGAGG + Intergenic
1044865149 8:96563586-96563608 TTTCTGATTCATTAGGTCTGGGG + Intronic
1045244939 8:100434632-100434654 GCTCTGATTCAGTAGGTCTGCGG - Intergenic
1045280236 8:100743592-100743614 TTTCTGATTCAGTAGGTCGGAGG + Intergenic
1045642571 8:104268262-104268284 ATTCTGATTCAGTAGGTCTGAGG + Intergenic
1046869466 8:119189207-119189229 ACTCTGATTCAGTAGGTTTGAGG + Intronic
1046928426 8:119818231-119818253 TTTCTGATTCAGTGGGTCTGGGG + Intronic
1047000328 8:120566720-120566742 TTTCTGATTCAGTTGGTCTGGGG + Intronic
1047004258 8:120603561-120603583 TTTCTGATTCAGTAGGTTTGAGG - Intronic
1047472756 8:125195061-125195083 TTTCAGATTCAGTAGGTCTAGGG - Intronic
1047658384 8:127004020-127004042 TTTCTGACTCAGTAGGTCTGGGG + Intergenic
1047668966 8:127124158-127124180 ACCATGATTCAGTAAGTCTGGGG - Intergenic
1048232657 8:132659106-132659128 GTTCTGATTCAGTAGGTCTGGGG + Intronic
1048481700 8:134801957-134801979 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1048488444 8:134869901-134869923 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1048492126 8:134903430-134903452 GCTAAAATTCAGTAGTTCTGGGG + Intergenic
1049187987 8:141269046-141269068 TCTCTGATCCAGTGGGTCTGGGG - Intronic
1049930902 9:455534-455556 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1049995538 9:1030744-1030766 TCTAAGATGAAGCAGCTCTGGGG - Intergenic
1050392732 9:5163159-5163181 TTTCTGATTCAGTAGGTTTGAGG + Intronic
1050710273 9:8453758-8453780 TTTCTGATTTAGTAGGTCTGAGG + Intronic
1051044978 9:12861994-12862016 TTTCTAATTCAGTAGGTCTGGGG + Intergenic
1051524108 9:18023267-18023289 TATCAGCTTTAGTAGGTCTGGGG + Intergenic
1051848285 9:21477673-21477695 TTTCTGATTCAATAGGTCTGTGG - Intergenic
1051885205 9:21885389-21885411 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1052017513 9:23486357-23486379 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1052024352 9:23558264-23558286 TCCAAGATTCAGTATATCTAGGG + Intergenic
1052308227 9:27035515-27035537 TTTCAAATTCAATAGGTCTGGGG - Intronic
1052798948 9:32949670-32949692 ACTGTGATTCAATAGGTCTGAGG - Intergenic
1053259069 9:36645884-36645906 ATTCTGATTCAGTAGGTCTGAGG - Intronic
1055004205 9:71486925-71486947 TTTCTGATCCAGTAGGTCTGGGG - Intergenic
1055019700 9:71656571-71656593 TTTCTGATTCATTAGGTCTGGGG - Intergenic
1055134517 9:72812581-72812603 TTTCTGATTCAGTAGATCTGAGG + Intronic
1055483104 9:76729303-76729325 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1055709252 9:79041213-79041235 TTCCAGATTCAGTAGGTCTAGGG - Intergenic
1056101394 9:83303487-83303509 TCTCTGATTCAGTAGATCTGGGG + Intronic
1057625688 9:96674366-96674388 TCTGAGCATCAGTAGTTCTGTGG - Intergenic
1057797112 9:98165852-98165874 TACCTGATTCAGTAGGTCTGGGG - Intronic
1057894163 9:98893752-98893774 ATGCAGATTCAGTAGGTCTGGGG - Intergenic
1057998660 9:99843717-99843739 TTTCTAATTCAGTAGGTCTGTGG + Intronic
1058019591 9:100073554-100073576 TCTAAGATTCAGCAGAGATGTGG + Intronic
1058021283 9:100091810-100091832 GTTCTGATTCAGTAGGTCTGAGG + Intronic
1058115072 9:101076146-101076168 TGTCTGATTCAGGAGGTCTGGGG - Intronic
1058159574 9:101553663-101553685 ACTGAGATTCAGTAGGTCTGGGG - Intronic
1058523441 9:105834594-105834616 TTTCTGATTCAGTAGGTCTGGGG - Intergenic
1058734665 9:107883373-107883395 TTTCTGATTCAGCAGGTCTGGGG - Intergenic
1058817325 9:108696407-108696429 TGGCTGATTCAGTAGGTCTGGGG + Intergenic
1059011353 9:110465155-110465177 TCTTTGATTCGGTAGGTCTGGGG - Intronic
1059057367 9:110998044-110998066 TGTCTGATTCAGTAGGTCTGGGG + Intronic
1059084618 9:111286841-111286863 GCTCTGATTTAGTAGGTCTGTGG + Intergenic
1059404285 9:114090412-114090434 TATCAGATACAGTGGGTCTGTGG - Intronic
1059476312 9:114550768-114550790 ACTCTGAATCAGTAGGTCTGGGG + Intergenic
1059559356 9:115317543-115317565 GCTAATATGCAGTAGGACTGTGG + Intronic
1059580183 9:115537176-115537198 TTTCAGGTTCAGTAGTTCTGAGG - Intergenic
1059590934 9:115661122-115661144 GTTAAAATGCAGTAGGTCTGAGG - Intergenic
1059802599 9:117765238-117765260 CTTCTGATTCAGTAGGTCTGGGG + Intergenic
1059826742 9:118038554-118038576 TCTAAGATTCTGTAGGCATTAGG - Intergenic
1060116314 9:120944023-120944045 TTTCTGTTTCAGTAGGTCTGGGG + Intergenic
1060237587 9:121876822-121876844 TTTCTGAGTCAGTAGGTCTGGGG - Intronic
1060271075 9:122142179-122142201 ATTTTGATTCAGTAGGTCTGCGG - Intergenic
1060705430 9:125794299-125794321 TTTCTGATTCAGTAGTTCTGAGG - Intronic
1060762554 9:126268100-126268122 TTTCTGCTTCAGTAGGTCTGGGG - Intergenic
1061607276 9:131720477-131720499 TTTCTGATTCAGTAGGTCTGTGG - Intronic
1186708929 X:12172542-12172564 TTTCTGATTCAGCAGGTCTGGGG + Intronic
1186738804 X:12495567-12495589 TTTTGGATTCAGTAGGTCTTGGG + Intronic
1186806963 X:13149655-13149677 TTTCTGATTCAGTAGGTCTAAGG - Intergenic
1186919067 X:14257596-14257618 TGTCCGATTCAGTAGGTCTTGGG - Intergenic
1186942678 X:14528191-14528213 ATTATGATCCAGTAGGTCTGGGG - Intergenic
1186985856 X:15012743-15012765 TTTCCAATTCAGTAGGTCTGGGG - Intergenic
1186996411 X:15128288-15128310 TTTATCATTCAGTAGGTCTCAGG - Intergenic
1187305348 X:18090367-18090389 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1187426754 X:19184357-19184379 TCTAAGATGCACTTGGTCTTGGG - Intergenic
1187433440 X:19245358-19245380 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1187476393 X:19614720-19614742 ATTCAAATTCAGTAGGTCTGGGG + Intronic
1187502408 X:19850860-19850882 CCTCAGATTCAGTAGGTCTCGGG - Intronic
1187510527 X:19913581-19913603 TTTCTGATTCAGGAGGTCTGGGG + Exonic
1187530199 X:20089591-20089613 TTTCATATTCAATAGGTCTGGGG - Intronic
1187566492 X:20454656-20454678 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1187572523 X:20519312-20519334 ACTATGATCCAGTAGCTCTGGGG + Intergenic
1187657795 X:21498351-21498373 TTTCTGATTTAGTAGGTCTGGGG - Intronic
1187712449 X:22067761-22067783 TGTCTAATTCAGTAGGTCTGGGG - Intronic
1187716245 X:22105183-22105205 CCTCTGATTCAGTAGGTCTGGGG - Intronic
1187740860 X:22353942-22353964 TTTCTGATTCAGCAGGTCTGCGG - Intergenic
1187797696 X:23022414-23022436 TTTCTGATTCAGTAGGTCTTAGG - Intergenic
1187827354 X:23345334-23345356 ATTCTGATTCAGTAGGTCTGAGG + Intronic
1187827384 X:23345601-23345623 TTTCTGAGTCAGTAGGTCTGGGG + Intronic
1187969983 X:24649378-24649400 TTTCTGATTCAGTAGGTCTGGGG - Intronic
1187997609 X:24945612-24945634 TTTCTGATTGAGTAGGTCTGGGG + Intronic
1188009794 X:25043514-25043536 TTTCTAATTCAGTAGGTCTGGGG + Intergenic
1188240193 X:27777315-27777337 TCTAAGCTTCATTAGGACAGAGG - Intergenic
1188286958 X:28338936-28338958 CTTCTGATTCAGTAGGTCTGGGG + Intergenic
1189048288 X:37616866-37616888 GTTCAGATTCAGTGGGTCTGAGG - Intronic
1189097163 X:38152486-38152508 TTTCTGATTCAGTAGGTCTCTGG - Intronic
1189148379 X:38678919-38678941 ATTCTGATTCAGTAGGTCTGGGG + Intronic
1189149138 X:38686482-38686504 TATCTGATTCAGCAGGTCTGGGG + Intronic
1189236859 X:39493882-39493904 TTTCTGATTCAGTAGGTGTGGGG - Intergenic
1189306430 X:39990278-39990300 TGTGGGATTCAGTGGGTCTGTGG - Intergenic
1189363036 X:40368176-40368198 TCTCTGATTCAGCAAGTCTGAGG - Intergenic
1189653901 X:43220846-43220868 TCTTAAATTCAGTGCGTCTGTGG + Intergenic
1190013406 X:46805144-46805166 GTTCAGATTCAGTAGGTCTGTGG + Intergenic
1190033853 X:47001286-47001308 TTTTTGATTCAGTAGATCTGAGG + Intronic
1190702889 X:53001212-53001234 TTTCTGATTCAGTGGGTCTGGGG + Intergenic
1190831011 X:54059480-54059502 TTTCAGATTCTGTAGGTTTGAGG + Intergenic
1190920984 X:54852240-54852262 TCTAAGATTTAGGAGGTTAGAGG - Intergenic
1190947408 X:55109268-55109290 TCTAAGATTCAGGGGGTTAGAGG + Intronic
1191011113 X:55760372-55760394 TGTCAGATTCAGCAGGTTTGGGG + Intergenic
1191676185 X:63794730-63794752 ATTCTGATTCAGTAGGTCTGGGG + Intergenic
1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG + Intergenic
1192600419 X:72458013-72458035 TCTAGGATAGAGTAGGGCTGGGG - Intronic
1192819259 X:74626352-74626374 AGTCTGATTCAGTAGGTCTGGGG + Intergenic
1193577230 X:83214487-83214509 GCTAGGATTCAATAGGTCTATGG - Intergenic
1193853213 X:86565440-86565462 TTTTTGATTCAGTAGGTCTGGGG - Intronic
1194233810 X:91357931-91357953 TTTAAGATTTAGTAGGACTTTGG + Intergenic
1194644226 X:96439058-96439080 TTTCTGATTCAGTAGGTCTCAGG + Intergenic
1195179409 X:102342355-102342377 TTTCTGATTCAGTAGGTCTAGGG + Intergenic
1195590397 X:106618383-106618405 TGTATGATTCATTAGGTCTGGGG + Intronic
1195591722 X:106636390-106636412 ATTCAGATTCAGTAGGTCTAGGG - Intronic
1195659019 X:107360429-107360451 ACTCAGACTCACTAGGTCTGGGG - Intergenic
1195762007 X:108256703-108256725 TTTGTGATTCAGTAGGTCTCGGG - Intronic
1196089441 X:111724311-111724333 TTTCTGATTCAGTAAGTCTGAGG + Intronic
1196120704 X:112047374-112047396 TTTCTGATTCAGTTGGTCTGAGG + Intronic
1196129917 X:112144405-112144427 TTTCTGATTCAGTAGATCTGAGG + Intergenic
1196889572 X:120279021-120279043 TACCAGATTCAGTAGGACTGGGG - Intronic
1197890564 X:131265933-131265955 ATTCTGATTCAGTAGGTCTGGGG - Intergenic
1198254167 X:134910897-134910919 TTTCTGATTCAGTAGGTCTAGGG - Intronic
1198559140 X:137829810-137829832 TTTTTGATTCAGTAGGTTTGGGG - Intergenic
1198841716 X:140864789-140864811 GCTAGGATTCTGGAGGTCTGTGG - Intergenic
1199115636 X:143988810-143988832 TTTCTGATTCAGTAGGTCTGGGG + Intergenic
1199725472 X:150575650-150575672 TTTCTGATTCAGTAGGTCTGGGG + Intronic
1199933791 X:152551661-152551683 TCTCTGATTCAGCAGGTCTGGGG + Intergenic
1202364732 Y:24150712-24150734 TTTCTGATTCAGTAGGTCTGTGG + Intergenic
1202506049 Y:25519410-25519432 TTTCTGATTCAGTAGGTCTGTGG - Intergenic