ID: 963941625

View in Genome Browser
Species Human (GRCh38)
Location 3:151101667-151101689
Sequence AGGCCTGGTGGAGCGTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 184}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963941625 Original CRISPR AGGCCTGGTGGAGCGTCTGC TGG Intronic
900186991 1:1337301-1337323 AGGCCAGCAGGGGCGTCTGCAGG - Intronic
900229776 1:1550791-1550813 AGGCCTGGTGGTTCATCAGCAGG + Intronic
900342641 1:2195971-2195993 GGGCCTGGGGGAGCTGCTGCAGG + Intronic
901643130 1:10703156-10703178 AGGTCTGCTGCAGAGTCTGCTGG - Intronic
902317485 1:15633452-15633474 AGTCCTGGTGGAGCAGCAGCAGG + Exonic
904470843 1:30735306-30735328 AGGCCTGCTGGAGCGTGAGAAGG - Intronic
904482655 1:30803895-30803917 AGGCCGTGTGAAGTGTCTGCTGG - Intergenic
906152250 1:43594344-43594366 AGGCCTCCGGGAGAGTCTGCAGG + Intronic
906199411 1:43949410-43949432 AGAGCTGGTGCAGCGCCTGCAGG - Exonic
912608598 1:111019213-111019235 AGGCCTGGATGTGTGTCTGCTGG + Intergenic
912726383 1:112062334-112062356 ATGCCTGGTGGAGGCTCTGTTGG - Intergenic
912825968 1:112903569-112903591 GGGCCTGGGGAAGCTTCTGCAGG - Intergenic
914918507 1:151832462-151832484 AGGCCTGGAGGAGTGCCTGGAGG + Intergenic
916033023 1:160894936-160894958 ATGCCTGGGGGAGCGGCCGCGGG - Intergenic
920398943 1:205665241-205665263 AGGCCTGGCAGAGGGTCTCCAGG - Intronic
920433584 1:205934360-205934382 AGACCTGATGGAGCCCCTGCAGG - Intronic
921611904 1:217222334-217222356 AGGCCTGGTGATGAGTCTGGGGG + Intergenic
922937211 1:229432003-229432025 AGGGCTGGAAGAGCGTCTCCGGG + Exonic
1063105420 10:2987852-2987874 AGGCCAGGTCGAGGGTCAGCAGG + Intergenic
1067346355 10:45441612-45441634 AGACCTGGTGGTGCGCCTGGAGG - Intronic
1067796461 10:49325462-49325484 AGGCCAGGTGCAGCATCTGGTGG - Exonic
1071416821 10:85449316-85449338 AGGCCAGGTGGATCGCCTGCTGG - Intergenic
1074051841 10:109887498-109887520 AGGCCTGGAGGTGGGGCTGCAGG - Intronic
1075799271 10:125142753-125142775 AAGCCTGGTGGGGTGTGTGCTGG - Intronic
1078447103 11:11412592-11412614 AGGCATGCTGGAACCTCTGCAGG - Intronic
1078484103 11:11705985-11706007 AGGCCTGGTGGTGGGACTCCAGG - Intergenic
1083431158 11:62614193-62614215 AGGCCTGGGGGAGGGACTGAAGG - Intronic
1083828051 11:65214120-65214142 AGGCTTGGTGAAGCGCCGGCAGG - Intergenic
1083889521 11:65588954-65588976 GAGCCTGGTGGGGCCTCTGCAGG + Intronic
1084042549 11:66550688-66550710 AGGGCTGTTGGAGCGTCAGCTGG - Intronic
1084366974 11:68708046-68708068 AGTCCTGGGAGAGTGTCTGCAGG - Exonic
1084491573 11:69481436-69481458 AGCCCTGTTGGAGTGACTGCTGG - Intergenic
1085322368 11:75583123-75583145 AGGCCGTGTGGGGCGTCGGCAGG + Intergenic
1085386881 11:76162680-76162702 AGGCCTGGTGGAGGGGCTGAGGG - Intergenic
1085455104 11:76661157-76661179 CGGCCTGCTGGAGCGGCTGCTGG - Exonic
1088693016 11:112343984-112344006 AGGCCTGCTGCAGCCTCTGAAGG + Intergenic
1089061686 11:115631013-115631035 AGGCCTGGTTGTACCTCTGCTGG - Intergenic
1089969601 11:122682155-122682177 AGGCCTCATGGTGCGTCGGCAGG - Intronic
1091353210 11:134914268-134914290 AGGCCTGTTGCAGGGTGTGCAGG - Intergenic
1094489752 12:30952278-30952300 AGACCAGGTGCAGCGTCTCCTGG - Intronic
1096162169 12:49387748-49387770 AGGCCTGGTGGAGAGCAGGCAGG + Intronic
1097380787 12:58893638-58893660 AGGCCTTGTGGCGTGTCTCCTGG - Intronic
1101903368 12:108807799-108807821 AGGCCTTGTGAAGCACCTGCAGG + Exonic
1102647643 12:114414219-114414241 CGGCGTGCTGGAGCGGCTGCGGG + Intergenic
1102787226 12:115614674-115614696 GGGCCTGGTGGTGCCTCTGTGGG + Intergenic
1104850808 12:131872626-131872648 GGGCCTGGTGGAGAGGCTGGCGG + Intergenic
1106776847 13:33016962-33016984 GCGCCTGCTGGAGCGGCTGCGGG + Exonic
1113619380 13:111702540-111702562 AGGCCTGGAGGAGCTGCAGCTGG - Intergenic
1113624909 13:111787801-111787823 AGGCCTGGAGGAGCTGCAGCTGG - Intergenic
1113749652 13:112768353-112768375 AGGGATGGTGCAGCGTCCGCTGG - Intronic
1119181770 14:72610266-72610288 AGGCCTGGTGGAGCCTGTGCAGG + Intergenic
1122287880 14:100663062-100663084 TGGCCTGGTGGGGCCTCTTCCGG + Intergenic
1122483607 14:102063673-102063695 ACGCCTGGGGGAGCGGCGGCCGG + Intergenic
1122976401 14:105172657-105172679 AGGCCTGGGGGTGGGCCTGCTGG - Intergenic
1124635241 15:31360939-31360961 AGCCCTGGAGGAGCCTCGGCAGG - Intronic
1125115044 15:36080746-36080768 TGGCCTGGAGGTGAGTCTGCTGG - Intergenic
1128063826 15:64751847-64751869 AGGCATCGTGCTGCGTCTGCCGG + Intronic
1129878511 15:78992505-78992527 AGGCCTCGTGGAAGGTCTGCTGG + Intronic
1130578739 15:85116277-85116299 GGGCCTGGGGGAGAGTCTGCTGG + Intronic
1131837190 15:96402545-96402567 AGGCCTGGTGGAGAGGCTGCAGG - Intergenic
1131981951 15:98003096-98003118 AAGCCTGCTGGAGCCTCTGAAGG + Intergenic
1132387702 15:101411963-101411985 ATGCCTGGTGGAGAGTCAGGAGG + Intronic
1133109960 16:3542083-3542105 AGGCCTGCTGAAGCGTCTGGGGG + Intronic
1133453538 16:5923028-5923050 AGGCCTTGTGGAGAGTCCCCTGG - Intergenic
1135032756 16:19051702-19051724 CGGCCTGGGGGAGGGTCTGCAGG - Exonic
1136570391 16:31093384-31093406 CGGGCTGGTGGAGCATGTGCTGG - Exonic
1141832424 16:86517157-86517179 AGTCCTGGTGGAGCTTTTGGGGG + Intergenic
1142243253 16:88956653-88956675 AGGCCAGGTGGGGCAGCTGCAGG - Intronic
1142412515 16:89923732-89923754 AGGCCCGGTGGAGGGGGTGCAGG - Intronic
1203061799 16_KI270728v1_random:980497-980519 AGGCCTGGTGGAGGGTCCCTGGG + Intergenic
1142605380 17:1078450-1078472 AGGCCAGGGAGAGGGTCTGCGGG - Intronic
1142978806 17:3659944-3659966 AGGACTGGAGGAACATCTGCAGG - Exonic
1145268620 17:21392535-21392557 AGCCCTGGTGGGGCTCCTGCTGG - Intronic
1146715244 17:35080657-35080679 AGGCCAAGTGGAGGCTCTGCTGG - Intronic
1148205527 17:45777427-45777449 AGCCATGGTGGAGCATCAGCTGG - Intergenic
1148477005 17:47935309-47935331 AGGCCTGGTGGTGGGTTTTCAGG - Intergenic
1150641627 17:66953434-66953456 AGGCCTGCTGGAGCCTCTGATGG - Intergenic
1151396998 17:73829857-73829879 AGGCCTGCTGGAGCAGCGGCCGG - Intergenic
1152690599 17:81716133-81716155 CGGCCTGCTGGAGCCTCAGCTGG - Intronic
1152738566 17:82009084-82009106 CGACCTGGAGGAGCGGCTGCAGG + Exonic
1152753497 17:82077450-82077472 GGGCCTGGTGCAGCGGCTGCAGG - Intergenic
1153201992 18:2656097-2656119 GGGCCTGGTGGGGCCTCTGTGGG + Exonic
1153660888 18:7325288-7325310 AGTCCTGGAGGCGGGTCTGCTGG - Intergenic
1154063297 18:11083610-11083632 AGGCTTGGTGCAGAGTCTGAGGG + Intronic
1154173705 18:12068118-12068140 ACTCCTGGTGGTGCGTCTTCTGG - Intergenic
1160541501 18:79626335-79626357 AGGGCTGGTGGGACGGCTGCCGG + Intergenic
1161074505 19:2278828-2278850 AGGCCCAGTGGGGCGTCAGCCGG + Exonic
1161237301 19:3204410-3204432 AGGCCTGCTGGAGCCCCGGCGGG - Intronic
1161269599 19:3382575-3382597 AGGCCTGGGAGAGCATCTGATGG + Intronic
1161379745 19:3958742-3958764 AGGCCCGGAGGAGGGTTTGCGGG - Exonic
1161709224 19:5838519-5838541 ATCCCTGGGGGAGGGTCTGCAGG - Intronic
1161934095 19:7360666-7360688 AGGGCTGGAGGAGAGCCTGCAGG - Intronic
1162203697 19:9039900-9039922 AGCCCTGGTTGAGAATCTGCAGG - Intergenic
1164985361 19:32644502-32644524 AGGCCGGCTGAAGCCTCTGCTGG + Intronic
1165271445 19:34711129-34711151 AGTCTGGGTGGAGGGTCTGCTGG + Intergenic
1165830365 19:38727632-38727654 AGGACTGGTGGAGGGTCGGGGGG - Intronic
1166331202 19:42079038-42079060 TGGCCCGGAGGTGCGTCTGCCGG - Exonic
1166943473 19:46383251-46383273 AGGCCTGGGGGAGCGGGAGCAGG - Intronic
1166959648 19:46489825-46489847 AGGCCTGGTGGGGAATGTGCTGG - Intronic
1166979332 19:46623559-46623581 AGCCCTGGTGGCGCTTCTGCTGG + Exonic
1167240952 19:48342703-48342725 AGGCCTGGAGCAGCTGCTGCCGG - Exonic
1168282639 19:55313602-55313624 AGGGCCGGGGGAGTGTCTGCTGG - Intronic
925413009 2:3650764-3650786 AAGCCTGGTGGAGGGTCTGCAGG - Intergenic
926218407 2:10919572-10919594 AGCCCTGCTGGGGCGCCTGCTGG + Intergenic
926996421 2:18740748-18740770 GGGCCTGGTGGACTGCCTGCTGG - Intergenic
927210713 2:20637438-20637460 GGGCCAGGAGGAGCGACTGCAGG + Intronic
928024725 2:27730250-27730272 AGGCCTGGTGGAGCAGCATCTGG - Intergenic
928024745 2:27730320-27730342 AGGCCTGGTGGAGCAGCGTCTGG - Intergenic
928114039 2:28533087-28533109 AGGCATGGTGGAGCTTCTGGAGG + Intronic
930873217 2:56187206-56187228 GGGCGTGGGGGAGCGTCTGAGGG + Intronic
932338805 2:70946747-70946769 AGGTCTGGTGGAGAGTGTGGTGG - Intronic
932760678 2:74437094-74437116 AGCCCTGGTGGAGATTCTGAAGG - Intronic
934616391 2:95773912-95773934 AAGGCTGTTGGAGCATCTGCAGG + Intergenic
934644504 2:96050648-96050670 AAGGCTGTTGGAGCATCTGCAGG - Intergenic
934837920 2:97606738-97606760 AAGGCTGTTGGAGCATCTGCAGG - Intergenic
936620688 2:114094111-114094133 AGACCTGGTAGAGCTTCTGGAGG + Intergenic
936953009 2:117997232-117997254 AGGGCGGGTGGATCTTCTGCAGG - Intronic
937276078 2:120685150-120685172 TGGGCTGGTGGAGAGGCTGCAGG + Intergenic
938239349 2:129731220-129731242 AGGCCTGGGGGAGCCCCGGCAGG + Intergenic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
944269046 2:197760392-197760414 TGGCCTGGGGGTGCATCTGCTGG - Intronic
944624759 2:201559364-201559386 TGGCCTGGTGATGTGTCTGCTGG - Intronic
945794116 2:214340582-214340604 AGGCCTGCTGGAGCAGCAGCAGG - Intronic
948593599 2:239066052-239066074 ACGCCTGGTGGAGGCCCTGCTGG + Intronic
948730412 2:239959922-239959944 AGGCCTGGTAGAGCTTCCGCGGG + Exonic
1168966970 20:1904580-1904602 AGGCCTCATGGAACCTCTGCAGG - Intronic
1171089664 20:22271775-22271797 AGGGCTGGTGGTGGGGCTGCTGG + Intergenic
1171383710 20:24752893-24752915 AAGCCTGGTCAAGCCTCTGCAGG + Intergenic
1172097069 20:32465696-32465718 AGGGCTGGAGGAGGGCCTGCAGG - Intronic
1172273460 20:33667347-33667369 AGGGCTGTGGGAGCGCCTGCTGG + Exonic
1172619246 20:36308266-36308288 AGGCCTGGTGAGGCCTGTGCTGG + Intronic
1176107433 20:63395954-63395976 TGGCCGGGTGGAGGGGCTGCAGG + Intergenic
1176118898 20:63445395-63445417 AGGCCTGGGGGAGGGCCTGGGGG + Intronic
1177325267 21:19579101-19579123 AAGCCTGGTGGATCATCTGAGGG + Intergenic
1179798823 21:43800993-43801015 AGGCCTGGTGGTGTTTCTGAGGG + Intronic
1181466680 22:23114142-23114164 AGGCCTGGTGGCTCAGCTGCAGG + Intronic
1183386187 22:37516143-37516165 AGGGCTGGAGCAGCGGCTGCGGG - Exonic
1184189985 22:42888029-42888051 AGACCTGGGGGAGGGACTGCAGG - Intronic
1184474054 22:44711207-44711229 AGGCCAGGTGGGGCGTCAGGAGG + Intronic
1184489334 22:44800050-44800072 AGGCATGGAGGATGGTCTGCAGG + Intronic
1184512827 22:44943176-44943198 AGGCTTGGGGGAGCGGGTGCTGG - Intronic
1184959897 22:47921334-47921356 AGGCCTGGTGGGCCCTGTGCGGG + Intergenic
1185372603 22:50467989-50468011 AGGCCTGGTGGTGCAGATGCTGG - Intronic
950695906 3:14701095-14701117 AGGCCACCTGGAGCATCTGCTGG - Intronic
953061834 3:39434236-39434258 AGCCCAGGTGGAGCCTCTGGTGG + Intergenic
954392657 3:50275647-50275669 AGGGCAGGTGGGGCGTCTTCTGG - Intronic
962381243 3:134899830-134899852 ATGCCTGGAGGAGCTTCTCCAGG + Intronic
963941625 3:151101667-151101689 AGGCCTGGTGGAGCGTCTGCTGG + Intronic
965755364 3:172021085-172021107 AGGACTGGTGGAGGGTGTGTGGG - Intergenic
967231175 3:187338750-187338772 AGCCCTGGAGGACCGACTGCTGG + Intergenic
968448886 4:665929-665951 AGGCCAGGTGCAGCCTCGGCAGG + Intronic
968710831 4:2116047-2116069 AGGCCTGGAGGAGTTTCTCCTGG + Intronic
968737421 4:2304593-2304615 GGACGTGGTGGAGCGTCTGCGGG - Exonic
969598262 4:8160991-8161013 AGGCCTGGTGGGGTGTCAGGGGG + Intergenic
970670927 4:18396010-18396032 AGGCCTGGTGTCTCCTCTGCTGG - Intergenic
971516244 4:27490501-27490523 AGGCCTGGTGCAGCGGCAGCAGG - Intergenic
972560189 4:40220205-40220227 AGGACTGGTGGACCGCATGCAGG - Intronic
977849858 4:101813764-101813786 AGGCCTTGGGGAGCTTCTGCGGG + Intronic
985769021 5:1797508-1797530 AGGCCTGGTGGGGCGGCAGAGGG - Intergenic
986183974 5:5419379-5419401 AAGCCTGGTGGAACGTGTGTGGG + Intergenic
990210599 5:53479202-53479224 AGGACTGGGGGAGGGTCTGGCGG + Intergenic
993968823 5:94391472-94391494 TGGCCTGAGGCAGCGTCTGCTGG - Intronic
997638016 5:135429044-135429066 AGGGCTGGAGGAGCATGTGCAGG - Intergenic
999148160 5:149409361-149409383 AGGTCTGTTGGAGGGTCTCCAGG - Intergenic
1001936717 5:175710630-175710652 AGGCCTCCTGGAGCCTCTGCTGG + Intergenic
1002054576 5:176591351-176591373 AGGCCTGGTGGGGTGGCTGAGGG + Intronic
1011192130 6:84740177-84740199 AGGCCAGGTGGAGCAGGTGCAGG - Intronic
1011227764 6:85126811-85126833 AGGCCTGGAGGAGTTACTGCCGG + Intergenic
1017951062 6:159135684-159135706 TGGCCTGGTGGAGAGAATGCAGG - Intergenic
1019475886 7:1244060-1244082 AGGCCTGGTAGCGTGTCGGCTGG - Intergenic
1019695657 7:2444721-2444743 TGGCTGGGTGGAGAGTCTGCGGG + Intergenic
1019712261 7:2523165-2523187 CGGCGCAGTGGAGCGTCTGCAGG + Intronic
1022034474 7:26520577-26520599 AGGCCTGGGGTAGATTCTGCTGG + Intergenic
1029413328 7:100428884-100428906 AGGCGTGGTGTGGCGTCTCCAGG + Intronic
1031914362 7:127548967-127548989 AGGGATGGTGGAGAGTCAGCTGG - Intergenic
1034383694 7:150720598-150720620 AGCCCAGGTGGAGCAGCTGCTGG + Exonic
1035100885 7:156395583-156395605 AGGCATCATGGAGCCTCTGCTGG - Intergenic
1035567267 8:649917-649939 GGGCCTGGGGAAGCGTGTGCTGG + Intronic
1036066191 8:5384108-5384130 AGCCCTGGTTGTGCGCCTGCAGG - Intergenic
1039905919 8:41786269-41786291 AGGGCTGGAGGGGCGTCTACAGG + Intronic
1040275894 8:46013490-46013512 AGGCCCAGTGCAGGGTCTGCCGG + Intergenic
1041542987 8:59008433-59008455 AGCCCTGTGGGAGGGTCTGCTGG + Intronic
1046671951 8:117065903-117065925 AGGGCTGGTGGAGCCTGGGCTGG + Intronic
1048016242 8:130500112-130500134 AGGTCTGTTGGAGCCACTGCAGG - Intergenic
1048742753 8:137580239-137580261 AGGCCAGGTGGAGTTTCTCCAGG + Intergenic
1049288729 8:141790646-141790668 AGGCCTGGTGGACAGGCTGAGGG + Intergenic
1049433484 8:142575817-142575839 AGGACTGGTGGGGCATCTCCAGG + Intergenic
1053056548 9:34996391-34996413 GGGCCGAGTGGAGCGGCTGCTGG - Exonic
1059111054 9:111558960-111558982 AGGAATGGAGGAGCATCTGCAGG - Intronic
1061204783 9:129156629-129156651 AGGCCCCGTGGAGAGGCTGCAGG - Intergenic
1061237996 9:129353095-129353117 AGGCCTCAGGCAGCGTCTGCAGG + Intergenic
1062107662 9:134764490-134764512 AGGGCTGGGGCAGAGTCTGCTGG - Intronic
1185540838 X:902138-902160 AGACCTGGTGGAGCTTCTGGTGG + Intergenic
1190115478 X:47623802-47623824 AACCCTGGAGGAGCCTCTGCCGG - Intergenic
1190362915 X:49666143-49666165 TGGCCTAGTGGAGCAGCTGCGGG - Intergenic
1191249723 X:58254585-58254607 AGGCCTGGCGCAGGGGCTGCAGG + Intergenic
1191250189 X:58256515-58256537 GGGCCTGGTGCAGTGGCTGCAGG - Intergenic
1191251067 X:58260457-58260479 AGGCCTGGCGCAGGGGCTGCTGG - Intergenic
1191252202 X:58265076-58265098 GGGCCTGGTGCAGGGGCTGCTGG - Intergenic
1194068373 X:89289178-89289200 AAGCCTGGTGGAGCTTCTGCAGG - Intergenic
1194976584 X:100402667-100402689 AGCCCAGGGGCAGCGTCTGCTGG + Exonic
1196468560 X:115998000-115998022 AAGCCTGGAGGAGAGGCTGCTGG + Intergenic
1197754002 X:129982572-129982594 AAGCCTGGTGGAGTGGGTGCCGG - Intronic
1197806360 X:130402100-130402122 TGGTGTGGTAGAGCGTCTGCGGG + Intronic
1200722515 Y:6623347-6623369 AAGCCTGGTGGAGCTTCTGGAGG - Intergenic
1201673061 Y:16546956-16546978 AGTTCTGCTGGAGCATCTGCTGG - Intergenic
1201763688 Y:17561894-17561916 GGGCCTGGTGCAGGGACTGCCGG + Intergenic
1201837865 Y:18344096-18344118 GGGCCTGGTGCAGGGACTGCCGG - Intergenic