ID: 963943638

View in Genome Browser
Species Human (GRCh38)
Location 3:151120659-151120681
Sequence CCACATAAGGAAACAATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963943638 Original CRISPR CCACATAAGGAAACAATGGA AGG Intronic
900210046 1:1450903-1450925 TCACAGAAGGAAACAAGGGGAGG + Intronic
900220099 1:1503806-1503828 TCACAGAAGGAAACAAGGGGAGG + Intergenic
900222406 1:1516233-1516255 TCACAGAAGGAAACAAAGGGAGG + Intronic
900503110 1:3016306-3016328 CCACAGAAGGAAAGAAGAGAGGG + Intergenic
904735921 1:32633173-32633195 GAACAAAAGGAAAAAATGGATGG + Intronic
907389187 1:54145697-54145719 TGACAAAAGAAAACAATGGAAGG + Intronic
909003231 1:70243969-70243991 CCAGGTCAGGACACAATGGATGG + Intronic
909285843 1:73815984-73816006 CCACACCATGAAACAATGGCAGG + Intergenic
910052599 1:82993478-82993500 ACACAGAAGAAAACACTGGAAGG + Intergenic
911040145 1:93584753-93584775 CCACACAAGGAAAAGGTGGAAGG + Intronic
916285785 1:163103453-163103475 GTACATAAGGAAACAAAGAAGGG - Intergenic
917595150 1:176521720-176521742 CCTCACAAGGCAACAAGGGAAGG + Intronic
917735581 1:177917063-177917085 CCACATAAGGCAACATTTGTAGG - Intergenic
919862794 1:201752973-201752995 TCACATTAGGAAAGAATGTAGGG + Intronic
920001401 1:202802271-202802293 CCAATTAAGGCAACAATGAAAGG + Intronic
920189011 1:204180533-204180555 CCACACAAGGCAGCACTGGACGG - Intergenic
920613907 1:207470266-207470288 CCACAAAATAAAACAATGGTGGG - Intronic
921630868 1:217432172-217432194 TCAAATAAGGAATCAAGGGAGGG - Intronic
921788059 1:219256620-219256642 CAACATAAGTAAAGAAGGGATGG - Intergenic
922064911 1:222127147-222127169 CCTCATAAGGTGACATTGGAGGG - Intergenic
924401596 1:243688912-243688934 CAACATAAGCAAACAAATGAAGG - Intronic
1070675190 10:78407307-78407329 CCACCTAGGGAGACAAGGGAGGG + Intergenic
1071174344 10:82906913-82906935 ACACATAAGGAAATAAAGAATGG + Intronic
1071971499 10:90912376-90912398 ACAGGAAAGGAAACAATGGAAGG - Exonic
1071979326 10:90987759-90987781 CCATATAAGGAAACAATCACAGG + Intergenic
1072095203 10:92171548-92171570 ACTCAAAAGGAAACAAAGGAAGG + Intronic
1074303949 10:112258753-112258775 CCACATAAGGAAGCCCTTGATGG + Intergenic
1075839204 10:125485031-125485053 TAACATAAGGAAACATTGAAGGG + Intergenic
1075934403 10:126327099-126327121 GCACATGAGGAGAGAATGGAGGG + Intronic
1076550609 10:131275619-131275641 CATCATTAAGAAACAATGGACGG + Intronic
1077759747 11:5080762-5080784 ACACACAAGAAAAAAATGGAAGG + Intergenic
1077769399 11:5198784-5198806 CCAAAGAAGGAAAGAAAGGAAGG - Intergenic
1078196714 11:9142846-9142868 CTACGTAAGGAAACAGGGGAGGG + Intronic
1078356594 11:10636676-10636698 AAATATAAGGAAACAAGGGATGG + Intronic
1079748985 11:24171296-24171318 CCACATGAGGACACAATGAGAGG - Intergenic
1080377434 11:31729976-31729998 CCACAGAAGGAAAGAATGTCTGG - Intronic
1081789275 11:45771549-45771571 CCCCATAAGGAAACAGGGCAGGG - Exonic
1083167192 11:60897864-60897886 CTACATCTGCAAACAATGGACGG - Exonic
1083339631 11:61950633-61950655 ACACACAGGGAAAGAATGGAGGG + Intronic
1086014695 11:82153327-82153349 CCTGATAAGGAAGCAATGTATGG - Intergenic
1087947357 11:104179088-104179110 CTACATTTGGAAAGAATGGAAGG + Intergenic
1090060279 11:123458661-123458683 CTAGATAAGGAAACAGTGAAAGG + Intergenic
1091445092 12:540506-540528 CCACGTAAGGAAGAAATGAATGG + Intronic
1091924001 12:4329019-4329041 CTGCACAAAGAAACAATGGAAGG - Intronic
1093548861 12:20383021-20383043 CCAGATAAGGCAACAGTAGAAGG + Intronic
1094013291 12:25832167-25832189 CTACAGAAGGAAAAAAAGGAAGG - Intergenic
1095302647 12:40603734-40603756 CCAAAAAAGGAAACACTGAATGG + Intergenic
1095592651 12:43921042-43921064 CCACATTAGGAAACACAGAAGGG - Intronic
1095972154 12:47909688-47909710 CCACAAAAGCAAACATTGGGTGG - Intronic
1100051678 12:90456855-90456877 ACACATATGCACACAATGGATGG - Intergenic
1101068244 12:101045861-101045883 CCACTTAAGGAGACAAGGGAAGG - Intronic
1101167105 12:102049748-102049770 CCAGAAAAGGAAGCAATGAATGG + Intronic
1105575987 13:21652245-21652267 CCACAAAAGAAAACAACGTAAGG - Intergenic
1105581958 13:21706442-21706464 CCACATAATGAAATTAAGGAAGG - Intergenic
1106439032 13:29749275-29749297 CCAAATAAGGAAACCAGGAATGG - Intergenic
1109637739 13:65144954-65144976 CCAAATAAAGAAACATTGGCTGG - Intergenic
1110895193 13:80741739-80741761 CCATATAATGAAAGAATGTATGG + Intergenic
1113080939 13:106519000-106519022 CCACGGAAGGAAACCATGGAAGG + Intronic
1113439829 13:110319668-110319690 CCAAATAAGGAAGAAAGGGAAGG - Intronic
1115788595 14:36854809-36854831 CAACAAAAGGAAACCAGGGATGG + Intronic
1115965860 14:38887453-38887475 CCCAGTAAGGAAACAAAGGACGG + Intergenic
1116424188 14:44769489-44769511 CCACAAAAAGAAACAAGGTAGGG + Intergenic
1121709031 14:96023317-96023339 CCACATCAAGACACAGTGGATGG + Intergenic
1122170933 14:99875027-99875049 ACAGAGATGGAAACAATGGAAGG - Intronic
1127251285 15:57240954-57240976 CCACATAAGTAAATTAGGGAAGG - Intronic
1127617654 15:60702841-60702863 CCACACAAGGTGACCATGGAAGG - Intronic
1128567964 15:68713795-68713817 CCAAATAAGGAAATAATTGCAGG + Intronic
1131610814 15:93961288-93961310 CAACATAAGGATACAATGTAAGG - Intergenic
1132241901 15:100264579-100264601 CCACAAAAGGAAAGACTGCAAGG + Intronic
1133743949 16:8673711-8673733 CCTCATAATGAATGAATGGATGG - Intergenic
1135692603 16:24554716-24554738 CCCCACAAAGAAACAATGGTAGG - Intronic
1137282094 16:46986090-46986112 CCCAAAAAAGAAACAATGGAAGG - Intergenic
1137961715 16:52887841-52887863 CCACAGTAGGAAGCCATGGAAGG + Intergenic
1139695357 16:68670388-68670410 CCACATGAGGAAACTAGGGCTGG - Intronic
1140154259 16:72406149-72406171 ACACATGAAGAAACAGTGGATGG + Intergenic
1140575391 16:76161866-76161888 ACAAATAAGGAAACACTGGTGGG - Intergenic
1144458586 17:15439147-15439169 CCACATAAGAACACAGAGGAAGG - Intronic
1145068528 17:19782292-19782314 CCACATAAGTAAACTCAGGATGG + Intronic
1146846602 17:36185174-36185196 CTATCTAAGGAAACAAAGGAGGG - Intronic
1148240073 17:45994447-45994469 CCACATAAGGAAACAACAGATGG - Intronic
1151498990 17:74476928-74476950 ACACATAAAGAAACTCTGGAAGG + Intronic
1151791533 17:76308482-76308504 CCACATAAGGAAAGACTTGAGGG + Intergenic
1152938878 17:83155276-83155298 CCAGGTGAGGGAACAATGGAAGG - Intergenic
1153609397 18:6867933-6867955 TCACAAAAGGGAACAATGTAAGG - Intronic
1153714211 18:7829837-7829859 ATACATAAGTAAACAAAGGAGGG - Intronic
1155588324 18:27394848-27394870 CTACATAAGGAGACAATGACAGG + Intergenic
1156577827 18:38339032-38339054 TCACATGAGGAAAGGATGGAGGG - Intergenic
1159244474 18:65787603-65787625 CTACACAAGGAAAGACTGGATGG + Intronic
1160319906 18:77880567-77880589 ACACTTAGGGAATCAATGGATGG - Intergenic
1167735635 19:51293087-51293109 ACGCAGAAAGAAACAATGGAAGG + Intergenic
1168118212 19:54237608-54237630 GCACATCAGGAAATACTGGAGGG - Intronic
925147153 2:1588886-1588908 CCACATGAGGACACAGGGGAGGG + Intergenic
926379690 2:12274442-12274464 CCACTTAAGGAAATACTAGACGG - Intergenic
926511867 2:13791647-13791669 CCACATTATGAAACACTGGGAGG + Intergenic
928945099 2:36765065-36765087 CCATATAAGGAAACATTCAATGG - Intronic
929297070 2:40260265-40260287 CCACAAAAGGGAACCAGGGAAGG + Intronic
929349202 2:40928062-40928084 ACATATATGGAAACACTGGAGGG - Intergenic
930097772 2:47579911-47579933 CCAGAGGAGGAAAGAATGGAAGG + Intergenic
930943182 2:57038438-57038460 CCGTAAAAGGAAACAAAGGAAGG - Intergenic
932743504 2:74311360-74311382 CCATATTAGGAAACAAGAGAAGG - Intronic
932971139 2:76544035-76544057 TCACACAAGGTAACCATGGAAGG + Intergenic
933563809 2:83924196-83924218 ACACATAAGGAATGAATGAATGG - Intergenic
933896267 2:86812720-86812742 CCACCTTAGGAAACAAGAGAAGG - Intergenic
935127134 2:100234540-100234562 CCACATGAATAAACAAAGGAAGG + Intergenic
935250358 2:101255085-101255107 CCAGAGAAGGAATCCATGGATGG + Intronic
939644834 2:144685043-144685065 GCACATAAGAAAATAATGGTTGG - Intergenic
939659425 2:144869915-144869937 CTCCAAAAGGAAACAGTGGATGG - Intergenic
939659628 2:144872005-144872027 CTCCAAAAGGAAACAGTGGATGG + Intergenic
940474561 2:154146379-154146401 TTACATAATGAAACTATGGAGGG - Intronic
942508634 2:176671952-176671974 CCAAATAAGGAAAAAATAAAAGG - Intergenic
943781307 2:191827391-191827413 CCACATAAAGAAACATAGTAAGG - Intergenic
946006956 2:216533524-216533546 CCCCATAGGGAGACAATGGAGGG + Intronic
1169780592 20:9306077-9306099 CCTTATATGGAGACAATGGAGGG - Intronic
1170510556 20:17072067-17072089 CAACAGGAGGAAACAATGAACGG - Intergenic
1170854649 20:20039965-20039987 CCACAGAGGGAAAGAATGGTAGG - Intronic
1172658863 20:36553333-36553355 TCACTTAAGGAAACACTGAAAGG - Intergenic
1175137935 20:56839168-56839190 GCACATAAGTATACAACGGATGG + Intergenic
1175343021 20:58246896-58246918 CCATATTAGCAAACACTGGAGGG + Intergenic
1177340287 21:19790007-19790029 CCATCTAAGGAAACAAGGTAAGG - Intergenic
1177395677 21:20532954-20532976 TCACACAAGGCAACAAGGGAAGG - Intergenic
1177939900 21:27396995-27397017 CCACATAAGGAGTCAAAGCATGG + Intergenic
1178495929 21:33086135-33086157 GCAGAAAAGGAATCAATGGAGGG - Intergenic
1178760500 21:35397308-35397330 CCACATAAAGAAACCATTGCCGG - Intronic
1179506815 21:41846718-41846740 TCAGATAAAGAAACAATGGAAGG + Intronic
1180629065 22:17214733-17214755 CCACCTAAGGCAAGAATGGAAGG + Intronic
1181426154 22:22841301-22841323 TCAGAAAAGGAAACAATAGAAGG + Intronic
1183223309 22:36531342-36531364 ACAAATAAGGAAACAAGGCAAGG - Intergenic
1183851679 22:40594626-40594648 CCACATTAGGAAAGGAGGGAGGG + Intronic
949180446 3:1123986-1124008 CAACATAAGGAAACAATCAGAGG - Intronic
951694316 3:25429579-25429601 CAAGATATGGAAATAATGGATGG - Intronic
952509927 3:34042718-34042740 CTACATAAAGAAGCAATGTATGG - Intergenic
955779467 3:62468929-62468951 CCAAATAATGAAACAATGCATGG + Intronic
959274514 3:104261145-104261167 CCAGATAAGGAAATAAATGAAGG + Intergenic
959840532 3:110969353-110969375 ACACAGACGGAAACAATGTAAGG - Intergenic
960910054 3:122640786-122640808 CCACATTAGTAAACATAGGAAGG + Intergenic
963277383 3:143346265-143346287 CCAGATGATTAAACAATGGAGGG + Intronic
963512883 3:146270967-146270989 CCAGAGAAGGGAAGAATGGAGGG + Intergenic
963943638 3:151120659-151120681 CCACATAAGGAAACAATGGAAGG + Intronic
965416178 3:168395767-168395789 CCACATGAGGATACAATGAGAGG - Intergenic
966558667 3:181293469-181293491 CCATAGAAGGAAACAATTGGAGG + Intergenic
966670621 3:182522220-182522242 CCACAGCAGGAAAAAATGGGCGG + Intergenic
973103312 4:46298740-46298762 CATCATAAGAGAACAATGGAAGG + Intronic
973710115 4:53621488-53621510 TCATTTAATGAAACAATGGATGG + Intronic
974455352 4:62123513-62123535 CCATATAAGGAAACATTTGTAGG + Intergenic
974853532 4:67431968-67431990 TCACATAAGGATACACTTGAGGG - Intergenic
975979611 4:80142500-80142522 CCTCATTAGGAAACTATGAATGG - Intergenic
976273472 4:83252664-83252686 CCACAAAAGGAAACATGTGAAGG - Intergenic
977689620 4:99892541-99892563 ACAAATAATGAAACAATGGAAGG - Intronic
978342521 4:107733720-107733742 CCAGATAAGGAAATAATATATGG - Intergenic
978387965 4:108194860-108194882 GCAAATAATGAAACAATGAATGG - Intergenic
979321890 4:119334533-119334555 CCAGAAAAAGCAACAATGGAAGG - Intergenic
981996636 4:150982452-150982474 TAACAAAAGGAAACAATGTAAGG + Intronic
983239867 4:165220139-165220161 CCAGACAAAGCAACAATGGAAGG - Intronic
983315124 4:166122365-166122387 CTACATTAGGACGCAATGGAAGG + Intergenic
983325714 4:166253320-166253342 ACACAAAAGGTAACTATGGAAGG - Intergenic
986598595 5:9448846-9448868 ACAGAGAAGTAAACAATGGAGGG - Intronic
989028545 5:37092842-37092864 TCCCATAAGGAAAACATGGATGG - Intergenic
990360889 5:55018499-55018521 CCACATAAGGACAATATGAATGG - Intronic
992568037 5:78022118-78022140 CCACATATGGAAAAAATATAAGG - Intronic
992809315 5:80370898-80370920 CCAGAAAAGGAAACTATGGCAGG + Intergenic
993565059 5:89463774-89463796 CCACATGAGGGAACACTGAAGGG + Intergenic
994089592 5:95798242-95798264 CAAGTTAAGCAAACAATGGATGG + Intronic
994275605 5:97833069-97833091 CCACACAGGGAAGCACTGGAGGG - Intergenic
995806592 5:116059156-116059178 CCAAAGAATGTAACAATGGAGGG + Exonic
995868082 5:116714070-116714092 CAAAGTAAGGAAACAATGGTTGG - Intergenic
997442841 5:133920872-133920894 CCACAAAAGGAGACCAGGGAAGG + Intergenic
998084652 5:139309296-139309318 GCACATCAGGAAAAAATGGACGG - Intronic
998409078 5:141894857-141894879 CCACATAGGGGAACCATGTAAGG - Intergenic
999523646 5:152379060-152379082 TTACATAAGGAAACAATAGTTGG + Intergenic
999811578 5:155132508-155132530 CCACATGAGTAAGCAAAGGAAGG - Intergenic
1000314264 5:160073590-160073612 CCTCACAAGGAAATAATGAAAGG + Intronic
1002602106 5:180359892-180359914 CCACATAAGGTAAGGAAGGAAGG + Intergenic
1005360744 6:25028669-25028691 CCACATAAGAAAAAAATTGGGGG + Intronic
1010121643 6:72382646-72382668 CCAGAGAAGTAAACACTGGAGGG - Intronic
1010300098 6:74250339-74250361 TCACATAAGTATGCAATGGAAGG + Intergenic
1010867893 6:81002697-81002719 GCACATTAGGAACCAATGGCTGG + Intergenic
1011817998 6:91214772-91214794 ACACAGAAGGAAACTGTGGAAGG + Intergenic
1012246626 6:96933351-96933373 CCACATGAACAAAGAATGGATGG - Intronic
1013857110 6:114586283-114586305 CCACTTAAGGACACAAAAGAGGG - Intergenic
1014294990 6:119607020-119607042 CCACATAAGGTCACATTGGGAGG - Intergenic
1015286113 6:131488395-131488417 CCAAATGAGAAAACAAAGGAGGG + Intergenic
1015499869 6:133920901-133920923 CCACCTGAGGAGACGATGGATGG + Intergenic
1017527355 6:155253263-155253285 GAAAATAAGGAAACAATGAAAGG - Intronic
1018369155 6:163151029-163151051 AACCATAAGTAAACAATGGATGG + Intronic
1020358464 7:7302716-7302738 AAACCTCAGGAAACAATGGATGG - Intergenic
1022200859 7:28115806-28115828 CCACATGAAGAAACATTGAAAGG - Intronic
1022587355 7:31627099-31627121 CCAAATAAGGATAAAATAGATGG - Intronic
1022680967 7:32545747-32545769 ACACATAAGCAAACCATGAAAGG - Intronic
1023548410 7:41343240-41343262 CCACAAAAGGACAAAAAGGAAGG - Intergenic
1024949588 7:54845771-54845793 CCACATAAGGAAACACTCTTTGG - Intergenic
1025770166 7:64497509-64497531 CCACATAAGGAAAAACTGAAAGG + Intergenic
1025814262 7:64895864-64895886 CCACAAAAGGAAAAATTGAAAGG + Intronic
1026289218 7:68990895-68990917 CCACAAAAGGCAAAAATGGAAGG + Intergenic
1027583508 7:80027103-80027125 GCACATAAGCAAACTATGGTAGG + Intergenic
1028415083 7:90571450-90571472 ACACAAAAGGTAACTATGGAAGG - Intronic
1029686585 7:102152743-102152765 CCACAGGAGGAGACAATGGGAGG - Intronic
1029859275 7:103551906-103551928 ACACAGAAGGTAACTATGGAAGG - Intronic
1030844636 7:114393723-114393745 CCACATAAGAGAATAATGGAGGG + Intronic
1030854977 7:114544250-114544272 CCAAACTAGGAAACAATGAATGG - Intronic
1031323303 7:120360792-120360814 AGATATAAGAAAACAATGGATGG + Intronic
1033050060 7:137996050-137996072 CCACATTATGAAATAATGGAGGG + Intronic
1033445958 7:141422334-141422356 CCACATCAGGAGACAATCAATGG - Intronic
1034974316 7:155439063-155439085 CCAGATAAGGAGACCGTGGAGGG + Intergenic
1038262757 8:26011631-26011653 ACACATAAGTAAACATGGGATGG + Intronic
1038350678 8:26773777-26773799 CCACGCAAGGAAAGAAGGGATGG - Intronic
1038686329 8:29721903-29721925 CCCCAAAAGGAAACAGTGCAAGG - Intergenic
1038979993 8:32749252-32749274 CCACACAAGGAAATAATTTAGGG + Intronic
1043119699 8:76307666-76307688 CGAGATAAGGAAAAAATGAAAGG + Intergenic
1046449308 8:114367356-114367378 CAACATAAGGAAATAAATGAAGG + Intergenic
1047999934 8:130370360-130370382 CCATATAAGGACACAATGAGAGG + Intronic
1048077127 8:131083802-131083824 GCACATAAAGAAACAAGGGTGGG - Intergenic
1050776591 9:9270499-9270521 ACAGTCAAGGAAACAATGGAAGG + Intronic
1051865384 9:21674660-21674682 CTACATACCGAAACACTGGAAGG + Intergenic
1053069639 9:35093496-35093518 CCACAAATGGAGACCATGGAGGG - Exonic
1055668193 9:78573205-78573227 ACAAATAAGGAGACAAAGGAAGG - Intergenic
1056637373 9:88342439-88342461 CCACAGAAGTACACAATGCAGGG - Intergenic
1057902249 9:98958497-98958519 CCACAGAAAGAAAAAAAGGAGGG + Intronic
1058258191 9:102796151-102796173 GCAAAAAAGGAAAAAATGGAAGG - Intergenic
1185591990 X:1283338-1283360 GGAAAGAAGGAAACAATGGAAGG - Intronic
1188081116 X:25841902-25841924 CCAGCAAAGGAAACAATAGAAGG - Intergenic
1191054172 X:56225249-56225271 CCAGAGATGGAAACAAAGGACGG - Intergenic
1191129462 X:56992836-56992858 GCAGAAAAGTAAACAATGGAAGG - Intronic
1191713769 X:64179707-64179729 GCACATAAGGAAGGACTGGAAGG + Intergenic
1192841038 X:74856561-74856583 CCACATAAGATTATAATGGAGGG + Intronic
1195674591 X:107498296-107498318 CCACATTAGGTAGCAGTGGAAGG + Intergenic
1196514033 X:116548414-116548436 CCTCATAAGGAAATAATAAATGG - Intergenic
1197591034 X:128410365-128410387 CAAAACAAGGAAACAAAGGAAGG - Intergenic
1198328152 X:135595305-135595327 CGACATAGAGAAACAAAGGAAGG + Intergenic
1198959577 X:142170067-142170089 CCACATAGGGAAGTAATGGAAGG - Intergenic
1199411819 X:147532979-147533001 ACACATAAAGAACCAATGTAAGG + Intergenic
1200282640 X:154790933-154790955 ACACTTATGGAGACAATGGAAGG + Intronic