ID: 963943819

View in Genome Browser
Species Human (GRCh38)
Location 3:151123174-151123196
Sequence CTTGATATGCAGAATGTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963943819_963943822 -3 Left 963943819 3:151123174-151123196 CCCTAAACATTCTGCATATCAAG 0: 1
1: 0
2: 0
3: 11
4: 282
Right 963943822 3:151123194-151123216 AAGCTGTTTATGTGGATTTTAGG 0: 1
1: 0
2: 3
3: 21
4: 244
963943819_963943823 25 Left 963943819 3:151123174-151123196 CCCTAAACATTCTGCATATCAAG 0: 1
1: 0
2: 0
3: 11
4: 282
Right 963943823 3:151123222-151123244 AAGATTTTAAAATCAAGAACAGG 0: 1
1: 0
2: 6
3: 55
4: 666

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963943819 Original CRISPR CTTGATATGCAGAATGTTTA GGG (reversed) Intronic
901189125 1:7394570-7394592 CTTAATATCCAGAATGTATAAGG - Intronic
905577186 1:39054627-39054649 CCTGATATGAAGAATGTATGGGG - Intergenic
905601355 1:39254575-39254597 CTTGAGAGGAAGAATGTTCACGG + Intronic
906264286 1:44417076-44417098 CTTGCTAGGGAGAATGTTTGGGG + Intronic
907071531 1:51540037-51540059 CTTGAGATAGAGGATGTTTAAGG - Intergenic
908026558 1:59958237-59958259 CTGGATGTACAGAATGTATAGGG - Intergenic
909275653 1:73683120-73683142 CTTAATATTCAGAATCTATAAGG - Intergenic
909558116 1:76978201-76978223 GTTAATATGCAGAATATGTAAGG - Intronic
911586827 1:99700942-99700964 GTTAATATGCAGAATATATAAGG - Intergenic
918011001 1:180586426-180586448 CTTGATATTCACAATAATTATGG + Intergenic
918782465 1:188719035-188719057 GTTGTCTTGCAGAATGTTTATGG + Intergenic
919184300 1:194124844-194124866 CTTGATGTTTGGAATGTTTATGG + Intergenic
919402856 1:197141288-197141310 CTTGATTTGCACATTGTCTATGG + Intronic
921425903 1:215000780-215000802 CTTGAAATGCAAAAGGTTTGGGG + Intergenic
921491313 1:215779598-215779620 CTTGATATGCATTATGTGAAGGG - Intronic
921631995 1:217445113-217445135 CTTGATATGCATATTGTTCCAGG - Intronic
923737661 1:236626601-236626623 ACTGATATGCAGAATATTTAAGG + Intergenic
923737835 1:236628270-236628292 ACTCATATGCAGAATATTTAAGG + Intergenic
923929128 1:238673646-238673668 GTTGAAATGCAGAATCTCTAGGG + Intergenic
924072708 1:240298451-240298473 CCTGATATACAGGACGTTTAGGG - Intronic
924399053 1:243658211-243658233 CTTAATATTCAAAATGTATAGGG + Intronic
1062893698 10:1086559-1086581 CATGATATGTACATTGTTTAGGG - Intronic
1063395324 10:5681938-5681960 CTTGATCTTCAGGATGTCTAAGG + Intergenic
1063523269 10:6760079-6760101 CTGGGTATGTAGAATGTTCAAGG + Intergenic
1064799694 10:19055279-19055301 GTTGATATTCAGAATATATAAGG - Intronic
1065540776 10:26764997-26765019 CTTAATATGCAGTATATATAAGG + Intronic
1065758469 10:28958111-28958133 ATTAATATCCAGAATGTATAAGG + Intergenic
1068449695 10:57170244-57170266 CTTAATATCCAGAATCTATAAGG + Intergenic
1068814898 10:61298147-61298169 CCAGAAATGCAGGATGTTTAGGG + Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1071710203 10:88042394-88042416 CTTGATATGAAAAATGTGAATGG + Intergenic
1072883688 10:99253719-99253741 CTTAATATCCAGAATCTATAAGG + Intergenic
1073827711 10:107344464-107344486 ACTGATATCCAGAATGTATAAGG - Intergenic
1078137908 11:8667465-8667487 ATTGGTATCCAGAATGTGTAAGG + Intronic
1079338366 11:19590979-19591001 CTTCCTATACAGAATCTTTAGGG + Intronic
1079530283 11:21444373-21444395 CTTGATATGCACAAGTTTAAGGG + Intronic
1080959248 11:37138857-37138879 CTTAATATCCAGAATTTGTAAGG + Intergenic
1081319987 11:41680073-41680095 CTTAAAATGCAGAATGGTGAAGG + Intergenic
1084449428 11:69227029-69227051 GTTGATAAGCAGAATGTGGAAGG + Intergenic
1085612435 11:77963927-77963949 CTTGATATGAATAGTTTTTAAGG + Intronic
1086265382 11:84991914-84991936 CTTGATATGCAAATTCTTTTTGG + Intronic
1087323315 11:96689216-96689238 CTTGAAATGTAAAATGTTTTTGG - Intergenic
1087591807 11:100198805-100198827 ATTCATATGCAGAATTTTTGTGG + Intronic
1087804009 11:102536074-102536096 TTTGATATCCAGAATATATAAGG - Intergenic
1087826904 11:102775530-102775552 CATAATATGCACACTGTTTATGG - Intronic
1092636783 12:10459815-10459837 TTTGATATCCAGAATCTATAAGG - Intergenic
1092664333 12:10778471-10778493 CTTGATATTCAAAATGCCTAAGG - Intergenic
1094277529 12:28695115-28695137 ATTGCTATGGAGAATGTTAAAGG + Intergenic
1099400861 12:82202430-82202452 ATTGAGAACCAGAATGTTTAAGG - Intergenic
1099565867 12:84245683-84245705 TTTCATATACAGTATGTTTATGG - Intergenic
1099796927 12:87411164-87411186 CTTGACATGCATTATGTTTTAGG - Intergenic
1105332969 13:19435251-19435273 TTTGATATGAAGGATTTTTAAGG + Intronic
1105443261 13:20432548-20432570 CTTGCTATCCTGTATGTTTATGG + Intronic
1105686143 13:22784014-22784036 GTTGATATGCAAAATATATAAGG + Intergenic
1105878730 13:24584543-24584565 TTTGATATGAAGGATTTTTAAGG - Intergenic
1105921114 13:24964522-24964544 TTTGATATGAAGGATTTTTAAGG + Intergenic
1107460684 13:40599016-40599038 TTTGATATGTACAATGTTTTGGG + Intronic
1108020085 13:46119405-46119427 CTCAATAAGCTGAATGTTTATGG + Intergenic
1109090260 13:58033914-58033936 CTTGATTTGTAGCATGTTTCTGG - Intergenic
1109144616 13:58763631-58763653 CTTTATTTTCAGAATTTTTATGG + Intergenic
1109156951 13:58923210-58923232 CTGAATATCCTGAATGTTTATGG - Intergenic
1109505172 13:63291195-63291217 CTCAATATACACAATGTTTATGG + Intergenic
1109646742 13:65268468-65268490 CTTAACATGCAGAATTTATAAGG - Intergenic
1109808394 13:67474722-67474744 CTTAATATTCAGAATATATATGG - Intergenic
1109812323 13:67529994-67530016 CTTAATATGCAAGATGTTGAAGG + Intergenic
1110142932 13:72153460-72153482 CTTGATAAACATTATGTTTATGG - Intergenic
1110245187 13:73315512-73315534 ATTGATATCCAGAATATGTAAGG + Intergenic
1110300590 13:73922223-73922245 ATTCATATGTAAAATGTTTAAGG - Intronic
1110598890 13:77349185-77349207 ATTGATATTCAAAATATTTAAGG - Intergenic
1111080511 13:83301005-83301027 CTTAATTTGCATAATTTTTACGG - Intergenic
1111319835 13:86612774-86612796 TTTAATATGCAGAATGTATAAGG - Intergenic
1112574856 13:100626817-100626839 TGTAATAAGCAGAATGTTTATGG + Intronic
1114489121 14:23085969-23085991 ATTAAAGTGCAGAATGTTTAAGG + Intronic
1114842427 14:26281103-26281125 CTTGATTCACAGAATATTTATGG - Intergenic
1115021108 14:28682947-28682969 TCTAATATGCAGAATCTTTAAGG - Intergenic
1116351927 14:43873329-43873351 TTTGTTATGAAGAATGTTTTGGG + Intergenic
1116586025 14:46705777-46705799 ATGGATATGCAGAGTGTTAAAGG + Intergenic
1116618241 14:47165379-47165401 CTTGATATCCCGAAAGTTTGAGG + Intronic
1116749094 14:48859726-48859748 GTTGATATGCTTGATGTTTAGGG - Intergenic
1118054480 14:62065223-62065245 GATGATATGCAGAGTGGTTAGGG + Intronic
1118519861 14:66570991-66571013 CTTAATATCCAGAATATATAAGG - Intronic
1118851361 14:69586418-69586440 ATTGATTTGCAGAATGGTTGTGG + Intergenic
1119972109 14:78982800-78982822 CTTGATGTGCAGAACCTTTTTGG - Intronic
1120353005 14:83387127-83387149 CTTGATATCCAAAATATATAAGG - Intergenic
1120545142 14:85801840-85801862 CTTGACATGAAGAAGGTCTATGG - Intergenic
1121590591 14:95103990-95104012 CTTGATGTGCAGCATTTTCAGGG + Exonic
1121893468 14:97621595-97621617 TCTGATTTGCAGAATTTTTATGG + Intergenic
1125765024 15:42129109-42129131 CTTGGTATGCAGAAGTTTTTTGG + Intergenic
1128845094 15:70886399-70886421 ATTGATTTTCAGAATTTTTATGG - Intronic
1128858771 15:71046578-71046600 CTTAATATCCAGAATTTATAGGG - Intronic
1129433138 15:75515963-75515985 AGAGATATGCAGTATGTTTATGG + Intronic
1130429791 15:83835498-83835520 CTTGTTTTGAAGAGTGTTTAAGG - Intronic
1130943770 15:88534904-88534926 CTTCATATGCTGAATGATTTTGG - Intronic
1131544799 15:93307143-93307165 CTTGAAATACAGTATGTTTGAGG - Intergenic
1132171033 15:99655348-99655370 CATCATATACAAAATGTTTATGG + Intronic
1133573349 16:7063767-7063789 GTTATTATCCAGAATGTTTAGGG - Intronic
1133653855 16:7840174-7840196 ATTGATAAACAGAATGATTAGGG - Intergenic
1134283659 16:12840815-12840837 GTTAATATCCAGAATGTATAAGG + Intergenic
1138425142 16:56926774-56926796 CTTTATACGCAGAATTTGTATGG - Intergenic
1138905987 16:61334140-61334162 CTTGATATGGAAAATAATTATGG - Intergenic
1138986780 16:62338588-62338610 CTTCATAAGTAGAATGTGTAGGG - Intergenic
1141777071 16:86131144-86131166 CCTGATATGGAGAAAGTTTTAGG - Intergenic
1144243941 17:13344552-13344574 ATTTGTATGTAGAATGTTTATGG + Intergenic
1145044187 17:19599824-19599846 CTAGTTATGCAGAAGGTATAAGG - Intergenic
1148140516 17:45324706-45324728 CTTGATCTGAAGAATGGTTTTGG - Intergenic
1150192053 17:63253320-63253342 ATTAATAAGCAGAATGTATAAGG - Intronic
1153852226 18:9106162-9106184 ATTTATATACAGAATGTATAGGG + Intronic
1154425373 18:14268068-14268090 ATTGTTATGCGGAATGTTAAAGG + Intergenic
1155274798 18:24176534-24176556 CTTGGTATGCTGAATGATTTTGG + Intronic
1156288973 18:35728631-35728653 CCTGATATCCAGAATCTATAAGG + Intergenic
1156672981 18:39492815-39492837 GTTAATATCCAGAATATTTAAGG + Intergenic
1158808978 18:61009023-61009045 ATTGATATGCATCATGCTTATGG - Intergenic
1160250018 18:77194670-77194692 CCTAATATCCAGAATGTATAAGG - Intergenic
1161097498 19:2401296-2401318 CTTGACATGCAGGACATTTATGG + Intronic
1161837359 19:6657073-6657095 CTGGGTATGCAGTATATTTATGG + Intergenic
1163591899 19:18198535-18198557 TTTGCCATGCAGAAAGTTTAAGG - Intronic
1166638687 19:44474412-44474434 CTGAATATGAAGAATGTTCATGG + Intergenic
1168334859 19:55591997-55592019 CTTGATCTGGAGAATGTGGAGGG - Exonic
925434534 2:3825535-3825557 TTTGATATGGAAAATGTTTAGGG + Intronic
925795965 2:7543209-7543231 CAGGATATGCAGATTTTTTATGG + Intergenic
926548967 2:14277897-14277919 TGTAATATGCAGAATGTGTAAGG - Intergenic
926898384 2:17721085-17721107 TGTGATATGCAGAATGTATTTGG - Intronic
926927152 2:17998646-17998668 TTTTATATGCAAAATGTGTAAGG + Intronic
928726493 2:34179784-34179806 TTAGATTTGCAGAATGTTGAAGG - Intergenic
931644408 2:64408472-64408494 AATGATATGCAGTATGTTTATGG - Intergenic
931940837 2:67250312-67250334 ATTGATAACCAGAATGTATAAGG - Intergenic
933065418 2:77787806-77787828 CGTGACATGTAAAATGTTTAAGG - Intergenic
933461330 2:82590477-82590499 TTTGAAATGTGGAATGTTTAAGG + Intergenic
933533164 2:83535994-83536016 GTAAATATGCAGACTGTTTATGG + Intergenic
933819466 2:86096980-86097002 CTTAATATCCAGAATATGTAAGG + Intronic
935891149 2:107679862-107679884 CTTTATAGGCAGAATGAGTAGGG + Intergenic
937745335 2:125405527-125405549 ATTAATAAGCAGAATGTATACGG - Intergenic
938209128 2:129450950-129450972 CCTGATATCCAGAATCTATAAGG + Intergenic
938550736 2:132379922-132379944 CTTGATATGGGGAATTTTGAAGG - Intergenic
939125248 2:138170417-138170439 TTTAATATCCAGAATGTATAAGG + Intergenic
939467292 2:142574642-142574664 ATTAATTTGCAGAATGTCTAAGG + Intergenic
940689449 2:156897013-156897035 CTTGATAAGCAGAATTTGTAAGG + Intergenic
940947388 2:159633666-159633688 CTTGATAGCCAGTATGTTTCAGG + Intergenic
941146137 2:161848261-161848283 TTTAATATCCAGAATCTTTAAGG - Intronic
942156054 2:173128884-173128906 ATTGATCTGAAGAATGTTTTTGG - Intronic
945479418 2:210327033-210327055 TTTGATATGCAGAAGCTTTTTGG + Intergenic
945582634 2:211614784-211614806 TTTGATATGCAGTATCTTGATGG - Intronic
946589688 2:221231324-221231346 CTTGATATGAAGATTGTCCAAGG + Intergenic
947192699 2:227525313-227525335 ATTGATATACACAATATTTAAGG - Intronic
948194285 2:236083714-236083736 CTTAATGTGCAGTATTTTTAAGG - Intronic
1168999610 20:2158573-2158595 CTTGAAATGCAGAAGTTTTTAGG - Intronic
1169310762 20:4537777-4537799 CTTGCTATGCAGAAGTTTTTGGG - Intergenic
1169967236 20:11231698-11231720 CATGATTTCCAGAATGTTAAGGG + Intergenic
1177776617 21:25574975-25574997 TTTGATTTGCAGAATATTTAAGG + Intergenic
1177839609 21:26221093-26221115 CTTTATAAGCACATTGTTTATGG + Intergenic
1178244746 21:30939653-30939675 CCTGCTATACAGAATCTTTATGG - Intergenic
1178973533 21:37202045-37202067 CTTAAAATGCAGAATCTTTGAGG - Exonic
1181675654 22:24449964-24449986 CTTGATCTGCTGCATATTTAGGG - Intergenic
1182166114 22:28175373-28175395 GTTAATATCCAGAATATTTAAGG + Intronic
1182588894 22:31363902-31363924 CTTGACCAGCATAATGTTTATGG - Intergenic
1184967357 22:47989956-47989978 TTTGTTATGCAGAATGATTGTGG + Intergenic
949474899 3:4434180-4434202 CTGGAAATGCATAATGTTGATGG + Intronic
950977996 3:17270364-17270386 TTTGATATCCAAAATGTATAAGG - Intronic
951566619 3:24018156-24018178 CATCATATGAAAAATGTTTATGG + Intergenic
953578348 3:44130842-44130864 CTTGCTATGTAGAATACTTAGGG + Intergenic
955030967 3:55217657-55217679 ATTAATATCCAGAATGTATAAGG - Intergenic
955750934 3:62184924-62184946 CTTGAACTGCAGATAGTTTAAGG + Intronic
956978016 3:74604422-74604444 GTTAATATTCAGAATGTATAAGG + Intergenic
957726377 3:84072308-84072330 CTTGAAAAGCAGGATCTTTAGGG + Intergenic
957856899 3:85891171-85891193 CTTGCTATGCAGAAGATTAAAGG - Intronic
957859024 3:85919346-85919368 CTTGATACTCAGAATTTTTTGGG - Intronic
959049381 3:101510393-101510415 CTTGTTTAGCAGAAAGTTTAGGG + Intronic
959360123 3:105378434-105378456 CTTTCTAAGAAGAATGTTTATGG + Intronic
960500359 3:118430462-118430484 TCTGATATCCAGAATGTATAAGG - Intergenic
960500440 3:118431246-118431268 TCTGATATCCAGAATGTATAAGG - Intergenic
960645514 3:119877271-119877293 CTTGGTATTCAGATTGTTTCAGG + Intronic
962689483 3:137879523-137879545 TTTGCTATGCAGAAGGTTTTTGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963504665 3:146168811-146168833 CTTGAAATTTAAAATGTTTAAGG - Intergenic
963943819 3:151123174-151123196 CTTGATATGCAGAATGTTTAGGG - Intronic
964007195 3:151845962-151845984 CTTATTGTGCAGGATGTTTAGGG - Intergenic
964148256 3:153492466-153492488 ATTGATATCCAGAATATTCAAGG + Intronic
964274362 3:154993200-154993222 ATTGATATTCAGAATATTCAAGG + Intergenic
964285343 3:155111615-155111637 CTTTTTATTCAGAGTGTTTAAGG + Intronic
964460147 3:156915639-156915661 CCCGATATGCAGCATGTATAAGG - Intronic
964651909 3:159021020-159021042 CATGATATCCAGAATTTATAAGG - Intronic
967059626 3:185860678-185860700 TCTGATATGCAGAATCTATAAGG + Intergenic
975036547 4:69691244-69691266 ATTGATAAGCAGAATCTATAAGG - Intergenic
976555303 4:86443962-86443984 CTAGAAATGAAGAATGTTTTTGG + Intronic
977035473 4:91946103-91946125 CTTGTTATGCAAATTTTTTATGG + Intergenic
977096844 4:92756928-92756950 CTTGCTGTGCAGAAGGTTTTTGG + Intronic
977238125 4:94533467-94533489 TTTAATATGTAGAATTTTTAAGG + Intronic
980319498 4:131250902-131250924 TTTGATATTCAGAATCTATAAGG + Intergenic
981595387 4:146415332-146415354 CTTGAGATTCAGAAAGTTCAAGG - Intronic
982931481 4:161413172-161413194 CTTAATATTCAGAATCTATAGGG + Intronic
982990281 4:162264871-162264893 TTTAATATGCAGAATCTATAAGG + Intergenic
983264423 4:165493091-165493113 CTTGATATGAAACATATTTAAGG + Intronic
984252768 4:177354341-177354363 ATTGATAAGCAGTATGATTATGG - Intronic
987659098 5:20848520-20848542 CTTAATATCCAGAATATATAAGG + Intergenic
987680406 5:21129150-21129172 ATAGATATTCAGAATATTTAGGG - Intergenic
988029222 5:25740525-25740547 ATTAATATGCAGAATATATAAGG + Intergenic
988315047 5:29614595-29614617 GTTAATATCCAGAATATTTAAGG - Intergenic
988408410 5:30854517-30854539 CTGGCTATGCACAATGATTAAGG - Intergenic
988753681 5:34221157-34221179 CTTGGTATGAAGAATCTTAAAGG - Intergenic
989759680 5:44998514-44998536 CTTCATATTCAGAATGTTCTGGG - Intergenic
990289406 5:54333428-54333450 CATGACATGCTGTATGTTTATGG - Intergenic
990350935 5:54915375-54915397 GTTTATATGCAGAAGGTTAAAGG - Intergenic
991436955 5:66606201-66606223 CTTGTTAAACAGAATGTTTGGGG + Intronic
993011153 5:82484496-82484518 CTTGCTTTGTAGAAAGTTTAGGG + Intergenic
993051158 5:82927648-82927670 CTGGGTATTCTGAATGTTTATGG - Intergenic
993558348 5:89370367-89370389 GTTGATATCCAGAATATATAAGG + Intergenic
994524669 5:100888908-100888930 CCTGATATTCAGAATATTTGGGG - Intronic
994908861 5:105875355-105875377 TTTGAAATCCAGCATGTTTAGGG + Intergenic
997292237 5:132746290-132746312 CTTAATATCCAGAATCTGTAAGG - Intergenic
998354704 5:141525282-141525304 CTTCATTTGCAGAAGGTTTGTGG + Intronic
999216108 5:149936666-149936688 CTTTATATGCTGAATATATAGGG - Intronic
999882752 5:155885079-155885101 ATTGATATCCAGAAAGTCTAAGG + Intronic
1002369234 5:178737607-178737629 CTTGCTGTGCAGGAGGTTTAAGG - Intergenic
1003801588 6:9675519-9675541 CTTCATATAGAAAATGTTTATGG - Intronic
1005272635 6:24182420-24182442 CTTGATATCTAGAATATATAGGG + Intronic
1005531778 6:26714499-26714521 CTTCATATGCTGAATATTTTGGG - Intergenic
1005539017 6:26787166-26787188 CTTCATATGCTGAATATTTTGGG + Intergenic
1005658739 6:27971133-27971155 GTTAATATCCAGAATGTATAAGG + Intergenic
1005708772 6:28483324-28483346 TTTGATTTGCTGAATTTTTAAGG + Intergenic
1006049749 6:31332748-31332770 CTTGATTTGCAGAAATTTTAAGG + Intronic
1006382897 6:33711155-33711177 CTTCAAATGCAGAATCTCTAGGG - Intronic
1006945509 6:37781886-37781908 CTTAATGTGCAGAATGTTACAGG + Intergenic
1007866909 6:44981453-44981475 GTTGATATACAGAATGTATTGGG - Intronic
1009009854 6:57829392-57829414 CTTCATATGCTGAATATTTTGGG + Intergenic
1009599288 6:65777298-65777320 CTTAATATCCAGAATTTATAAGG + Intergenic
1010008270 6:71020424-71020446 GTTTATATCCAGAATATTTAAGG + Intergenic
1010176272 6:73031712-73031734 CTTTATATCCTGCATGTTTATGG + Intronic
1010187440 6:73159777-73159799 CTTAATATCCACAATGTATAAGG - Intronic
1010268047 6:73889931-73889953 GTTGATATCCAGAATATATAAGG - Intergenic
1010847431 6:80726793-80726815 ATTGAAAGGGAGAATGTTTAAGG + Intergenic
1010949743 6:82021554-82021576 CTTAAAATGCAGAATGTTTCAGG - Intergenic
1011181038 6:84621137-84621159 GTTAATATTCAGAATGTATAAGG - Intergenic
1012030813 6:94060128-94060150 CTTGATTTGCATAATGTTAGGGG - Intergenic
1012794807 6:103746014-103746036 CTTGGGATTCAGACTGTTTATGG - Intergenic
1013539510 6:111093925-111093947 CTTCATTTCCAGAATGTTTCTGG + Intronic
1015846658 6:137527146-137527168 GTTAATATTCAGAATATTTAAGG - Intergenic
1016018359 6:139209877-139209899 TTTGCTATGCAGAATCTTTTTGG - Intergenic
1018232370 6:161687879-161687901 CTTAATTTGAAGAATGTTAAAGG + Intronic
1020413770 7:7922619-7922641 ATTGCTATGCAGATTGTTGATGG + Intronic
1020659799 7:10968378-10968400 CTTGATATGTAGAAAATGTAAGG - Intergenic
1026455426 7:70568307-70568329 CCTGAGATACAGAATGGTTAAGG - Intronic
1027387146 7:77670102-77670124 CTTGGTATGCAAGATGTTCAAGG - Intergenic
1028026115 7:85842977-85842999 ACTGATATGCAGAATTTATAAGG - Intergenic
1029099653 7:98118183-98118205 CATGGTATTTAGAATGTTTATGG - Intronic
1030347444 7:108450520-108450542 ATTCTTATGCTGAATGTTTAGGG - Intronic
1031083091 7:117277401-117277423 CTTGATATAAAAAATCTTTAGGG - Exonic
1031626626 7:123999753-123999775 TCTGATATGCAGAATCTATAAGG + Intergenic
1032185748 7:129724155-129724177 ATTGATATCCAGAATATATAGGG + Intronic
1033029041 7:137807150-137807172 CTGCATATGCAGAATATTTTGGG - Intronic
1033496748 7:141906296-141906318 CTTTTTATTCAGGATGTTTATGG - Intergenic
1033815361 7:145065152-145065174 ATTGATATGTAGAAGTTTTAAGG + Intergenic
1034754704 7:153605473-153605495 ATTGTTATACACAATGTTTATGG + Intergenic
1037060819 8:14507167-14507189 CTTGATTTGCAGATTGGATATGG - Intronic
1037277123 8:17192502-17192524 ATTAATATCCAGAATGTATAAGG - Intronic
1037488573 8:19374475-19374497 CTTGGTTTGCATTATGTTTAAGG + Intronic
1039680725 8:39732652-39732674 CTTGATATCCAGAATGTAGAAGG + Intergenic
1042035281 8:64526268-64526290 CATGGTATGCTGAATGTTCAGGG - Intergenic
1043685870 8:83085444-83085466 GTTTATATGCAGACTGGTTAGGG + Intergenic
1044772913 8:95656094-95656116 CTTAATATCCAGAATCTGTAGGG - Intergenic
1044844417 8:96366254-96366276 ATTTATGTGCAGAAAGTTTATGG + Intergenic
1045702929 8:104887575-104887597 CATGATAGCCAAAATGTTTATGG - Intronic
1045783133 8:105891345-105891367 ATTAATATGCAGAATATGTAAGG + Intergenic
1046616110 8:116479240-116479262 CTTGATTTGCTTATTGTTTAAGG + Intergenic
1047572831 8:126119207-126119229 GTTAATATGCAGAATATCTAAGG - Intergenic
1048090973 8:131239772-131239794 CTAGGTATCCAGATTGTTTAGGG + Intergenic
1049922594 9:379264-379286 CTTGATATGCAGACATTTTTAGG + Intronic
1052274021 9:26657918-26657940 CTCAAGATGCAGAATGTTTTAGG - Intergenic
1053640276 9:40068064-40068086 TTTGATATCCAGAATATATAAGG + Intergenic
1053765859 9:41397413-41397435 TTTGATATCCAGAATATATAAGG - Intergenic
1054320973 9:63664068-63664090 TTTGATATCCAGAATATATAAGG + Intergenic
1054544471 9:66308570-66308592 TTTGATATCCAGAATATATAAGG - Intergenic
1055664659 9:78541260-78541282 CTAGACATTCTGAATGTTTAAGG + Intergenic
1058827761 9:108790084-108790106 CTTGATATGGGGGATGGTTATGG + Intergenic
1059518056 9:114914042-114914064 TTTGATTTGCAGAATGATTCTGG - Intronic
1059991031 9:119866610-119866632 TTTGATATCCAGAATCTATAAGG + Intergenic
1059999972 9:119949697-119949719 TTTGTTATGCAGCATTTTTATGG - Intergenic
1061368728 9:130186136-130186158 CTTGATTTAGAGAATGTTTATGG + Intronic
1187851619 X:23596715-23596737 CTTGGTTTTCAGAAGGTTTAAGG + Intergenic
1188099340 X:26063520-26063542 TCTGATATGCAGGAAGTTTATGG + Intergenic
1188864405 X:35297275-35297297 TTTGAAAAGCTGAATGTTTATGG - Intergenic
1189868375 X:45355139-45355161 ATTGATAATCAGAATATTTATGG - Intergenic
1189874593 X:45422524-45422546 TCTGATATCCAGAATGTATAAGG + Intergenic
1191771867 X:64769286-64769308 CTTGATTTTCAAAATGTTAACGG - Intergenic
1192924343 X:75740041-75740063 CTTAAAATGCAGAATCTTTGAGG + Intergenic
1193444463 X:81583167-81583189 TTTAATATCCAGAATCTTTAAGG + Intergenic
1193934423 X:87599302-87599324 TTTGATATGTAGAATAATTAAGG - Intronic
1194325093 X:92505036-92505058 CCTAATATCCAGAATGTATAAGG - Intronic
1196357174 X:114808845-114808867 ATTAATAAGCAGAATGTATAAGG - Intronic
1196428207 X:115593870-115593892 CTTTATTTAGAGAATGTTTAGGG + Intronic
1198417161 X:136432272-136432294 ATTGATATGCATAATTGTTAGGG + Intergenic
1199198070 X:145056033-145056055 CTTCAGTTGCAGAGTGTTTATGG + Intergenic
1200389196 X:155926579-155926601 GCTGATATGGAGAATGTTTTAGG - Intronic
1200633827 Y:5624216-5624238 CCTAATATCCAGAATGTATAAGG - Intronic
1202598347 Y:26567194-26567216 TTTGATATGAAGGATTTTTAAGG - Intergenic