ID: 963943864

View in Genome Browser
Species Human (GRCh38)
Location 3:151123709-151123731
Sequence ACAGGCACTCCTAACACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963943864_963943867 21 Left 963943864 3:151123709-151123731 CCTTTAGTGTTAGGAGTGCCTGT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 963943867 3:151123753-151123775 TTTCCTTACCAGCTTGGTACAGG 0: 1
1: 0
2: 1
3: 7
4: 157
963943864_963943866 15 Left 963943864 3:151123709-151123731 CCTTTAGTGTTAGGAGTGCCTGT 0: 1
1: 0
2: 0
3: 10
4: 101
Right 963943866 3:151123747-151123769 TTAAGTTTTCCTTACCAGCTTGG 0: 1
1: 0
2: 1
3: 17
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963943864 Original CRISPR ACAGGCACTCCTAACACTAA AGG (reversed) Intronic
905151017 1:35927824-35927846 ACAGACACAGCTAACACTGAAGG - Exonic
906587702 1:46994362-46994384 ACAGGCACTGCCAGCACTAAGGG - Intergenic
906749978 1:48250091-48250113 ACATGCAGGCCTAACACTCATGG - Intergenic
908494580 1:64681480-64681502 ACACGTACTCCTAACAAAAAAGG - Intronic
910610389 1:89134703-89134725 ACAGACACTTCAAAGACTAAAGG + Intronic
913284370 1:117213404-117213426 ACAGGGACCCCTATCACTTATGG - Intergenic
915924761 1:160008061-160008083 AGAGGCCCTCAAAACACTAAAGG + Intergenic
916349165 1:163829512-163829534 ACAGGCACTACCAACCCTAGTGG + Intergenic
922023111 1:221724046-221724068 AAAGACACTCCTAACACTCGGGG + Intronic
1066575901 10:36824527-36824549 CCAGTCACTCCTCACACAAAGGG - Intergenic
1067918139 10:50422690-50422712 ACAGGTGCTCCTAACCATAATGG + Intronic
1068173432 10:53424948-53424970 ACATGCAATCCTAACACTTTGGG - Intergenic
1071384344 10:85104458-85104480 ACAGGCAGTGCTAACAATCATGG - Intergenic
1074701264 10:116094856-116094878 ACAGGCACCCTGAACACTAGGGG + Intronic
1074911288 10:117911674-117911696 AGAGACACTCCTATCACTCAGGG + Intergenic
1075522869 10:123154599-123154621 CCGGGCACTCCTAAAAATAAAGG - Intronic
1079466532 11:20736244-20736266 ACATGCTCTCCAAACACTCACGG + Intronic
1083006822 11:59355037-59355059 ACAGTCAGTCCCCACACTAATGG + Intergenic
1084853105 11:71959976-71959998 ACAGTCACTCCTACCACTCTGGG - Intronic
1088200022 11:107321844-107321866 ACAGGTCCTCCTCACACTTAAGG - Intergenic
1088722844 11:112609594-112609616 ACAGTTCCTCCTAACCCTAAAGG - Intergenic
1100389715 12:94137845-94137867 ACATCCACTCTTAACACTAGTGG + Intergenic
1100842230 12:98624430-98624452 ACAGGCCCTCCTAACTCCAGTGG + Exonic
1107838206 13:44429192-44429214 ACGGTCACTCCTAACTCCAAGGG + Intergenic
1110201679 13:72857933-72857955 ACAGGCAATCTTAACATTAGTGG + Intronic
1110765856 13:79278985-79279007 ACCGCCACTCTTAACTCTAAAGG + Intergenic
1111018812 13:82418680-82418702 ACTGGTACTCCTAGAACTAAAGG - Intergenic
1120061592 14:79989744-79989766 ACAGACACTCCTAGCACAGAAGG - Intergenic
1120837554 14:89055048-89055070 TCAGGGACTCCCACCACTAATGG - Intergenic
1122924268 14:104892491-104892513 CCTGGCACTCCTCACACTGAGGG - Intronic
1123149076 14:106164281-106164303 ACAAGCTCTTCTAACACTACTGG + Intergenic
1123401744 15:19994186-19994208 ACAGGCACTCCCAAGAAGAAGGG - Intergenic
1123511085 15:21000847-21000869 ACAGGCACTCCCAAGAAGAAGGG - Intergenic
1127601512 15:60542450-60542472 ACAGGCACACCTCACACACACGG + Intronic
1131872255 15:96775200-96775222 ATAGGCACTCCCAAAACTAAAGG - Intergenic
1135165181 16:20132890-20132912 ATAGTCATTCCTAACCCTAAGGG - Intergenic
1136681147 16:31963276-31963298 ACAGGCTCTTCTAACACTACCGG - Intergenic
1136781462 16:32904788-32904810 ACAGGCTCTTCTAACACTACCGG - Intergenic
1136888335 16:33949052-33949074 ACAGGCTCTTCTAACACTACCGG + Intergenic
1137506183 16:49055953-49055975 ACAGACACTGCAAACAATAAGGG + Intergenic
1139091331 16:63651423-63651445 AGAGGGACTCCTAACACCATTGG - Intergenic
1139640396 16:68287542-68287564 ACAGGCACTTCCATCACTACTGG - Intronic
1203084114 16_KI270728v1_random:1168770-1168792 ACAGGCTCTTCTAACACTACCGG - Intergenic
1145990526 17:29076804-29076826 CCAGGCACTCCTTAGCCTAACGG - Exonic
1147323521 17:39659582-39659604 ACAGAAACTCCTAACACGCATGG - Intronic
1153235249 18:2980019-2980041 ACAAACACTCCTAAAACTTAGGG + Intronic
1154928354 18:20963770-20963792 ACAGGCACCCATAACCGTAAGGG + Intronic
1168303369 19:55419637-55419659 ACAGGCACCCCTGAGACTGAAGG - Intergenic
925585983 2:5464616-5464638 GCAGCCACTCCTAAAACAAAAGG + Intergenic
927926515 2:27017415-27017437 ACAGGCACTGCTGCCACTCATGG + Intronic
930520283 2:52457137-52457159 AAAGACACTCCTACCACTCAGGG - Intergenic
932112589 2:69014020-69014042 ACAGGCACTCCTAAAGTTAGAGG + Intronic
935693888 2:105754002-105754024 AGTGGCCCTCCTAACACAAAAGG - Intronic
939203079 2:139063221-139063243 ACAAGCACTCCTAAGACTCTTGG - Intergenic
940784791 2:157969861-157969883 AGAGACACACCTAACACAAAAGG - Intronic
941854441 2:170216379-170216401 ACAGTCACACCTAACACGGAGGG - Intronic
942247213 2:174018933-174018955 GCAAGCGCTTCTAACACTAAGGG - Intergenic
942308781 2:174634802-174634824 CCAGGCACTCCTGACTCCAAAGG + Intronic
943263184 2:185692640-185692662 ACAGGCACTGCTCACACTCAAGG - Intergenic
1168925509 20:1575732-1575754 ACAGGCCCTCCTACCCCTACAGG + Intronic
1168929387 20:1608760-1608782 ACAGGCCCTCCTACCCCTACAGG + Intronic
1169243647 20:4007283-4007305 TCAGGTACTTCTAACCCTAAGGG - Intronic
1169980171 20:11375894-11375916 ACAGGCAGGCATAAAACTAAGGG - Intergenic
1172870547 20:38132820-38132842 ACAGGCACTCCTAAGGCTGTGGG + Intronic
1174868323 20:54160108-54160130 ACAGGCACTACCTACACTGAGGG + Intronic
1179976041 21:44867172-44867194 AAAGGCATTCCAAACACAAAAGG + Intronic
1181589159 22:23872468-23872490 ACAGGCTCTCCTAAAGCTAAAGG + Intronic
949788725 3:7769811-7769833 CCAGCCACTCCCAACACTAGGGG + Intergenic
950431730 3:12954822-12954844 GCCAGCACTCCTAACACAAAGGG + Intronic
950549130 3:13655640-13655662 ACAGGCACTAATGGCACTAATGG - Intergenic
951707756 3:25560558-25560580 ACAGACAGTCCTAACATTAGAGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
956789568 3:72670210-72670232 ATAGGCACTACTAATACTATGGG + Intergenic
960674192 3:120179251-120179273 ATAGGCACTCCTATCTCTATGGG + Intronic
963943864 3:151123709-151123731 ACAGGCACTCCTAACACTAAAGG - Intronic
964644035 3:158938724-158938746 AGAGGCACACCTAACACATAAGG + Intergenic
967929088 3:194677640-194677662 ACAGATACTACTAACACAAATGG + Intergenic
970855311 4:20644448-20644470 ACAGACACACCTAACACAAAGGG - Intergenic
980700857 4:136428393-136428415 AAAGACACTCCTATCACTTACGG - Intergenic
981717319 4:147764382-147764404 CCAGGCACACCTAACACTATAGG + Intronic
985571546 5:648442-648464 ACAGTCACACCTCACACTCAGGG - Intronic
985571612 5:649023-649045 ACAGTCACACCTCACACTCAGGG - Intronic
987390104 5:17367508-17367530 AAAGACACTCCTATCACTCAAGG + Intergenic
989624975 5:43420486-43420508 ACAGGCATTCCTTTCAGTAACGG - Intergenic
992911904 5:81403189-81403211 ACAAGCAATCCTAACACTTTAGG - Intergenic
993850588 5:93002759-93002781 CCATGCCCTCTTAACACTAATGG + Intergenic
997335547 5:133106731-133106753 ACAAGGATTCCTAACACCAAAGG - Intergenic
998170026 5:139867296-139867318 ACACACACTCCTACCACTACAGG - Intronic
1003569675 6:7247655-7247677 AAAGGCCCTCCTGACCCTAATGG - Intronic
1003803777 6:9702188-9702210 ACAGCCACTTCTAACTCAAAAGG + Intronic
1005410852 6:25544639-25544661 ACACACACCCCAAACACTAAAGG + Intronic
1005559773 6:27026561-27026583 ACAGGGAATACCAACACTAAAGG - Intergenic
1005990853 6:30901060-30901082 ACAGGTACTGCTAATACTACTGG + Intergenic
1010205709 6:73321000-73321022 ACAGGCACTGCCTACACTTAAGG - Intergenic
1014083785 6:117317983-117318005 ACAGGCAATCCTCAGACAAAAGG - Intronic
1020787636 7:12590805-12590827 AAAGGAACCCCTATCACTAATGG - Intronic
1022517157 7:30983394-30983416 ACACTCACTGCTGACACTAATGG - Intronic
1028423236 7:90656871-90656893 ACAGGCACAACTAACAATAGTGG + Intronic
1036771067 8:11578718-11578740 ACAGGCACTCAGAACACCGAGGG - Intergenic
1037397825 8:18461336-18461358 AAAGACACTCCTATCACTCAGGG - Intergenic
1040499310 8:47993030-47993052 AAAGGGACCCCTATCACTAACGG - Intergenic
1045830989 8:106459824-106459846 AAAGACACTCCTTATACTAAAGG + Intronic
1045921048 8:107529514-107529536 ACAGGCCCTCCTTCCATTAATGG + Intergenic
1046360647 8:113150164-113150186 ACAGGCTCTTCTCACACTCAAGG - Intronic
1051376119 9:16404709-16404731 TCAGGAACTGCTAACTCTAAGGG + Intergenic
1186873007 X:13790886-13790908 ACAGGCACTCCCAGCACTTTAGG - Intronic
1187513863 X:19947616-19947638 ACAAGCACACCTAACACTTGGGG - Intronic
1192264934 X:69531512-69531534 ACAGGCCCTGCTGGCACTAAAGG - Exonic
1193049096 X:77082410-77082432 ACAGGCACTCTTATCAGCAAAGG - Intergenic
1193350466 X:80457735-80457757 ATAGGCACTGCTAACAGTAGTGG + Intergenic
1193699198 X:84742286-84742308 AAAGGGACGCCTATCACTAACGG + Intergenic
1195222691 X:102761660-102761682 GCAGGCTCTCCTAAGGCTAATGG - Intergenic