ID: 963945010

View in Genome Browser
Species Human (GRCh38)
Location 3:151136053-151136075
Sequence CTGTGCCACCTGAGGTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963945005_963945010 -7 Left 963945005 3:151136037-151136059 CCCCTAGTCATTTCCTCTGTGCC 0: 1
1: 0
2: 0
3: 33
4: 403
Right 963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG 0: 1
1: 0
2: 6
3: 18
4: 195
963945006_963945010 -8 Left 963945006 3:151136038-151136060 CCCTAGTCATTTCCTCTGTGCCA 0: 1
1: 1
2: 2
3: 25
4: 272
Right 963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG 0: 1
1: 0
2: 6
3: 18
4: 195
963945007_963945010 -9 Left 963945007 3:151136039-151136061 CCTAGTCATTTCCTCTGTGCCAC 0: 1
1: 0
2: 1
3: 24
4: 204
Right 963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG 0: 1
1: 0
2: 6
3: 18
4: 195
963945004_963945010 14 Left 963945004 3:151136016-151136038 CCTGGGGCACTGCTCTGTTTACC 0: 1
1: 0
2: 0
3: 11
4: 147
Right 963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG 0: 1
1: 0
2: 6
3: 18
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963945010 Original CRISPR CTGTGCCACCTGAGGTTTTG TGG Intronic
900932057 1:5743777-5743799 CTGGGCCACCTCAGGGCTTGGGG - Intergenic
901218887 1:7570945-7570967 CTGTGTCGCCGGAGGTTGTGAGG + Intronic
907421230 1:54348683-54348705 CTGTGCCAGCTTAGGGTCTGTGG + Intronic
908721357 1:67129535-67129557 GTGTGCAACCTGAGGTTGTGTGG - Intronic
909489045 1:76206262-76206284 CTGTGAGAGCTGAGGGTTTGTGG + Intronic
909642416 1:77883430-77883452 CTGTGCAGCCTGGGGTTTGGGGG + Intergenic
910106122 1:83633000-83633022 ATCTGCCACCTGAGGGGTTGCGG - Intergenic
910156338 1:84224477-84224499 ATATGCCACCTGAGGGTTTAGGG - Intronic
910289898 1:85589454-85589476 CTGAGCCACCTGGGGCTTGGGGG - Intergenic
910813531 1:91263758-91263780 CTGTGGGACCTGAGGATTTGGGG - Intronic
911042450 1:93601545-93601567 CTGTGTCACCTGTGTATTTGTGG - Intronic
911080199 1:93921412-93921434 CTGTGCCAGCTGGGTTTCTGAGG + Intergenic
911868459 1:103059267-103059289 CTGTTCCACCTAAGGTCATGGGG + Intronic
915590024 1:156865353-156865375 CTGTTCCACCTCAGATTATGAGG + Intronic
917113164 1:171573412-171573434 CTGTACCATCTGAGATTTTGTGG - Intronic
917441694 1:175074156-175074178 GTGTGCCACTGGAGGTTTGGGGG - Intronic
917811854 1:178666646-178666668 CTTGGCCACTTTAGGTTTTGAGG + Intergenic
918072331 1:181142040-181142062 CTGTGCATCCTGGGGCTTTGGGG + Intergenic
918138272 1:181697238-181697260 CTGTGCCACCTGAGGCCCTTAGG - Intronic
918979126 1:191532513-191532535 CTGTTCCACCTCAGATTTTCTGG + Intergenic
919862331 1:201748492-201748514 TTTTGCCCCCTGAGGTTCTGAGG - Intronic
922175277 1:223192689-223192711 CAGGGCCACCTAAGGTTTTAGGG + Intergenic
924563721 1:245178756-245178778 TGGTGTCACCTTAGGTTTTGGGG + Intronic
924946721 1:248851443-248851465 CTGTACACCCTGAGGTTTGGTGG - Intronic
1066291395 10:34017444-34017466 CTGGGGCACCTGAGGCTTGGAGG + Intergenic
1069719274 10:70539441-70539463 CTGTGACCCCTGAGGCTTGGGGG + Intronic
1069728506 10:70596411-70596433 CTGTCCCACCTGGGGATTTAGGG + Intergenic
1070579829 10:77710967-77710989 CTGTGGGATCTGAGGTTTAGTGG - Intergenic
1072399940 10:95087424-95087446 CTGTGCAGCCTGAGGTTTTGGGG + Intergenic
1073592367 10:104769337-104769359 CTGTGCCCACGGAGGTGTTGTGG + Intronic
1075264017 10:120985494-120985516 GCGTACCACCTGAGGTTCTGTGG - Intergenic
1077487184 11:2844409-2844431 CTGTGCCAACTGGGGCTTTGAGG - Intronic
1077971969 11:7203629-7203651 TTGTGAAAACTGAGGTTTTGAGG - Intergenic
1078250858 11:9615166-9615188 CTGTGCCCCTTGGAGTTTTGGGG - Intergenic
1080202110 11:29684256-29684278 CTGTTCCACCTCAGATTTTCAGG + Intergenic
1080318351 11:30976294-30976316 CTTTGCTACCTGTGCTTTTGGGG - Intronic
1084643939 11:70443393-70443415 CAGTTCCAACTGAGGTTTGGAGG + Intergenic
1085088442 11:73689268-73689290 CTGTTCCACCTGTGATTTTCAGG + Intronic
1088725022 11:112626865-112626887 CAGTGCCAACTGAGATGTTGAGG - Intergenic
1089816614 11:121182350-121182372 ATGTGCCACCTGAGGACCTGAGG - Intronic
1091298395 11:134489407-134489429 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298404 11:134489440-134489462 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298413 11:134489473-134489495 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298426 11:134489539-134489561 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298435 11:134489572-134489594 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298450 11:134489638-134489660 CTGTGTGACCTGAGGTTGTCAGG - Intergenic
1091298473 11:134489737-134489759 CTGTGTCACCTGAGATTGTCAGG - Intergenic
1091298481 11:134489770-134489792 CTGTGTGACCTGAGGTTGTGAGG - Intergenic
1094602052 12:31917658-31917680 GTGTGACTCTTGAGGTTTTGGGG + Intergenic
1095214849 12:39536321-39536343 CAGTGCCACCAGAGTTTCTGTGG - Intergenic
1096125591 12:49117105-49117127 CTGTGCCCTCTGGGGTTTTGAGG + Intergenic
1097394882 12:59061260-59061282 ATGTGACACCTGAAGTTGTGGGG + Intergenic
1100590447 12:96023330-96023352 ATGTGCCAGCTGAGGTTGCGAGG + Intronic
1100698131 12:97117638-97117660 CTGTTTCACCTGACATTTTGAGG - Intergenic
1101791646 12:107933260-107933282 CTGTAGCCACTGAGGTTTTGAGG + Intergenic
1103036912 12:117664235-117664257 CTGGGCACCCTGAGGTTGTGAGG + Intronic
1104856266 12:131903830-131903852 TGGTGCCCCCTGAGGTTTTGGGG + Intronic
1106421788 13:29591439-29591461 CTCTGCAACATGAGGTTATGGGG - Intronic
1107828358 13:44351251-44351273 CTGTGCCCCCACATGTTTTGAGG - Intergenic
1108421955 13:50259869-50259891 CTGAGATACCTGAGGTTCTGAGG + Intronic
1110363834 13:74659372-74659394 CTGTTCCACCTCAGGTCATGAGG + Intergenic
1110654930 13:77986771-77986793 CTGTGCCACCTTAGTTCTTCAGG + Intergenic
1111178627 13:84632851-84632873 ATACGCCAACTGAGGTTTTGTGG + Intergenic
1112116843 13:96365285-96365307 CTGTGCCACGTGAGGCATTGTGG + Intronic
1112584677 13:100707900-100707922 GAGAGACACCTGAGGTTTTGAGG - Intergenic
1117293630 14:54358198-54358220 CTTTGTCACCTGTGCTTTTGGGG + Intergenic
1118592368 14:67411269-67411291 CTGGGCCACCTGGGGTGGTGGGG + Intronic
1118956722 14:70489447-70489469 TGGACCCACCTGAGGTTTTGAGG + Intergenic
1119392237 14:74298792-74298814 CTGTGCCACCTGTTTTCTTGGGG - Intronic
1122856733 14:104563651-104563673 CTGTGCCCCTTGAGGGCTTGTGG - Intronic
1122919828 14:104875427-104875449 CTGTGGCTCCTGAGGTTTGGGGG + Intronic
1125465858 15:39951760-39951782 CTTTACCACCTGTGGATTTGTGG + Intronic
1125467325 15:39966872-39966894 CTTTGCCATGTGAGGTTCTGAGG + Intronic
1125745989 15:41997475-41997497 TTGTGCCAGCTAAGGCTTTGGGG - Intronic
1126073585 15:44886984-44887006 CTGTGCCACCACAGGATGTGGGG - Intergenic
1129190424 15:73934255-73934277 CAGTGCCACCAGACGTTTTATGG + Intronic
1129785387 15:78306734-78306756 CTCTGCCAGCTGGGGTTCTGAGG - Intergenic
1130991350 15:88877734-88877756 CTGGGCCATTTGCGGTTTTGTGG - Exonic
1132752638 16:1465853-1465875 CTCAGCCACCTAAGGCTTTGCGG + Intronic
1135407886 16:22211125-22211147 CTGTGCCACCTGTGGTTTTCAGG + Intronic
1135851473 16:25967812-25967834 CTGTGCCAGCTGTGGGCTTGTGG + Intronic
1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136882946 16:33913965-33913987 CTGGCCCCACTGAGGTTTTGGGG - Intergenic
1137822823 16:51462065-51462087 CTGTTCCATCTGAGGTTCTGGGG - Intergenic
1139883505 16:70192776-70192798 CTGTGCCAGCAGAGGCTGTGGGG - Intergenic
1140369005 16:74402743-74402765 CTGTGCCAGCAGAGGCTGTGGGG + Intergenic
1141138391 16:81481574-81481596 CTGTTTCAACTGAGGTCTTGGGG + Intronic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1143011917 17:3870678-3870700 CTTTGCCACCAGTGGTCTTGGGG + Intronic
1144117599 17:12114053-12114075 ATGTGACACATAAGGTTTTGTGG + Intronic
1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG + Intronic
1147186269 17:38714969-38714991 TTGTTCCACCTGAGGTATTTAGG + Intronic
1147619269 17:41853822-41853844 TTCTGCCACATCAGGTTTTGAGG + Exonic
1148989773 17:51655763-51655785 CTGAGCCTCCTGAGGTGTAGAGG + Intronic
1149048746 17:52279401-52279423 CAGTGCAACCTCAGATTTTGTGG - Intergenic
1152065080 17:78107985-78108007 CTGTGCCACCTGAGATTCTGGGG - Exonic
1152625050 17:81384211-81384233 CTGTGCACCCTGGCGTTTTGGGG + Intergenic
1156211036 18:34943148-34943170 GGGCGCCACCTGAGGTTTTCAGG - Intergenic
1157599952 18:48887779-48887801 CTCTCCCACCTGAGGTCATGAGG + Intergenic
1159197835 18:65141528-65141550 CTTTGGCACCCAAGGTTTTGTGG - Intergenic
1161575679 19:5052987-5053009 CTGGGCCACCAGAGGTTGGGTGG + Intronic
1167871858 19:52377297-52377319 CTTTGCCTCTTGAGGTCTTGTGG + Intronic
1168116298 19:54222839-54222861 GGGTGCCTCCTGAGCTTTTGAGG + Intronic
1168119282 19:54242614-54242636 TGGTGCCTCCTGAGCTTTTGAGG + Intronic
929024328 2:37585239-37585261 CTGTTCCACCTGAAGATTTGAGG - Intergenic
929910850 2:46088344-46088366 CAGTGCTACATGGGGTTTTGGGG - Intronic
930046716 2:47178792-47178814 CTCTTCCATCTGAGGATTTGAGG - Intergenic
930692818 2:54381705-54381727 CTGTGCCATCTGCCCTTTTGAGG + Intronic
932627980 2:73314134-73314156 CTTTCCCACCTGAGGTTGTCTGG + Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936636125 2:114260612-114260634 TTGTGCCCCCAGGGGTTTTGTGG + Intergenic
942549023 2:177095093-177095115 GTGTGCCACTTGAGATTTTCTGG - Intergenic
942858480 2:180581391-180581413 GAGAGCCACCTGAGGGTTTGGGG - Intergenic
943288996 2:186043768-186043790 CTGAGACACCTGAGGTTGAGGGG + Intergenic
944671112 2:201995408-201995430 CTGGCCCACCTGAGCTCTTGGGG - Intergenic
948845237 2:240679963-240679985 CTCTGCCTCCTGAGGCTTTAGGG + Intronic
948848623 2:240694916-240694938 CTCTGCCTCCTGAGGCTTTAGGG - Intronic
1170398060 20:15949330-15949352 CTGTGCCACCTGGGGTAGTTAGG - Intronic
1170550538 20:17472340-17472362 CTGTGCCACCTGGGGGACTGTGG + Intronic
1170582522 20:17710092-17710114 CTGTGCCACCTGAGGGGTGTGGG + Intronic
1173940818 20:46909684-46909706 CTGTGCCACCTGTGGAGCTGTGG + Intronic
1175874341 20:62222283-62222305 CTGTCCCTCCTGAGGCTCTGGGG - Intergenic
1177023735 21:15895979-15896001 CTGTGCTGCCTGGGGTTTGGGGG - Intergenic
1180014417 21:45073368-45073390 GTGGGCCGCCTGAGGTTTGGAGG + Intergenic
1181263500 22:21615785-21615807 GTGTTCCAGCTGAGGTTGTGTGG + Intronic
1181410666 22:22716339-22716361 CTCAGCAACCTGAGGTATTGAGG - Intergenic
1181418071 22:22774499-22774521 CTGTGTCACCCGTTGTTTTGGGG - Intronic
1181418221 22:22775597-22775619 CTCAGCAACCTGAGGTATTGAGG - Intronic
1181955804 22:26587193-26587215 CCTTGCCAGCTGAGGCTTTGTGG - Intronic
1183436957 22:37802001-37802023 CTGCACCACCTGTGGTCTTGTGG - Intergenic
1183896454 22:40973228-40973250 CTGTTCCACCTGAGATCATGAGG + Exonic
1184258855 22:43303010-43303032 CTGTGTCACCTGGGGTGTCGTGG - Intronic
1184627926 22:45752524-45752546 CAGTGGCACCTGAGGGGTTGGGG + Intronic
954376157 3:50195161-50195183 CTGTGACACCTGAGGTCTTGGGG - Intronic
957200084 3:77122709-77122731 CTGTTCCACATGTGGTGTTGTGG + Intronic
959162737 3:102740258-102740280 CTGTGCCTTCAGAGGCTTTGGGG - Intergenic
959373647 3:105560926-105560948 CTGTGCCACAAAAAGTTTTGTGG + Intronic
959620744 3:108396371-108396393 CTGTTCCACCTCAGATTATGAGG + Intronic
960470393 3:118057586-118057608 ATGAGCCACCTAAGGTTTTGTGG + Intergenic
960615545 3:119592616-119592638 CTGAGCAACCTGAGGCTTGGAGG - Intergenic
960907916 3:122620200-122620222 CTGTGCCACAGGTGGTTTTGAGG + Intronic
961947838 3:130712749-130712771 CTGTGCTACCTGAGTTTCTTAGG - Intronic
963200090 3:142577994-142578016 CTGTGCACGCTGAGATTTTGTGG + Intronic
963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG + Intronic
963982228 3:151551355-151551377 CTGTGATACCTGAGGATGTGTGG - Intergenic
963988683 3:151627898-151627920 ATGTCCCATCTGAGGGTTTGAGG - Intergenic
964434112 3:156634345-156634367 CTCTGGCAGCTGAGGTGTTGGGG - Intergenic
964644767 3:158947344-158947366 CTGTGGCTCCTGAGCCTTTGTGG + Intergenic
965168707 3:165231718-165231740 CTGTGACACCTAAGGATTTTGGG + Intergenic
968294802 3:197567729-197567751 ATGAGGCACCTGAGATTTTGGGG + Intronic
968730534 4:2267417-2267439 CAGTGCAACTTGAGGTGTTGGGG - Intergenic
969542662 4:7803451-7803473 CTGGGTCCCCTGTGGTTTTGGGG - Intronic
972744831 4:41922719-41922741 CTGTTCCACCTGAGATTATCAGG - Intergenic
980457867 4:133069157-133069179 ATGTGCCACCTGTGGTCCTGGGG - Intergenic
980752640 4:137111957-137111979 CTTTGCTACCTAAGCTTTTGAGG + Intergenic
984811845 4:183802108-183802130 CTGTGCTCCCTGAGGTCTGGAGG - Intergenic
984944067 4:184957573-184957595 CTGTGCCACTTGAGGGCCTGAGG + Intergenic
986495675 5:8339476-8339498 CTGTGCAACATGAGGCTTTTAGG - Intergenic
988399997 5:30750422-30750444 CTCTGCCACTTTAGGTTTTGCGG - Intergenic
989421073 5:41240548-41240570 ATGTGCCACCTGAGGGTATGGGG - Intronic
991430443 5:66539296-66539318 CTGGGCCATCTGAGGGCTTGGGG - Intergenic
992759436 5:79938563-79938585 CTGTGCCCACTGAGGTTTTGTGG - Intergenic
994410410 5:99400984-99401006 CTGTGCTGGCTGGGGTTTTGAGG - Intergenic
994483414 5:100364286-100364308 CTGTGCTGGCTGGGGTTTTGAGG + Intergenic
996477499 5:123937791-123937813 CTGTGGCAACTGAGGATTTCTGG - Intergenic
997463617 5:134071981-134072003 CTTTGGCATCTGAGGTTGTGTGG + Intergenic
998121519 5:139581955-139581977 CTGTGCCAGCTGTTTTTTTGGGG + Intronic
998498908 5:142614884-142614906 CTGTGCCACATGAAGCTATGTGG - Intronic
999060667 5:148631136-148631158 CTGTGCCACTTGGGGTTATGGGG - Intronic
1004046702 6:12031937-12031959 CTGTGCAACTTGATGTTATGAGG - Intronic
1005660172 6:27990254-27990276 CTGTGACACCTTATATTTTGTGG - Intergenic
1007508774 6:42359210-42359232 CTGTGGCACCAGAGGCTTTCTGG + Intronic
1009657834 6:66568882-66568904 CTGGGTCAACTGAGGTTTTCTGG - Intergenic
1015038321 6:128685388-128685410 AAGTTCCACCTGGGGTTTTGGGG + Intergenic
1015055470 6:128897609-128897631 CAGTTCCAACTGCGGTTTTGGGG - Intronic
1016373048 6:143394002-143394024 CTCTGCCTCCCGAAGTTTTGGGG + Intergenic
1027883704 7:83875099-83875121 CTGTGTCACCTGAGTATTAGGGG - Intergenic
1028138710 7:87248378-87248400 CTGTGCCAGATGAGATTTTCAGG + Intergenic
1029172661 7:98641873-98641895 CTGTGCCAGCTGAGGGTTTGGGG + Intergenic
1031842197 7:126757324-126757346 AGGTGCCAGCTGAGGATTTGGGG + Intronic
1032673356 7:134106344-134106366 CTGTGCCCACTAGGGTTTTGGGG + Intergenic
1037046994 8:14318690-14318712 CTGTCTCTTCTGAGGTTTTGAGG - Intronic
1038046980 8:23773848-23773870 CACTGCCACCTCAGCTTTTGGGG + Intergenic
1039678330 8:39698526-39698548 CTGTGACTCCTGATGTGTTGGGG - Intronic
1040595523 8:48834435-48834457 CTGTCCCTCCTGGGGTTTGGGGG - Intergenic
1041039222 8:53829146-53829168 CTGTATCACCTGAGGCTTTCTGG - Intronic
1041537877 8:58948170-58948192 GTTTGCCAGCTGAGGCTTTGAGG + Intronic
1041795242 8:61740238-61740260 CTGTGACAACTGAAGGTTTGTGG + Intergenic
1042094856 8:65203159-65203181 GTGTGCCACCAAATGTTTTGTGG - Intergenic
1045501099 8:102745094-102745116 CTCTGCCTCATGCGGTTTTGGGG - Intergenic
1045718660 8:105079625-105079647 CTGGTTCAACTGAGGTTTTGAGG - Intronic
1046748180 8:117898154-117898176 CTGTGACACCTCTGATTTTGAGG - Intronic
1047632538 8:126724068-126724090 CTGTGCCACCTGGGCTCCTGTGG - Intergenic
1047763324 8:127970205-127970227 GTGTGCCCCCTGAGGGTCTGAGG - Intergenic
1048737250 8:137515423-137515445 CTGTGACCTCTGGGGTTTTGGGG + Intergenic
1048743246 8:137585552-137585574 CTGTGCCAACTGAGGTGATGAGG - Intergenic
1051330855 9:16023778-16023800 CTGTCACAGCTGAGGTTTTCTGG + Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053428158 9:38024650-38024672 CTCTACCACTTGAGGTTCTGGGG - Intronic
1053494380 9:38539377-38539399 CTCAGCCTCCTGAGTTTTTGTGG + Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056268091 9:84919844-84919866 CAGTGCCTCATGAGGTTGTGAGG + Intronic
1058340529 9:103890506-103890528 CTGTGGTGCCTGTGGTTTTGAGG + Intergenic
1059967580 9:119630896-119630918 CTGTGCAAGCTGAAGTTCTGAGG + Intergenic
1062191713 9:135251280-135251302 CTTTGACTCATGAGGTTTTGAGG - Intergenic
1186841830 X:13492222-13492244 CTCAGGCACCTCAGGTTTTGGGG + Intergenic
1187625276 X:21105216-21105238 TTGTGACTCCTGGGGTTTTGGGG + Intergenic
1192548690 X:72036048-72036070 CTGTTCCACCTCAGGTTATCAGG - Intergenic
1193204914 X:78736805-78736827 CTGTGCAGCCTGAGGTTGGGAGG + Intergenic
1195100330 X:101549500-101549522 CTGAGGCACCTGAGGGTGTGAGG - Intergenic
1199069745 X:143462425-143462447 CTGTGCCCGCTGGGGTCTTGGGG - Intergenic
1199214832 X:145251959-145251981 TTGTGCTACCTGAGATTTTGTGG + Intronic
1201941496 Y:19465524-19465546 CTGTGCCATCAAAGGCTTTGGGG + Intergenic