ID: 963948558

View in Genome Browser
Species Human (GRCh38)
Location 3:151172506-151172528
Sequence AGGCACAGCCAGGATCTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963948554_963948558 1 Left 963948554 3:151172482-151172504 CCATCACGCAGTCTACTAATCAT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 963948558 3:151172506-151172528 AGGCACAGCCAGGATCTTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 164
963948553_963948558 2 Left 963948553 3:151172481-151172503 CCCATCACGCAGTCTACTAATCA 0: 1
1: 0
2: 0
3: 4
4: 42
Right 963948558 3:151172506-151172528 AGGCACAGCCAGGATCTTTTGGG 0: 1
1: 0
2: 1
3: 16
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963948558 Original CRISPR AGGCACAGCCAGGATCTTTT GGG Intronic
900414533 1:2528939-2528961 AGGCACACTCAGGAGCCTTTTGG + Exonic
900644488 1:3702833-3702855 GGGCACAACCAGGACTTTTTTGG - Intronic
902393684 1:16120568-16120590 AGTCAGAGCCAGGCTCTTCTGGG + Intergenic
902633344 1:17718955-17718977 AGGCACAGCGAGGGTCTCTCTGG + Intergenic
905051210 1:35052676-35052698 TGGCACAGACAGAACCTTTTAGG - Intergenic
905651016 1:39657024-39657046 CTGCACAGCCAGGATCCTTCTGG - Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
908605646 1:65793745-65793767 AGGCTCTGCCAGGAACTTTTGGG + Intronic
914931732 1:151940714-151940736 AGGCACTGCCAGCATTTTCTGGG - Intergenic
915240386 1:154516955-154516977 AGGCACAGCAAGGACATTGTAGG + Intronic
915606910 1:156958061-156958083 AGGCACAGCCAGGCACTTTAAGG - Intronic
915935865 1:160089943-160089965 GGGCACAGCCAGGGTCCTATGGG + Exonic
917435914 1:175021160-175021182 AGTCAAAGCCAGGAGCTTTCAGG - Intronic
918558293 1:185831961-185831983 AAGTACAGGCAGGATATTTTTGG + Intronic
920038411 1:203080564-203080586 AGGCACAGCCAGAATCGTGGAGG + Intergenic
922909654 1:229204987-229205009 AGCCCCAGCCAGGGCCTTTTGGG + Intergenic
923264872 1:232304636-232304658 ACACACAGCCTGGATCTCTTAGG + Intergenic
1063131503 10:3181854-3181876 GGGAACAGTGAGGATCTTTTGGG + Intergenic
1069789194 10:71008811-71008833 AGGCAGAGCTAGGGTGTTTTTGG + Intergenic
1071359255 10:84829266-84829288 AGGCAGAGCCCGGAGCCTTTGGG - Intergenic
1072163370 10:92788574-92788596 AGTCAGACACAGGATCTTTTTGG + Intergenic
1072587026 10:96791888-96791910 AGGCAAAGTCAGGATGTTTCGGG - Intergenic
1076669490 10:132111703-132111725 AGGCACAGCCAGCAGCCTCTGGG + Intronic
1077565005 11:3292099-3292121 AGGCAGAGACAGAATCTCTTGGG - Intergenic
1077570891 11:3337916-3337938 AGGCAGAGACAGAATCTCTTGGG - Intergenic
1078184928 11:9043906-9043928 ATGCATAGGCATGATCTTTTGGG + Intronic
1079392646 11:20035851-20035873 TGGCACAGATTGGATCTTTTCGG + Intronic
1082945842 11:58758241-58758263 AGACACATTCAGAATCTTTTAGG - Intergenic
1083878258 11:65536077-65536099 GAGCACAGGCAGGATCTTCTGGG - Exonic
1085119109 11:73955920-73955942 GGGCACAGCCAGGACCCTTATGG + Intronic
1085617780 11:78014660-78014682 AGGCAAAGCCAGGTTCTTATAGG + Intergenic
1089178145 11:116563038-116563060 AGCCACAGCCACGACCTCTTCGG + Intergenic
1090886184 11:130878943-130878965 AGGTAAAGCCAGGATCCTTGAGG + Intronic
1091013108 11:132024213-132024235 AGGCACAGCCTGGATGTCTTTGG - Intronic
1101438121 12:104681437-104681459 GGGCATAGACAGAATCTTTTGGG + Intronic
1101817499 12:108156943-108156965 AGGCACTGCCAGGACTTGTTTGG + Intronic
1108044495 13:46370580-46370602 AGGCACTGACAGGAGCTGTTGGG + Intronic
1109916290 13:68988809-68988831 TAGCACAGCCAATATCTTTTAGG + Intergenic
1110522315 13:76494474-76494496 TGCCACAGCGAGGATGTTTTGGG - Intergenic
1111253774 13:85639626-85639648 AGGCACAGCCAGGAATTGTGGGG - Intergenic
1112064299 13:95776040-95776062 AGGCACAGCCAGGAGTTATAGGG - Intronic
1112666368 13:101579113-101579135 AGGCACAACCATGATGTGTTTGG + Intronic
1115297104 14:31840832-31840854 TGGCACAGGCAGGAGTTTTTAGG - Intronic
1120104840 14:80481710-80481732 AGACACAGCCAGGATTTCTCTGG + Intronic
1120175890 14:81293049-81293071 AAGCACAGTGAGGTTCTTTTTGG + Intronic
1122891090 14:104732596-104732618 AGGCACACCCTGGCTCTGTTGGG - Intronic
1126101163 15:45119111-45119133 AAGCACAATCAGGATCTTTGGGG + Intronic
1127290605 15:57567314-57567336 AGGAAAAGCCAGCATCTTATTGG - Intergenic
1128082437 15:64864635-64864657 AGTCACAGCCAGGGTCCTCTTGG - Intronic
1128662363 15:69511608-69511630 AGGCACAGGAAGAAACTTTTGGG + Intergenic
1130622432 15:85477504-85477526 AGACACAGCAAGGATCTGTTGGG - Intronic
1130927701 15:88397690-88397712 AGGCACATCCTGGAACTTTAGGG + Intergenic
1133609654 16:7421502-7421524 AGGCACAGCCAGGTTTTCTAAGG + Intronic
1134138439 16:11696254-11696276 AGGGGCAGCCAGGATCTTGATGG - Intronic
1135493111 16:22926765-22926787 AGGCATAGCAAGGAGCTTCTGGG + Intergenic
1135645239 16:24155924-24155946 AGACTCAGCTAGGATCTCTTTGG + Intronic
1139296021 16:65901646-65901668 AGGGGTAGGCAGGATCTTTTAGG - Intergenic
1143096366 17:4480614-4480636 TGGCAGAGCCAGGCTCTTTGTGG + Intronic
1144715720 17:17434414-17434436 TGGAACAGCCAGGAATTTTTTGG + Intergenic
1146679009 17:34793578-34793600 AGGAACAGGCAGGAGCTATTAGG - Intergenic
1148156403 17:45427402-45427424 AGGCACAGCCACGATCCTGGGGG - Intronic
1153642210 18:7166831-7166853 AGTCACAGACATTATCTTTTAGG - Intergenic
1156576734 18:38325819-38325841 GGAGACAGCGAGGATCTTTTAGG - Intergenic
1157481149 18:48054564-48054586 AGGCAGGGCCGGGATCTTTGAGG - Intronic
1157520039 18:48339196-48339218 AGGCACAGCCCCCATCTCTTGGG + Intronic
1158843727 18:61418260-61418282 ACGCCCGGCCAGGATGTTTTAGG - Intronic
1160013414 18:75123655-75123677 AGGCCCAGCCATGATGTTGTGGG - Intergenic
1161944544 19:7427146-7427168 AGGCGCACACAGGATGTTTTAGG + Intronic
1161953113 19:7478515-7478537 AGGCACAGCCAGGAGGGTGTGGG - Intronic
1161994051 19:7701704-7701726 AGGCAGAGGCAGGACCTCTTGGG - Intronic
1162533849 19:11251840-11251862 AGGCACAGCAAGGTTCTTAGAGG - Intronic
1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG + Intronic
1164748735 19:30635609-30635631 AGCCACACCCAGGAGCTCTTGGG - Intronic
1167980479 19:53270915-53270937 TGCCACAGCCAGGATCATGTGGG + Intergenic
1167985696 19:53313301-53313323 TGCCACAGCCAGGATCGTGTGGG - Intergenic
1168483049 19:56737385-56737407 AGGCACAGCCAGTGTAATTTGGG + Intergenic
927032844 2:19140629-19140651 GGGCAAGGCCAGGAACTTTTGGG + Intergenic
927144095 2:20149884-20149906 AGGGACAGCCAGGTGCTATTTGG - Intergenic
928873811 2:36013201-36013223 AGGCACAGTCAGGAAATTGTAGG - Intergenic
929816074 2:45232739-45232761 AGGCACAGGCTGGATCCTTTGGG - Intergenic
929998870 2:46847567-46847589 AGGCCCAGCCAGGATCTCTTAGG + Intronic
931256768 2:60581083-60581105 AGCCACTTCCAGGATCTTTTCGG + Intergenic
932531074 2:72533218-72533240 AGGCACAGCCAAGCTCATTCTGG - Intronic
935799185 2:106675964-106675986 ACCCACAGCCAGGAGCTTTTGGG + Intergenic
937080137 2:119134854-119134876 AGGCACAGCCAGAGGCTTCTGGG - Intergenic
938608798 2:132925009-132925031 AGGCACAGCCAGCCTCTGTAGGG - Intronic
939998523 2:148943238-148943260 AAGCAGAGCCAGGAGCTTTAGGG + Intronic
941182642 2:162278880-162278902 AGGGGGAGCCAGGAGCTTTTAGG + Intronic
942911098 2:181245289-181245311 AGCCTCAGCCAGGATCTCTCTGG + Intergenic
945143779 2:206715172-206715194 AGGAACAGGCAGGAGCTATTAGG + Intronic
946178468 2:217936264-217936286 AGGCACCGAGAGGATCCTTTGGG - Intronic
946815120 2:223569166-223569188 AGGTATGGCCAGGATGTTTTGGG - Intergenic
948445892 2:238032637-238032659 ATGCCCAGCCAGCATGTTTTTGG - Intronic
948947821 2:241230075-241230097 AGGCCCAGCCAGGAGCTTCAGGG - Intronic
1169375005 20:5059500-5059522 AGGCACAGACAGGGGCTTTGGGG - Intergenic
1172067708 20:32233445-32233467 AGGCCCAGCGAGGACCTTGTAGG + Intronic
1176019695 20:62956358-62956380 AGGGGCAGACAGGACCTTTTGGG + Intronic
1176275796 20:64267927-64267949 AGAAACAGCAAGAATCTTTTTGG - Exonic
1178494869 21:33078066-33078088 ACACACAGCCAGGATCTTAAAGG - Intergenic
1179590736 21:42406209-42406231 TTGCACACCCAGGATCTTTGGGG - Intronic
1182248164 22:28977247-28977269 AGCAACAGCCAGCAGCTTTTTGG + Intronic
1182459816 22:30475648-30475670 AGGCAGAGGCAGGATCGCTTGGG + Intergenic
1182838181 22:33361556-33361578 AGGGGCAGCAAGGATGTTTTGGG + Intronic
1182857969 22:33534868-33534890 CAGCACTGCCAGTATCTTTTGGG - Intronic
953269273 3:41424294-41424316 AGGGGCAGCCATGGTCTTTTAGG + Intronic
954982767 3:54761219-54761241 GGGCCCAGACAGGATCTTGTAGG - Intronic
956331486 3:68115123-68115145 AGGGACAGCCAGGAGCCTTCTGG + Intronic
960738735 3:120809564-120809586 AGGCAAAGTCAGGACCTTTTGGG + Intergenic
961156436 3:124683653-124683675 GGGCAGAGGCAGGGTCTTTTTGG - Intronic
961810231 3:129517853-129517875 AGGCACAGCCAGTGCCTTTTAGG - Intronic
963017911 3:140843289-140843311 AGGCACTGCCTGGATCTGTAAGG + Intergenic
963948558 3:151172506-151172528 AGGCACAGCCAGGATCTTTTGGG + Intronic
964656548 3:159073206-159073228 AGCCACAGCCATGCTCTTTCGGG - Intronic
964747861 3:160028590-160028612 AGGCTGAGGCAGGATCTCTTGGG + Intronic
968611843 4:1560796-1560818 AGGCACAGCCAGGGTCATCGTGG + Intergenic
969472231 4:7395746-7395768 AGGCACAGCCAAGATGCTTGGGG - Intronic
970488034 4:16544157-16544179 AGGCACAGTCTGGCTATTTTTGG + Intronic
979317676 4:119283898-119283920 AGACACAGACAGGATCCTTCAGG + Intronic
984245798 4:177274325-177274347 AGGCACATCACTGATCTTTTAGG + Intergenic
984470196 4:180160017-180160039 AGGAACAACCAGCTTCTTTTGGG + Intergenic
985570694 5:643289-643311 TGGCACTGCCAGGAGCTTTCTGG + Intronic
986210575 5:5667676-5667698 AGGCACAGCAAGGGCCTTTGTGG - Intergenic
986491986 5:8302582-8302604 TGGCACAGGCATGTTCTTTTGGG - Intergenic
986597458 5:9438781-9438803 AGGGACAGCCAGAATGTTCTGGG - Intronic
986854320 5:11851351-11851373 AGTTTCAGCCAAGATCTTTTTGG - Intronic
986854508 5:11853272-11853294 AGGCACAGCCAAGCTCTTCCTGG + Intronic
987304626 5:16625675-16625697 GGCCACAGCCAGGATGTTCTTGG - Intergenic
995869068 5:116725201-116725223 AGGGACTGTCAGGATATTTTTGG + Intergenic
997400422 5:133597791-133597813 AGGCCCAGCCAGCCTGTTTTGGG - Intronic
998343776 5:141442279-141442301 AGACTCAGACAGGATCATTTTGG - Intronic
998567191 5:143226109-143226131 AGCCATAGCCTGAATCTTTTAGG + Exonic
999764485 5:154728771-154728793 AGGAACAGCCACTATCTTTAGGG + Intronic
1003489633 6:6610077-6610099 ACGCCCAGCCAGGATCTGTATGG + Intronic
1006473256 6:34239905-34239927 AGGGCCAGCCAGGGTCTGTTAGG + Intronic
1006510443 6:34518438-34518460 AGGCAGAGACAGGAGCTTGTTGG - Intronic
1007061378 6:38943965-38943987 CGGCAGAGCCAGGATATTTTGGG + Intronic
1007239380 6:40414062-40414084 AGGAACAGGCAGGAGCTCTTTGG + Intronic
1007317466 6:41000709-41000731 AGGCACAGCCCACAGCTTTTTGG - Intergenic
1008125291 6:47661120-47661142 AGGCACAGCCAGCATTTTGGAGG - Intronic
1010654484 6:78496074-78496096 AGACAAAGCCAGTAACTTTTAGG + Intergenic
1013969844 6:116003692-116003714 AGCCATAGACAGTATCTTTTTGG + Intronic
1014369650 6:120588553-120588575 ATGCACTGTCAGGATCCTTTGGG + Intergenic
1015807925 6:137131354-137131376 ATGCACTGCAAGGATCTGTTAGG - Intergenic
1015810849 6:137160797-137160819 ATGCAGAGCCAGGAACATTTTGG + Intronic
1016423078 6:143905018-143905040 AGGTACAGCCAAGATTGTTTTGG + Intronic
1016847977 6:148587791-148587813 AGGGACAGCCACCATCTTTGTGG - Intergenic
1018254181 6:161902148-161902170 AAGCCCAGCCAGGGTCTTTAGGG - Intronic
1018590830 6:165419995-165420017 GGGCACAGCCAGTATTTGTTTGG - Intronic
1019338215 7:495021-495043 AGGGCCAGCCAGGCTCTTCTGGG - Intergenic
1019614375 7:1952513-1952535 AGCCACAGCCCGGATGTTCTGGG - Intronic
1019641280 7:2105101-2105123 AGGCACAGCCAGTTTCTTCCCGG - Intronic
1024526267 7:50352241-50352263 ATTCAAAGCCAGGATCATTTAGG - Intronic
1025815418 7:64906603-64906625 AGGCCCAGTTAGGTTCTTTTTGG + Intronic
1025865518 7:65377302-65377324 AGGCCCAGTTAGGTTCTTTTTGG + Intronic
1026244846 7:68610821-68610843 AGGCAAAAGCAGGATCTTATAGG + Intergenic
1028831142 7:95327652-95327674 AAGCACAGCCCAGATCTTGTGGG - Intergenic
1029180007 7:98693560-98693582 AGACACAGCCAGGAGCTGTGTGG - Intergenic
1033224276 7:139548343-139548365 TGGCAAAGCCAGGATTTGTTGGG + Intergenic
1036544801 8:9757319-9757341 AGGCACAGAGAGGATCTTAAAGG - Intronic
1038161681 8:25045583-25045605 AGGAAGAGACTGGATCTTTTTGG + Intergenic
1038392686 8:27218976-27218998 AGGCACAGCCAGAAAGTTCTTGG + Intergenic
1040722702 8:50345394-50345416 AGGCAGAGCCAGGATCCTAGAGG - Intronic
1043165172 8:76894354-76894376 AGGCTCATCCAGGATTTATTAGG - Intergenic
1047015985 8:120724059-120724081 AGGCTCTGCCAAGATCTTTTCGG + Intronic
1048260516 8:132941183-132941205 AGGCACATCCAGAAGCTTTGTGG + Intronic
1051585603 9:18723661-18723683 GGGCACAGCCAGGAGTTTCTTGG + Intronic
1051994619 9:23200319-23200341 TTCCACAGCCAGGTTCTTTTGGG - Intergenic
1052599105 9:30600700-30600722 AGGCACATCAGGGATCTTTGTGG - Intergenic
1052698451 9:31908882-31908904 AGGGACAGATAGGGTCTTTTGGG + Intergenic
1055871068 9:80880295-80880317 AGACACAGCCATTATCTTATTGG + Intergenic
1056118834 9:83466906-83466928 CGGCAGAACCAGCATCTTTTTGG - Intronic
1057818134 9:98310791-98310813 AGGCACAGCCACGAGTTTTTGGG + Intronic
1057952605 9:99381835-99381857 CAGAACAGCCAGGAACTTTTTGG - Intergenic
1060812343 9:126616838-126616860 AGGCACAGCCAGAGCCTTTTGGG - Intronic
1061831564 9:133299651-133299673 AGGGACTGCCAGGCTCTTTTGGG - Intergenic
1061929756 9:133826442-133826464 AGACACAGCCAGGCTCTGTCAGG - Intronic
1062426266 9:136507597-136507619 AGGCCCCGCCAGGGTCTGTTGGG - Intronic
1185516279 X:701514-701536 AGCCACAGACAGGACATTTTGGG - Intergenic
1187218086 X:17296481-17296503 AGGAGAAGCCAGGATCTTATGGG - Intergenic
1187735169 X:22295677-22295699 TGACACAGCCAGGAGCTTTTTGG - Intergenic
1199186509 X:144921610-144921632 GAGAACAGCAAGGATCTTTTTGG - Intergenic
1199746071 X:150772550-150772572 AGGCTCAGCCAGGACCTTGAGGG + Intronic