ID: 963949716

View in Genome Browser
Species Human (GRCh38)
Location 3:151185554-151185576
Sequence CTTTTGCTCTTGAGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963949713_963949716 -7 Left 963949713 3:151185538-151185560 CCCTCATTATGTTATTCTTTTGC 0: 1
1: 0
2: 1
3: 34
4: 488
Right 963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG 0: 1
1: 0
2: 2
3: 15
4: 351
963949714_963949716 -8 Left 963949714 3:151185539-151185561 CCTCATTATGTTATTCTTTTGCT 0: 1
1: 0
2: 3
3: 46
4: 655
Right 963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG 0: 1
1: 0
2: 2
3: 15
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963949716 Original CRISPR CTTTTGCTCTTGAGGAAAAA AGG Intronic
902890430 1:19439394-19439416 CTTTTGTTCTTGAAGAACCACGG + Intronic
909930722 1:81496357-81496379 CTTTTTTTCTTTAGCAAAAAAGG + Intronic
910823477 1:91378472-91378494 TTTTTTCTCTCTAGGAAAAATGG - Exonic
911312470 1:96310962-96310984 TTTTTAATTTTGAGGAAAAAAGG + Intergenic
911660195 1:100492994-100493016 GATATGCTCTTCAGGAAAAAAGG - Intronic
911660303 1:100493978-100494000 ATTTTTCAGTTGAGGAAAAAAGG + Intronic
913063770 1:115231249-115231271 CTTTTGCTCTTTAGCCAGAAAGG + Intergenic
913273485 1:117116811-117116833 CTTTTTCTCTTCAGAACAAAGGG + Intronic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913358586 1:117952634-117952656 CTCTTATTCTTGAGGAAGAAAGG + Exonic
913403157 1:118458201-118458223 CTTATGCCCTTGAGAAAAGAGGG - Intergenic
914678927 1:149925742-149925764 CTGTTACTGTTGAGGAACAAAGG + Intronic
915890745 1:159771395-159771417 CTTTTTCTCTTGTGCAAATACGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
918643636 1:186876049-186876071 CTTATGGCCTTGAGGAAAGAAGG + Intronic
918742030 1:188143882-188143904 CTTTTGATCTGAAAGAAAAAGGG - Intergenic
919394859 1:197033200-197033222 ATTTTGCTATTTAGGAAGAAGGG + Intergenic
919675331 1:200376653-200376675 CTTTGGCTTTTGAGTAAAATGGG - Intergenic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923236114 1:232034965-232034987 CATTTGAACTTGAGGAAAATGGG - Intronic
923260240 1:232261385-232261407 CTGGTGCTTTTGAGGAAAACTGG - Intergenic
923305858 1:232687490-232687512 CATTTTCTCTTGAGCAAAAGAGG + Intergenic
924367194 1:243307454-243307476 GTTTTCCTCCTGAAGAAAAATGG + Intronic
1063092806 10:2882703-2882725 ATTTTGCTCTTGAGAAAAATGGG + Intergenic
1063103255 10:2969990-2970012 CAGTGGCTCTTGAGGAAAACAGG + Intergenic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1064534947 10:16349184-16349206 CTTTTGCTCTGAATGAAGAAGGG + Intergenic
1065998881 10:31085879-31085901 CTTTATCACTGGAGGAAAAAGGG - Intergenic
1066041817 10:31555983-31556005 CTTTTGCTCTTCTGGAAGTATGG - Intergenic
1067901376 10:50244991-50245013 CTTCTGCTCATGAAAAAAAAAGG + Intronic
1068309602 10:55261336-55261358 ATTTTGTACATGAGGAAAAAAGG + Intronic
1069138601 10:64796513-64796535 TTTTTGCTCTTGAGAAAAGGGGG - Intergenic
1069873297 10:71546307-71546329 CATTTGCTCGTGCGGAAAAATGG + Intronic
1070278231 10:75028774-75028796 GTTTTCCTCTTGAGGCAACAGGG - Exonic
1070393573 10:75992124-75992146 ATTATGCACATGAGGAAAAAGGG + Intronic
1071095252 10:81966348-81966370 CTTTTTCTAATGAGTAAAAATGG + Intronic
1072186507 10:93044737-93044759 CTTTTCCTCTTGAGGCAATTGGG + Intronic
1072551954 10:96485873-96485895 CTTTTTCTTTGGGGGAAAAATGG - Intronic
1073644948 10:105292228-105292250 ATTTTGTTCTGGAGGAAACACGG + Intergenic
1073834143 10:107421361-107421383 CTCTTTCTCTTTAGCAAAAATGG + Intergenic
1074461306 10:113639776-113639798 CATGTGCTCCTGAGAAAAAATGG + Intronic
1074711525 10:116181951-116181973 CTTTTTGTTTTGAGTAAAAATGG + Intronic
1075955251 10:126517956-126517978 TTTTTGCTCTGGAGCATAAAAGG - Intronic
1076051080 10:127333625-127333647 CTTTTGTTCTTGAACAAAAAGGG - Intronic
1076411813 10:130257089-130257111 CTTTTGCCCTTGAAGGACAATGG + Intergenic
1078107076 11:8365268-8365290 AATTTGCTCTTGAAGAGAAAGGG - Intergenic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1080146849 11:28996098-28996120 ATTTTACTCATGAGGAAACATGG - Intergenic
1080761734 11:35257021-35257043 CTTTTGCTATTGAGAGCAAAGGG + Exonic
1080932514 11:36826622-36826644 ATTTTGCTCATGAGAAAATAGGG + Intergenic
1081145511 11:39558253-39558275 TTTTTCCTTTTAAGGAAAAAGGG - Intergenic
1082020415 11:47528240-47528262 GTATTTCTCTTGAGGAAATAAGG - Intronic
1082051277 11:47772429-47772451 CTTTTCCTCTTGAGGCTTAAGGG + Intergenic
1082780734 11:57285653-57285675 CTTTTGCTTTAGAGGGAAATGGG + Intergenic
1083108750 11:60384237-60384259 CTTTTCATTTTGAGCAAAAAAGG - Intronic
1084069262 11:66723535-66723557 CATTTTCTCTTTAGGAGAAAGGG - Intronic
1085165916 11:74398895-74398917 CTTTTTCTTTTGAGGAAAGGGGG - Intergenic
1087019602 11:93589044-93589066 CCTTTACTCTTAAGAAAAAAGGG - Intergenic
1087483441 11:98731567-98731589 TACTTGCTCTTGAAGAAAAAGGG - Intergenic
1088850211 11:113698058-113698080 CCTCTGCTCTTGAGGAGAGAGGG - Intronic
1089130447 11:116208078-116208100 CTTTTTCTCTAGAGGGAAAGTGG + Intergenic
1090605321 11:128417014-128417036 TTTTTTCTTTTGAGGAAAGAGGG - Intergenic
1091002097 11:131918250-131918272 CTTTTGCACTTAGGGAAACATGG - Intronic
1091055914 11:132418865-132418887 CTTTTGCACTTGAAGGACAAAGG - Exonic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1093438804 12:19169100-19169122 TTTTTACTCTTAAAGAAAAATGG + Intronic
1094448367 12:30558300-30558322 GTTTTTCTCTTGAAGAAAAGGGG - Intergenic
1094695484 12:32814124-32814146 CTTATGCATTTGAGGGAAAACGG - Intronic
1095403124 12:41838307-41838329 CTTTTCCTCTTCAGGGAAAGAGG - Intergenic
1095977925 12:47952349-47952371 CTTTTGCTCTTCAGGATTTATGG + Intergenic
1100871445 12:98914478-98914500 CTTTTACTCTTAAAGAACAAGGG - Intronic
1101903189 12:108806790-108806812 ATTTTGATTCTGAGGAAAAAGGG - Intronic
1102760236 12:115378797-115378819 CTATTTCTCTTGGGGAGAAATGG + Intergenic
1102938640 12:116918535-116918557 GCTTTCCTCTTGGGGAAAAATGG + Intronic
1104070872 12:125344407-125344429 CTTTTGGGCTAGAGGGAAAAGGG + Intronic
1104401735 12:128481839-128481861 CATTTCCTCATGAGGAAATAGGG - Intronic
1107421923 13:40255207-40255229 CTGTTGCTCTTTAGGGAGAAAGG + Intergenic
1108165363 13:47687520-47687542 CTTTTGATATTAAGGAAAGATGG + Intergenic
1108517039 13:51213216-51213238 CTTTGCCTCTGGAGGATAAAGGG - Intergenic
1108764351 13:53608472-53608494 CTTTAGCTCTTGAATAAAATCGG - Intergenic
1109157991 13:58935413-58935435 TTTTTTCTCTTGAAGTAAAAAGG - Intergenic
1109896530 13:68698801-68698823 CAGTTCCTCTTTAGGAAAAATGG + Intergenic
1109999871 13:70182304-70182326 CTTTTCCTCTTGAGATTAAAAGG + Intergenic
1110100970 13:71601352-71601374 GTTTTCCTGTTGAAGAAAAAGGG - Intronic
1110870492 13:80447058-80447080 CTATGGCTTTTGAAGAAAAATGG - Intergenic
1112133643 13:96551795-96551817 CTTTCTCACTTGAGGAAATAAGG + Intronic
1112588212 13:100738505-100738527 CTTTTCCTCTTTAGGCCAAAGGG + Intergenic
1113252268 13:108466913-108466935 GTTTAGCTCTGGAGAAAAAAGGG - Intergenic
1115314951 14:32015654-32015676 CTTTTGCTGTTGCTGTAAAATGG - Intronic
1115672621 14:35631167-35631189 ATTTTGCACATGAGGACAAATGG + Intronic
1115877881 14:37881056-37881078 TTGTTGCTCTGGGGGAAAAAGGG - Intronic
1116086383 14:40243835-40243857 CTTTTGCTCTTAAGAGAAATTGG - Intergenic
1118057469 14:62095217-62095239 ATTTTGCTCTTGACTATAAAGGG - Intronic
1118233784 14:63980379-63980401 GTTTTCCTCTTGTGGAAAAAAGG - Intronic
1118420845 14:65601187-65601209 CTTTTGCACATTAGGTAAAATGG + Intronic
1119245906 14:73107810-73107832 CTTTGGCCTTTGAGGAAATAAGG - Exonic
1119586755 14:75842948-75842970 TTTTTGCTATGGAGGCAAAAAGG - Intronic
1120330101 14:83081803-83081825 CTTTTGCTCTTTAAAAAAAGGGG + Intergenic
1121072587 14:91037988-91038010 CTATTGTTCTGGAGGAAATAGGG + Intronic
1122018979 14:98820762-98820784 CTGATGCTCTTGGGGAAAATGGG - Intergenic
1122465044 14:101927025-101927047 CTTCTCCTTTTGAGGGAAAAAGG + Exonic
1123195640 14:106613607-106613629 CTTTTGCTTTTGAGGGAGTAAGG + Intergenic
1125431139 15:39594557-39594579 ATTTTGCTTTTGAGGACACAAGG + Intronic
1125742361 15:41974147-41974169 ATTTTGCTCTTAAGGAAACTAGG - Intergenic
1126678545 15:51182773-51182795 CTTTTGTTGGTGAGGAAGAAAGG + Intergenic
1127145389 15:56018185-56018207 CTCTTGCTCTTCAGGAGAGAAGG - Intergenic
1127843281 15:62848130-62848152 CTTTTTCTCTCCAGGAAACAGGG - Intergenic
1128287912 15:66453689-66453711 CTTCTGTCCTTGAGGAAAAGTGG + Intronic
1128904064 15:71451820-71451842 GTTTTGGTCCTGAGGAAAGAGGG + Intronic
1129151350 15:73689966-73689988 CTTTTGCAATTAACGAAAAAAGG - Intronic
1129526907 15:76224013-76224035 AATATTCTCTTGAGGAAAAAAGG + Intronic
1129867363 15:78919468-78919490 CTTTTTATCTGGGGGAAAAAAGG - Intergenic
1130439346 15:83935666-83935688 TTATTTCTCATGAGGAAAAATGG - Intronic
1130880129 15:88047799-88047821 CCTTTGGTCTGGATGAAAAATGG + Intronic
1131382841 15:91978333-91978355 CTTTTACTCTTCAGTGAAAATGG + Intronic
1132360536 15:101209485-101209507 CTTTTTGTTTTAAGGAAAAAGGG + Intronic
1132782702 16:1636850-1636872 CAGTGGCTCTTGAGGAAAGAGGG + Intronic
1133646572 16:7770161-7770183 CTTTTGCTCATATGTAAAAAGGG + Intergenic
1134015805 16:10887437-10887459 CTTCTCCTCCTGAGGAATAATGG - Intronic
1134771067 16:16810072-16810094 CTCTTGCTTTTGAGTAAAATAGG + Intergenic
1135041546 16:19121260-19121282 TTTTTGCTTTTGAAAAAAAAAGG + Exonic
1137357079 16:47777271-47777293 CTTTTACTCTTAAGGAAATGAGG + Intergenic
1137861906 16:51855399-51855421 GTTTTGCTCTTGAGAGAAAGAGG + Intergenic
1138093940 16:54197420-54197442 CTTTTTATATTGAGGAAAACTGG - Intergenic
1138694909 16:58804036-58804058 CTTTTTCTCTTCAGAACAAAGGG - Intergenic
1138731012 16:59195273-59195295 CTTATGCTCTGGAGGGATAATGG - Intergenic
1139141094 16:64263621-64263643 CTTTGGCTGTCTAGGAAAAAAGG - Intergenic
1139821950 16:69727696-69727718 CTTTTGCACTGGAGGGACAACGG - Intergenic
1141822226 16:86454407-86454429 CTTTTCCTCTTGTTGCAAAATGG + Intergenic
1143313467 17:6013209-6013231 TTTTTGCTTTCGAGGAAAAGGGG - Intronic
1143379066 17:6484478-6484500 CTTTTCCTTATGAGGAGAAAGGG - Intronic
1143777538 17:9209371-9209393 GGTTTGCTCTTGAGGAAGAAAGG + Intronic
1144371751 17:14597920-14597942 CTTTTGCTCCTCTGGAAAGACGG + Intergenic
1144409950 17:14991206-14991228 CTCGGGGTCTTGAGGAAAAATGG - Intergenic
1146287526 17:31584278-31584300 ATTTTACTGTTGAGGAAACAGGG + Intergenic
1148939080 17:51191516-51191538 GTTTTGCTTTCTAGGAAAAATGG + Intronic
1149295714 17:55260619-55260641 CTTTTGATCCCGAGGAAAAATGG - Intergenic
1150786273 17:68165484-68165506 CTTTTCCCGTTTAGGAAAAAAGG - Intergenic
1153235998 18:2988273-2988295 TTTATGCTCTTCAGGAGAAACGG + Intronic
1153767184 18:8385712-8385734 CTTTTGCTTTGAAGGAAATAAGG + Intronic
1153852103 18:9104536-9104558 CTTTTGTTTTTGAGGCAAAGGGG + Intronic
1155008884 18:21755289-21755311 CTTTTGTTTCTGAGGGAAAATGG + Intronic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155992851 18:32298402-32298424 CTTTTGCTATTAAAAAAAAAAGG - Intronic
1156850553 18:41720739-41720761 TTTTTGGTCATGAAGAAAAATGG - Intergenic
1156956284 18:42968476-42968498 CCTTTGATCTTGGGGAAAATGGG - Intronic
1157992998 18:52519959-52519981 CTTTTACTCTTGAGATACAATGG - Intronic
1159214926 18:65379833-65379855 CTTTTACTAGTGAGTAAAAAGGG - Intergenic
1159302346 18:66590938-66590960 ATTATCCTCTTGAGGAAGAAAGG - Intronic
1159510287 18:69389495-69389517 CTTTGGGACTTAAGGAAAAATGG + Intergenic
1159635871 18:70804398-70804420 ATTTTGCTCTGGAGAAAATACGG - Intergenic
1160241811 18:77130380-77130402 TTTTTACTGTTGAGGAAACAAGG - Intronic
1164948652 19:32317744-32317766 CTTTTTCTTTTAAGAAAAAAGGG - Intergenic
1165210743 19:34233869-34233891 CATATGCTCTTCAGCAAAAATGG + Intergenic
1165589679 19:36957128-36957150 CATTTGCTCATGAGTAAGAATGG - Intronic
1166614229 19:44228665-44228687 TCTTTGCTCTTGAAGACAAAAGG + Intronic
1166952210 19:46436872-46436894 TTTTTACTCTTCAGCAAAAAAGG - Intergenic
1166995678 19:46718651-46718673 CATCTGCCCTTCAGGAAAAAGGG - Intergenic
1167605219 19:50478350-50478372 CGTTTCCTCTTCTGGAAAAAGGG - Intronic
1168460472 19:56551238-56551260 CTTTTCCTCTTGATGCACAAGGG + Intronic
925508426 2:4596820-4596842 CTTTTCCTTCAGAGGAAAAAGGG + Intergenic
926861964 2:17319244-17319266 CTTCTGCTCTTTAGGAATAAGGG - Intergenic
926941902 2:18146857-18146879 TTTTTTCTCTTAAGAAAAAAAGG - Intronic
929009164 2:37424058-37424080 CTTTTCCTCTGAAGGAGAAAGGG + Intergenic
929719379 2:44351882-44351904 CTTTTCCTCTTGAGCAAGATGGG - Intronic
930243454 2:48959434-48959456 CATTTGCTCTTGCAGAAACAAGG + Intergenic
931509158 2:62970800-62970822 CTTTTGCTTTTGAGGGGAAGGGG - Intronic
933145075 2:78842028-78842050 CTGTTGCTCATGAGGAGAACTGG + Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934020616 2:87947785-87947807 TTTTAGATCTTGAGGAAAACCGG - Intergenic
935822404 2:106907337-106907359 CTGTTACTCTTTAGGAAATAGGG - Intergenic
936652949 2:114450694-114450716 CTATTTCTCTTGAGGATAAGTGG + Intronic
937367116 2:121271254-121271276 CTTTTGCTTTTTAAGACAAATGG - Intronic
937792250 2:125974189-125974211 CCCTGGCTCATGAGGAAAAAAGG + Intergenic
938172727 2:129094997-129095019 GTTTTGATATTGGGGAAAAATGG + Intergenic
938542336 2:132294523-132294545 CTTCAGCTCTTGAAGAAATAAGG + Intergenic
939350908 2:141036564-141036586 CTTTGCCTTTGGAGGAAAAAGGG - Intronic
940062013 2:149582208-149582230 ATTTTGCTCTTTAGTTAAAAGGG - Exonic
941092742 2:161197080-161197102 CAGTTACCCTTGAGGAAAAATGG + Intronic
941094633 2:161223523-161223545 CTTTTGATATTCAGTAAAAATGG - Intronic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
942920733 2:181370412-181370434 CTTTTTCTCTTTAGGATGAATGG - Intergenic
943142252 2:183997619-183997641 CTTTTACTCTTGTGGAATAGGGG - Intergenic
943366251 2:186970135-186970157 CTTTTTGTCTAGAGGGAAAAGGG - Intergenic
944496531 2:200312636-200312658 GTTTTGCTCTTCAGTAAAACTGG - Intronic
947301284 2:228690489-228690511 CTTTTGCTCATCAGCAAAGAAGG + Intergenic
948042821 2:234917179-234917201 ATTTTTCTCTTGGAGAAAAAAGG - Intergenic
1169423998 20:5482270-5482292 TTTTTGCTCTTGGAGAATAATGG + Intergenic
1170367297 20:15611712-15611734 CATTTGTTCTTGTGGAAATATGG + Intronic
1171363815 20:24610002-24610024 CTTTTCCTTTTGACCAAAAAGGG - Intronic
1171871215 20:30527366-30527388 CTTCAGCTCTTGAAGAAATAAGG + Intergenic
1173376159 20:42485123-42485145 CTTTTGCGCTAGAGGAAATCGGG + Intronic
1174382586 20:50166099-50166121 CTTTTGCTCCTGGGTAAATAGGG + Intergenic
1175476609 20:59279661-59279683 TTTTTACTTTTGAGGAAAAGTGG + Intergenic
1175769800 20:61616482-61616504 CTCTTACTGTGGAGGAAAAAAGG - Intronic
1177233732 21:18358524-18358546 CATTTGCTCTTAAAAAAAAATGG - Intronic
1178811831 21:35890933-35890955 CTTCTGCTGTTGAGAGAAAAGGG - Intronic
1179027550 21:37692296-37692318 CCTTTACCCTTGAGAAAAAAAGG + Intronic
1179728044 21:43351136-43351158 ATTTTGATAGTGAGGAAAAAAGG - Intergenic
1181390811 22:22579570-22579592 CTTTCTCTCTTGAGGAAATTAGG + Intergenic
1182001456 22:26923263-26923285 CGATTGCTCTGGGGGAAAAAGGG + Intergenic
1182168321 22:28199820-28199842 GTGTTACTCTGGAGGAAAAATGG + Intronic
1182742171 22:32575856-32575878 TTTTTTGTCTTGAGGAAAGAAGG - Intronic
1182904974 22:33927966-33927988 CTTGTGATCATGAGGAAACATGG - Intergenic
1183355579 22:37357345-37357367 GTTTTGCTCCTGTGGAAGAAGGG + Intergenic
1184311756 22:43650105-43650127 CTTGTGGTCCTGAGGAAATAAGG + Intronic
949734153 3:7151685-7151707 CCTTTGCCCTTTAGGAAAAAAGG + Intronic
949819393 3:8099725-8099747 CTTTTGCTCCTTAGGGATAATGG + Intergenic
950594926 3:13971482-13971504 CTTTTACTCCTGAGATAAAAAGG + Intronic
951586682 3:24222028-24222050 CTTTGTTTCATGAGGAAAAAAGG + Intronic
952512534 3:34071572-34071594 CCTTTGCTCTTGGGAAGAAAAGG + Intergenic
954130448 3:48558001-48558023 CATTTTCTCTTCAGGAAAATGGG + Intronic
955159734 3:56452955-56452977 ATTTTACTCATGAGGAAGAAAGG - Intronic
955400671 3:58588969-58588991 CTTTTACAGTTGAGGAAATACGG + Intronic
956675686 3:71729983-71730005 CTTTTGCTGTTAAAGGAAAACGG - Intronic
957264948 3:77951101-77951123 CTTCTGCATTTGAGTAAAAAAGG + Intergenic
957729682 3:84117605-84117627 ATTTTGATCTTGAGAAAACAAGG - Intergenic
958802086 3:98767656-98767678 CTTTTGCTTCAAAGGAAAAAAGG - Intronic
959285775 3:104407850-104407872 CATTTGCTATTGAGAAAAATGGG + Intergenic
961101073 3:124199619-124199641 CCTTTACTCTTTAAGAAAAAAGG - Intronic
961559808 3:127720845-127720867 CTTTTTGTCTTGGGGGAAAATGG + Intronic
961959999 3:130845041-130845063 CTTTTCCTTTTAAGGAAAATGGG - Intergenic
962300401 3:134236548-134236570 CTTTTACTCTTGTGCAAAAATGG - Intronic
962317180 3:134366206-134366228 CTTTTGTTCTAGAGAAAAATTGG - Intronic
963927367 3:150965259-150965281 CTGTTTCTCTTGAAGAAATATGG - Intronic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
964737321 3:159930043-159930065 CTCTTGCTGTTCAGGAACAAGGG + Intergenic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
965902997 3:173667382-173667404 ATTTTGGACTTGAAGAAAAATGG + Intronic
966067817 3:175837521-175837543 CTTTTGGCCTTGAAGAAGAAAGG - Intergenic
966693624 3:182766732-182766754 ATTTTACTGTTGAAGAAAAAGGG + Intergenic
967759639 3:193208960-193208982 CTTCGTCTCTTGAGGAAATAAGG + Intergenic
968278559 3:197458846-197458868 CTTTTCTTCCTGGGGAAAAAAGG - Intergenic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
969893467 4:10280735-10280757 GGTTGGCTCTTGAGGAAAGATGG + Intergenic
970835600 4:20402018-20402040 CCTTTGCTCTAGGGGAAAGAGGG + Intronic
971173627 4:24260020-24260042 ATTTTACTCTTGAGAAACAAAGG - Intergenic
971714255 4:30154867-30154889 CTTTAGGTTTTGAGGATAAAAGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972718647 4:41674351-41674373 CTTTGTCTTTTGAGGGAAAAGGG - Intronic
974499357 4:62679042-62679064 CATTTGCTTGTGAAGAAAAAAGG + Intergenic
975435847 4:74350363-74350385 ATAATGCTGTTGAGGAAAAAGGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
976594139 4:86878644-86878666 CTTTCACTCCTGAGGAAAAATGG - Intronic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
977565748 4:98578790-98578812 CTTTGGATCTGGAGGAAAAGTGG - Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
979493768 4:121361492-121361514 CTTTTGCTTCTGAGGAACACGGG - Intronic
981209909 4:142091344-142091366 ATTTTGCAGTTGAGGAAATAGGG - Intronic
981738340 4:147976163-147976185 CTCTTGCACTTGATGGAAAATGG - Intronic
981932739 4:150208555-150208577 CATTTGCTCCACAGGAAAAAGGG + Intronic
983051189 4:163049363-163049385 CATTTTTTCTTTAGGAAAAAGGG - Intergenic
983126806 4:163963064-163963086 CATATGCTCTTAAGGAATAATGG + Intronic
984088457 4:175341001-175341023 CTTTTTTTCTTGAAGAAAACAGG - Intergenic
984090079 4:175362428-175362450 ATTTTACTCTTTAAGAAAAATGG + Intergenic
984493327 4:180464542-180464564 TTTTTGCTATTGACAAAAAATGG - Intergenic
984988494 4:185354354-185354376 CTACTGCTCAAGAGGAAAAAAGG - Intronic
985024619 4:185728451-185728473 CTTATGCTCTGGATGAAAACTGG + Intronic
985980549 5:3458810-3458832 CTTTTGCTCTTGACAGAAGAGGG - Intergenic
986319953 5:6622466-6622488 CTTTTCCTCATCTGGAAAAATGG + Intronic
987435719 5:17891655-17891677 ATTATGCTTTTGATGAAAAATGG - Intergenic
989108144 5:37882603-37882625 TTTTTTCTTTTGAGGAAAGAGGG + Intergenic
989981412 5:50649810-50649832 ATTGTGCTTCTGAGGAAAAAGGG - Intergenic
989993234 5:50794651-50794673 TTTTTGCTTTTCAGGAAAAATGG + Intronic
992229721 5:74652239-74652261 ATTTTGCTCATGAGGAAACAGGG + Intronic
995126618 5:108583290-108583312 CCTTTGCTCTAGAGAATAAAAGG + Intergenic
995909136 5:117164408-117164430 CTTTTGCTGCTGAGAAGAAATGG + Intergenic
996527652 5:124496578-124496600 CTTTTGCTTTTGACTAATAAAGG - Intergenic
996597309 5:125220184-125220206 CTTTTGTGCTTGATGAAAGAAGG - Intergenic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
998042904 5:138964508-138964530 CATTTTCTTTTGGGGAAAAAAGG - Intronic
999929234 5:156412533-156412555 CTTTTACTCATGAGGAAAAAGGG + Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1001215864 5:169855119-169855141 CATTTGCTCTTCTGGAAAATGGG + Intronic
1001948562 5:175799911-175799933 CTTTTGCTCATGAGAACTAAGGG - Intronic
1003210562 6:4060956-4060978 ATTTTGGTCTTGAGATAAAATGG + Exonic
1004270391 6:14190106-14190128 CTTCTGCTCTTTAGCAAAAGGGG - Intergenic
1004497464 6:16178303-16178325 CTTTTTCTGATGAGGAAAAGTGG - Intergenic
1004875247 6:19944752-19944774 ATTTTGGTTTTGAGGAAAAGGGG - Intergenic
1007071480 6:39041419-39041441 CTTTTTCTCTGGAGGAAAGGTGG - Intergenic
1007955374 6:45913394-45913416 CTGTTACTCTAGAGAAAAAATGG + Intronic
1008135372 6:47770252-47770274 CTTTTACTAATGATGAAAAATGG + Intergenic
1008138894 6:47809088-47809110 TTTTGGGTCTTTAGGAAAAATGG - Intronic
1008354336 6:50533594-50533616 CTTTAGATCTTGAGGATATAAGG + Intergenic
1008384404 6:50871968-50871990 CTTTTCCTCCTCAGGAAAATGGG + Intergenic
1009642924 6:66361621-66361643 CCTCTGCTCTTGAGGAGAGAGGG + Intergenic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010373137 6:75134848-75134870 ATTGTGGTCTTGAGTAAAAAGGG + Exonic
1011163999 6:84425409-84425431 TTTTTTCTCTTGGGGAAGAAGGG + Intergenic
1011781090 6:90790163-90790185 CCTGTGCTGGTGAGGAAAAAGGG + Intergenic
1012059338 6:94458209-94458231 TAATTGCTCTTGAAGAAAAAAGG - Intergenic
1012219323 6:96629199-96629221 CTTTCCCTCTTGAAGAAAATTGG + Intergenic
1012659477 6:101869665-101869687 CACTGGCTTTTGAGGAAAAAAGG + Intronic
1015128349 6:129780825-129780847 CTTTTGCTTTTTAGAAAAAATGG - Intergenic
1015295670 6:131589337-131589359 TTTTTTCTTTTAAGGAAAAAGGG - Intronic
1015330190 6:131968837-131968859 CATGTGCTCTGGAGGAAGAAGGG + Intergenic
1015503789 6:133960675-133960697 CTTTGGGTATAGAGGAAAAATGG + Intronic
1015911759 6:138175532-138175554 CTTTTGCTTATGAAGCAAAAAGG - Intronic
1016248383 6:142015070-142015092 TTTTAGATCTTGAGGAAAACAGG - Intergenic
1016290527 6:142524014-142524036 CTTTCACTATTGGGGAAAAAGGG - Intergenic
1016658620 6:146549375-146549397 GTGTTGCTCTTGGGGTAAAAGGG + Intronic
1017291367 6:152742489-152742511 CTATTGCTCTTGAAGGAAACAGG - Intergenic
1017412592 6:154185001-154185023 TTTTTACTTTTTAGGAAAAAGGG - Intronic
1020404787 7:7819649-7819671 GTTTTGCTCTGAAAGAAAAATGG + Intronic
1020452242 7:8333283-8333305 CTTTAGCTATTAAGGAAACATGG + Intergenic
1021900604 7:25281257-25281279 CTTTTGCTTTTGGCCAAAAAGGG + Intergenic
1022127566 7:27372954-27372976 CCTTTGTTCATGAGGAAAGATGG + Intergenic
1023008885 7:35907493-35907515 CTTTTGCAGATGAGGAAACAGGG - Intergenic
1023359452 7:39400462-39400484 CCTTTGCTCTTGGGGTCAAATGG - Intronic
1023390012 7:39700657-39700679 CTTCAGCTCTTGATGAAAAGTGG + Intronic
1024301774 7:47892464-47892486 CTTTTACTCTTGAGTAAAAAGGG + Intronic
1026440000 7:70435888-70435910 CCTTTTCTCTTTAGGAAAGATGG + Intronic
1028311350 7:89341147-89341169 CTCTTGCTATTTAAGAAAAATGG - Intergenic
1028400289 7:90418292-90418314 ATTTTGCTTTATAGGAAAAAAGG + Intronic
1028504581 7:91557146-91557168 CTTAATCTCTTGAAGAAAAAAGG + Intergenic
1029155171 7:98512193-98512215 TTTTTGATCTTGATGAAAATGGG + Intergenic
1029854107 7:103495930-103495952 ATTATTCTCTTGAGGAAAATTGG + Intronic
1031591305 7:123595341-123595363 CTTTTTGTCATGAGGCAAAAAGG - Intronic
1032113942 7:129101084-129101106 ATTTGGCTCTTGTGGAATAAGGG + Intergenic
1032354803 7:131200725-131200747 CTTTAGTTTTTCAGGAAAAATGG - Intronic
1033029133 7:137807915-137807937 TATTCGCTCTGGAGGAAAAATGG - Intronic
1033073366 7:138225182-138225204 GTTTTCTTCTTGAGGCAAAATGG - Intergenic
1034637199 7:152576821-152576843 CTCCTGCCCTTAAGGAAAAAGGG + Intergenic
1034830845 7:154306075-154306097 AGTTTGCTCTTGAGGGAAACAGG - Intronic
1035304470 7:157922638-157922660 CTTTTGCTGGGAAGGAAAAAGGG + Intronic
1036122047 8:6029296-6029318 CTTTTGCTGTTGCATAAAAAAGG - Intergenic
1038124893 8:24662532-24662554 CTTTTGGTCCTGAGGAAAGTGGG - Intergenic
1038697269 8:29817731-29817753 CTTTCCCTCCTGAGGACAAAGGG - Intergenic
1038835266 8:31113487-31113509 CTTTTCCTCTTTAGGATGAAAGG - Intronic
1039262031 8:35782237-35782259 TTACTGCTCTTGAGGATAAATGG + Intronic
1039271647 8:35887828-35887850 CTTTTGGTGTTAAGGGAAAAAGG + Intergenic
1039662544 8:39482884-39482906 CTCTTGCTCATGAACAAAAAGGG - Intergenic
1042899586 8:73710129-73710151 TTTTTGAGCTTGAGGAGAAACGG - Intronic
1043918705 8:85955508-85955530 ATTTTTCATTTGAGGAAAAAAGG - Intergenic
1045362335 8:101444493-101444515 TTTTTACTTTTGAGTAAAAAAGG - Intergenic
1047289096 8:123513544-123513566 CTTCTGCACTTGAGGTTAAAGGG + Intronic
1048696209 8:137031207-137031229 CTTTTCCCCTTTAGGAAACAAGG + Intergenic
1049135832 8:140898527-140898549 CTTCTCCTCTTGAAGAAATAGGG + Intronic
1050198938 9:3120720-3120742 CTTTTGCTATTGAACAAAAATGG - Intergenic
1050346077 9:4689076-4689098 TTTTTTCTATTGGGGAAAAAGGG + Intronic
1051409558 9:16775534-16775556 CTATTGCTCTTGAAGAGTAAGGG - Intronic
1052032004 9:23639460-23639482 CTTGTCCTCCTTAGGAAAAATGG + Intergenic
1052576250 9:30295291-30295313 ATTTAGCTTTTAAGGAAAAAAGG - Intergenic
1052817474 9:33112460-33112482 ATTTTGCTCTTGAGAAAACCTGG + Exonic
1053269279 9:36739273-36739295 CTTTTTATCTTGAGCAACAAAGG + Intergenic
1054798169 9:69321795-69321817 GCTTTGATCTTGAGGAAAACTGG + Intergenic
1057462606 9:95277295-95277317 CTTTTCCCATTTAGGAAAAAAGG - Intronic
1057611011 9:96543785-96543807 CATTTGCTCCTGGGGAAACAGGG + Intronic
1059529354 9:115021532-115021554 TCTTTCCTCTTGAGGCAAAATGG + Intronic
1059969111 9:119646410-119646432 CATTAGCTCTGGAGGAGAAATGG - Intergenic
1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG + Intronic
1189526061 X:41823251-41823273 CTTTTGGTCTTGATGGAAGAGGG + Intronic
1190780697 X:53592227-53592249 TTTTTTCTCCTGAGGAAAACTGG - Intronic
1195438223 X:104870311-104870333 CTCTTGCTTTTGAAGAAAAGTGG + Intronic
1196275141 X:113757906-113757928 CTTTAGCACTTGAGGATATATGG - Intergenic
1197748802 X:129951147-129951169 CTTTTTCCATTGAGGAAACACGG - Intergenic
1197999977 X:132423665-132423687 CTTTTTTTCATTAGGAAAAAAGG - Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1199123906 X:144091344-144091366 TTTTAGATCTTGAGGAAAACCGG + Intergenic
1199489747 X:148385252-148385274 CACATGCTCTGGAGGAAAAATGG - Intergenic
1199522679 X:148753992-148754014 CTTTTGCACTTGAGGGAGCAAGG + Intronic
1199651530 X:149949580-149949602 CTTTTGCTTTTCAGTGAAAATGG - Intergenic
1199686003 X:150266249-150266271 GTTTTGTTAATGAGGAAAAAGGG + Intergenic
1200014002 X:153145261-153145283 CTTCTTCTCTCCAGGAAAAAGGG - Intergenic
1200025598 X:153254692-153254714 CTTCTTCTCTCCAGGAAAAAGGG + Intergenic
1201518266 Y:14842000-14842022 CTTTTGCTGTAGAGGAACTAAGG - Exonic
1201639474 Y:16164114-16164136 TTTTAGATCTTGAGGAAAACTGG + Intergenic
1201663339 Y:16421210-16421232 TTTTAGATCTTGAGGAAAACTGG - Intergenic