ID: 963950209

View in Genome Browser
Species Human (GRCh38)
Location 3:151191003-151191025
Sequence ATGTAGTGGTAGAAGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 267}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963950204_963950209 18 Left 963950204 3:151190962-151190984 CCAGAAACTAAACTCTACTGGGA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267
963950200_963950209 20 Left 963950200 3:151190960-151190982 CCCCAGAAACTAAACTCTACTGG 0: 1
1: 0
2: 2
3: 18
4: 173
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267
963950197_963950209 27 Left 963950197 3:151190953-151190975 CCCACTCCCCCAGAAACTAAACT 0: 1
1: 0
2: 0
3: 21
4: 223
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267
963950196_963950209 28 Left 963950196 3:151190952-151190974 CCCCACTCCCCCAGAAACTAAAC 0: 1
1: 0
2: 2
3: 16
4: 240
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267
963950202_963950209 19 Left 963950202 3:151190961-151190983 CCCAGAAACTAAACTCTACTGGG 0: 1
1: 0
2: 0
3: 10
4: 117
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267
963950199_963950209 21 Left 963950199 3:151190959-151190981 CCCCCAGAAACTAAACTCTACTG 0: 1
1: 0
2: 0
3: 12
4: 167
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267
963950198_963950209 26 Left 963950198 3:151190954-151190976 CCACTCCCCCAGAAACTAAACTC 0: 1
1: 0
2: 1
3: 25
4: 232
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267
963950207_963950209 -6 Left 963950207 3:151190986-151191008 CCATGTTCAAATGGGTCATGTAG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG 0: 1
1: 0
2: 3
3: 25
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963950209 Original CRISPR ATGTAGTGGTAGAAGAGTGA TGG Intronic
902748448 1:18489333-18489355 ATGTATTGAGGGAAGAGTGAGGG - Intergenic
904225113 1:29010696-29010718 GTGGAGTGGGAGAACAGTGAAGG + Intronic
904820548 1:33240755-33240777 AAGCAGTGATAGCAGAGTGATGG + Intergenic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
908770325 1:67590100-67590122 ATGTTGTGGTTTAAGAATGAAGG - Intergenic
912643090 1:111366179-111366201 ATCTAGAGGTAGCAGTGTGATGG - Intergenic
912895870 1:113588355-113588377 ATGTGGTTGGAGCAGAGTGATGG + Intronic
913182301 1:116333986-116334008 ATGTAGTCATTGAAGAGTGTGGG - Intergenic
913304153 1:117406597-117406619 ATGTTGTGGTAGAGGAGTAAAGG + Intronic
916295474 1:163214428-163214450 ATGTAGTAATAGAAATGTGAAGG - Intronic
916841053 1:168601102-168601124 AGGTAATGGGAGAAGAATGAAGG + Intergenic
917193544 1:172443845-172443867 ATGGGGTGCCAGAAGAGTGAAGG - Exonic
917628165 1:176866519-176866541 AGGGAGTGGCAGAAGAGGGAGGG + Intronic
918017838 1:180654244-180654266 AAGTAGTTTTAGTAGAGTGATGG - Intronic
918233211 1:182554493-182554515 ATGTAGGGGTTGGAAAGTGAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
918761541 1:188417017-188417039 AGGTAAAGGAAGAAGAGTGATGG - Intergenic
919072472 1:192773388-192773410 ATTTAATGGTAGAAAAATGAGGG - Intergenic
919785576 1:201255837-201255859 ATGGAGTGATCAAAGAGTGATGG + Intergenic
919935764 1:202249682-202249704 ATGCAGTGGTGAAAGAGTTAAGG - Intronic
920695745 1:208180226-208180248 GTGGAGTGGTAGGAGAGTAAAGG + Intronic
921893338 1:220374511-220374533 ATGTATTGGGAGAAAACTGAAGG + Intergenic
1065735235 10:28745433-28745455 GTTGACTGGTAGAAGAGTGAAGG + Intergenic
1069230175 10:65998817-65998839 ATGTAGTGATAAAAGACAGAGGG + Intronic
1069979452 10:72242190-72242212 ATGCTGTGGGGGAAGAGTGAGGG + Intergenic
1070650299 10:78230538-78230560 AGGTAGTGGGAGGAGGGTGATGG - Intergenic
1071706287 10:88002774-88002796 ATGAAGTATTAGAAGAGAGATGG + Intergenic
1072035472 10:91559275-91559297 ATGTTTTGGTATAAGACTGAAGG - Intergenic
1072189835 10:93070255-93070277 AGGTTGGGGCAGAAGAGTGAAGG - Intergenic
1072801414 10:98394798-98394820 GTGGAGAGGTAGAAGAGGGAAGG + Intronic
1072879221 10:99207664-99207686 ATGTGGAGGGAGTAGAGTGAAGG + Intronic
1073664576 10:105516306-105516328 ATGTATTGGTAGGAAAGTGCAGG + Intergenic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1077713066 11:4554877-4554899 AGGTAGAGGAAGAAGAGGGATGG + Intergenic
1077892954 11:6432432-6432454 ATGAGGTGGTGGAAGAGTGAGGG + Intronic
1078086324 11:8234813-8234835 CTGGAGTAGTAGCAGAGTGAAGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1079745789 11:24127936-24127958 GTTTAGTAGGAGAAGAGTGATGG - Intergenic
1079898834 11:26155573-26155595 TAGAAATGGTAGAAGAGTGATGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1084349016 11:68580590-68580612 TTCTAGTTGAAGAAGAGTGAAGG + Intronic
1085913996 11:80862872-80862894 ATGTAGAAGGAGAAGAGTCAGGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087897500 11:103602982-103603004 AAGTAATCTTAGAAGAGTGAAGG - Intergenic
1088893532 11:114061568-114061590 AAGCAGTGTTCGAAGAGTGAGGG + Intronic
1089141878 11:116291826-116291848 ATGTGGTGGAAGAAGATTTATGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090468742 11:126959409-126959431 ATTTAGGGGTATAAGAGTCAGGG - Intronic
1090514989 11:127415584-127415606 ATGTAGTGAAAGAAGGGTGGGGG - Intergenic
1090997060 11:131876366-131876388 ATGTGGTGGGAGATGAGTGGAGG - Intronic
1092601350 12:10069299-10069321 ATGTGGTGGAAGAAGATTTATGG - Intergenic
1093532741 12:20186724-20186746 ATTTGGTAGTAGAAGACTGAGGG - Intergenic
1094098745 12:26737730-26737752 ATTTAGTAGTAGAAGACTTATGG - Intronic
1094321596 12:29189970-29189992 AAGTAGGGGTAGGAGAATGAGGG + Intronic
1096756873 12:53806944-53806966 ATCTTATGATAGAAGAGTGAAGG + Intergenic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1096949310 12:55448772-55448794 ATGTACTGGAAAAAGAGGGAGGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097604879 12:61741586-61741608 ATTGAGTGTTAGAAGAGTTATGG + Intronic
1099164763 12:79290465-79290487 ATGTGGGGGTAGCAGAGTGGAGG + Intronic
1099906289 12:88775324-88775346 ATGTTATGGTATAAGACTGATGG - Intergenic
1100371364 12:93971825-93971847 ATGGAGTGGCAGATGAGAGATGG + Intergenic
1100786663 12:98086133-98086155 ATATAGTGATAGAAGAGTGCAGG + Intergenic
1100904741 12:99284854-99284876 ATGTAGCTGGAGAATAGTGAAGG - Intronic
1100969046 12:100047089-100047111 ATGTAGTAGTGGAAGATTGAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1102208494 12:111106902-111106924 ATGTAGTGGAAGAGAAGTGTTGG + Intronic
1102693542 12:114780530-114780552 AAGTGGGGGTAGCAGAGTGATGG + Intergenic
1103110739 12:118276005-118276027 ATGTAGTAGGAGAAGAGATAGGG + Intronic
1106624385 13:31405578-31405600 ATGGACTTTTAGAAGAGTGAAGG - Intergenic
1107193212 13:37615404-37615426 ATGTAGTGGTATAATAGGCACGG - Intergenic
1107330158 13:39291048-39291070 ATTGAGTGGTAGAAGAGCGTAGG - Intergenic
1107778480 13:43873643-43873665 TTGTAATGGAAAAAGAGTGAAGG - Intronic
1109083972 13:57946370-57946392 AGGTGGTGGTAGAAGAGGGAAGG + Intergenic
1110442529 13:75541281-75541303 ATGTAGTGGTAGCAGCTTCAGGG + Intronic
1111290549 13:86163141-86163163 ATGTTGTGGTAGAAGAGCCAGGG + Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1111689900 13:91550525-91550547 ATATATTGGTACAAGAGTTAAGG + Intronic
1111774510 13:92642436-92642458 ATGTAATGGAAGAAGAGTCGAGG - Intronic
1113214911 13:108028862-108028884 ATGCAGAGGTAGAAGTGGGAGGG + Intergenic
1114578437 14:23734661-23734683 ATGGAGGGGTAGTAGAGAGAGGG + Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117204866 14:53431419-53431441 ATGTAGGGGAAGAAGATTTATGG + Intergenic
1120838265 14:89060485-89060507 ATGTATTCTTAGAAGAGGGAGGG - Intergenic
1121889355 14:97574505-97574527 CTGTAGTGGGAGAAGAGCCATGG + Intergenic
1124039556 15:26088078-26088100 ATGGGGTGGAAGAAGACTGATGG + Intergenic
1124944818 15:34254894-34254916 AAGTAGTGATAGTAGAGTCAGGG - Intronic
1125176354 15:36826564-36826586 ATGTGGAGGTAGAAGAGTTCTGG - Intergenic
1126502573 15:49362306-49362328 ACGTGGTGGTAGGAGAGTGAAGG - Intronic
1126943367 15:53790401-53790423 TGGTAGTGGTAGAAAAGTAAAGG + Intergenic
1127461639 15:59204649-59204671 CTGTAGGGGTAGAAGAGGGAGGG - Intronic
1129118371 15:73379358-73379380 ATGGGAAGGTAGAAGAGTGATGG - Intergenic
1130612470 15:85373831-85373853 TTCCAGTGGTAGAAGGGTGAGGG - Intergenic
1137748642 16:50842008-50842030 AAGCAGTGGTAGAGGAGAGAAGG + Intergenic
1137844237 16:51671454-51671476 ATGGAGTGGTAAGAGAGGGAAGG + Intergenic
1139949400 16:70661820-70661842 ATGTGGTGGGAATAGAGTGAGGG - Exonic
1140170405 16:72598706-72598728 ATGGAGTGGGAGAAGGGAGAGGG + Intergenic
1140452804 16:75084720-75084742 ATGTATTAGAAGAACAGTGAGGG - Intronic
1140494947 16:75377361-75377383 ATATAGTGGTAGAAGAATGATGG - Intronic
1140935148 16:79663401-79663423 AGCTAGTGGTAGAAAGGTGACGG + Intergenic
1141402373 16:83761476-83761498 ATGTAGTGGAAGAAGATTTATGG + Intronic
1142483169 17:230798-230820 ATGAGGTGGAAGAACAGTGAAGG - Intronic
1142708698 17:1711457-1711479 AGGTGGGGGTAGAAGAATGAAGG - Intergenic
1143016844 17:3895338-3895360 ATGTAGGGGTAGGAGAATGGAGG + Intergenic
1143444293 17:6998228-6998250 AGGTAGGGGAAGATGAGTGAAGG + Intronic
1144673818 17:17148169-17148191 AAGTAGGGGTAGGAGAGTGTGGG + Intronic
1145282174 17:21476299-21476321 AGGTAGTGGCAGCAGGGTGATGG + Intergenic
1149682060 17:58513916-58513938 ATGGAATGGTGGAAGAGGGAAGG + Intronic
1153391797 18:4570126-4570148 ATGTGGTGGGAGGAGAGTGAGGG - Intergenic
1155606798 18:27615589-27615611 AGGTAGTGGAAGAAGATTTATGG + Intergenic
1156794950 18:41033084-41033106 ATGTATTAACAGAAGAGTGACGG - Intergenic
1157543415 18:48529858-48529880 ATCCAGTGGTAGAAGATTGTAGG + Intergenic
1158422833 18:57311453-57311475 ATGTGGTGGAAGAAGATTTATGG - Intergenic
1158747025 18:60212875-60212897 ACGTGGTGGCAGAAGAGAGAGGG - Intergenic
1161621429 19:5299286-5299308 ATGTAGCTGGAGCAGAGTGAGGG - Intronic
1162329457 19:10018674-10018696 AAGTAATGCTAGAAGAGTGAGGG + Intronic
1163144747 19:15372957-15372979 ATGGACTGGGAGAAGAGGGACGG + Exonic
1163149236 19:15401289-15401311 ATGTTCTGGGAGAAGAGGGAGGG + Exonic
1164591928 19:29512133-29512155 ATGAAGAGGAAGAAGAGGGAGGG + Intergenic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
1166846286 19:45730679-45730701 AGGTAGTAGTAGAAGAATGGTGG - Intronic
925472850 2:4181761-4181783 ATGTTTTGGTAGAAAAATGATGG - Intergenic
925657745 2:6167636-6167658 AGGTAATGGGGGAAGAGTGAGGG + Intergenic
926148781 2:10412986-10413008 ATGTGGAGGCAGAAGAGTGTAGG - Intronic
930295961 2:49553896-49553918 GATTAGTGGTAGAAGAGAGAAGG - Intergenic
931384155 2:61782135-61782157 ATGTAGTGGAAGAAGATTTATGG + Intergenic
931931163 2:67135631-67135653 ATATAGTGGTAGAAGGGTGGGGG - Intergenic
932166471 2:69512277-69512299 ATCTAGTTGTATTAGAGTGATGG - Intronic
933326492 2:80844461-80844483 AGGTAGTGGTAGGAGATTGGAGG + Intergenic
934913479 2:98279389-98279411 ATGTAGAGGCAGGAGAGTGCTGG - Intronic
935087591 2:99863462-99863484 ATATAGTGGCTGAAGAGTTAGGG - Intronic
937037590 2:118794610-118794632 ATGTAGTGGCAGAAAACTAAAGG - Intergenic
939569131 2:143819345-143819367 ATTTGGTGGTAGAAGGGGGAGGG + Intergenic
940146091 2:150545494-150545516 GTGTTATGGTAGAAAAGTGATGG - Intergenic
940168924 2:150805710-150805732 AGGTGGTGGTAGGAGAGTGCTGG - Intergenic
942619066 2:177828451-177828473 TTTTAGTGATAGAAGAGAGATGG + Intronic
942627896 2:177922809-177922831 ATGTAGAGGGAGAAGAGTGCTGG - Intronic
944562051 2:200949465-200949487 ATGTAGTGGTATAATAATCATGG + Intronic
945566091 2:211401835-211401857 ATTTATTGGTAGAAGAGCTAGGG - Intronic
1168949338 20:1785952-1785974 CTGTGGTGGGAGCAGAGTGAGGG + Intergenic
1169643354 20:7779847-7779869 TTCCAGGGGTAGAAGAGTGATGG + Intergenic
1172796802 20:37545590-37545612 ATGTAGAGAAAGAAGAGTGGAGG - Intergenic
1173430694 20:42984960-42984982 ATGTACTGGTAGAAGACAGTGGG + Intronic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1177679578 21:24348683-24348705 ATGTGGTGGGAGAAGATTTATGG + Intergenic
1177941104 21:27412170-27412192 ATGTAAGAGTAGAAGAGTGCCGG - Intergenic
1178226469 21:30725172-30725194 AGGAAGAGGTGGAAGAGTGAGGG + Intergenic
1178819123 21:35959371-35959393 ATGTGGTTGTATAGGAGTGAAGG - Intronic
1179046244 21:37847896-37847918 AAGGAGGGGAAGAAGAGTGATGG + Intronic
1181885627 22:26020022-26020044 ATGTAGTGGAAGAAGAAGAATGG + Intronic
1183792627 22:40085460-40085482 ATTGAGGGGAAGAAGAGTGAGGG - Intronic
1185189495 22:49425522-49425544 CTGTAGTGGGAGGTGAGTGACGG - Intronic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951210638 3:19970640-19970662 ATGAAGCGGTCTAAGAGTGATGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
955391715 3:58526860-58526882 CTGTAGGGGCATAAGAGTGAAGG + Intronic
956734749 3:72229658-72229680 ATTCAGAGGTAGAAGAATGAGGG + Intergenic
957815878 3:85296532-85296554 TTGTAGTGGAAAAAGACTGAAGG - Intronic
957934845 3:86929070-86929092 ATGTAGTGATAGAAGAGCTATGG + Intergenic
959825880 3:110795188-110795210 ATGTGGTGGAAGAAGATTTATGG - Intergenic
960129856 3:114044232-114044254 ATTTAGCGGTTGAAGAGAGAAGG + Intronic
960175570 3:114513801-114513823 ATGAAGTGCTAGAAGATGGAAGG - Intronic
960301548 3:116008936-116008958 AAGAAGTGGTAGAAGAGACAAGG - Intronic
963302832 3:143618030-143618052 ATAAAGTGGTATCAGAGTGAAGG + Intronic
963855171 3:150245871-150245893 ATGTACTGGGAGAATATTGAAGG + Intergenic
963950209 3:151191003-151191025 ATGTAGTGGTAGAAGAGTGATGG + Intronic
965132298 3:164716433-164716455 CATTAGTGGAAGAAGAGTGATGG - Intergenic
965550440 3:169959543-169959565 ATGGTGAGGTAGAGGAGTGACGG + Intergenic
966089800 3:176119207-176119229 ATGGAATGTTAGAAGTGTGACGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967031181 3:185608652-185608674 ATGTAGTGCAAGAAGAGATACGG + Intronic
969411753 4:7033218-7033240 GTGCAGTGGTAGTTGAGTGAAGG + Intergenic
969726984 4:8925556-8925578 TTGTAGTTTTAGAAGAGTCAGGG - Intergenic
970158310 4:13163799-13163821 CTGTAGTGGCAGAAGGGAGAAGG - Intergenic
971488956 4:27191049-27191071 ACATAGTGGAAGAAGAATGATGG - Intergenic
971744335 4:30559617-30559639 ATGTGGTGGAAGAAGATTTATGG - Intergenic
972787518 4:42341070-42341092 ATGTAGTGGTAGAAAAAAGCTGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973813730 4:54598693-54598715 TTGTTATGGTAGAAGAGAGAAGG + Intergenic
973972643 4:56228822-56228844 ATATTGTGATAGAAGAATGATGG + Intronic
974189795 4:58489830-58489852 ATGCCGTTTTAGAAGAGTGAAGG + Intergenic
974367373 4:60968852-60968874 ATTTATGAGTAGAAGAGTGAAGG - Intergenic
978326255 4:107560590-107560612 ACGTGGTGGAAGAAGAGTTATGG - Intergenic
978375097 4:108066588-108066610 ATTTAGCGGTAGAAGCGTAACGG - Intronic
980148651 4:129020873-129020895 ATAGAGTGGTAGAAGAGACAAGG + Intronic
980488925 4:133499426-133499448 TTGTAGTGGTAGAAAATTGGTGG - Intergenic
981509813 4:145543657-145543679 ATGTAGAGCTGGAAGAATGATGG - Intronic
982921163 4:161276837-161276859 GGGTAGTGGTGGAAGAGAGAAGG - Intergenic
983955634 4:173695723-173695745 ATGTAGCAGTAGTAGAGAGAAGG - Intergenic
984287784 4:177755644-177755666 AGTTAGTGGTAGAAGTGGGAAGG - Intronic
984383079 4:179019486-179019508 ATGTGGTGGAAGAAGATTTATGG - Intergenic
984542712 4:181060455-181060477 ATGTAGTGTTAGGTGGGTGAGGG - Intergenic
984767981 4:183414041-183414063 AGGGAGGGGCAGAAGAGTGAAGG - Intergenic
987844727 5:23268319-23268341 ATGTGGTGGAAGAAGATTTATGG + Intergenic
988180832 5:27789545-27789567 ATGTGGCGGAAGAAGAGTTATGG - Intergenic
988567976 5:32335492-32335514 ATGTATTTTTAGGAGAGTGAAGG + Intergenic
988589980 5:32540402-32540424 GAGTGGGGGTAGAAGAGTGAGGG - Intronic
988731565 5:33977682-33977704 AGGCAGTGGTAGAGGAGTGAGGG + Intronic
988744044 5:34114791-34114813 ATGATGTGTTAGAAGAGAGATGG - Intronic
988969864 5:36456617-36456639 GTGTAGTGATAGAAAAATGACGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989598924 5:43183738-43183760 ATGATGTCCTAGAAGAGTGAAGG + Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
991395560 5:66201358-66201380 ATGTAGAGGAACAAGAATGATGG - Intergenic
991651590 5:68860975-68860997 ATGTAGTGGTACATCAGTGTGGG - Intergenic
995700272 5:114928172-114928194 TTGTAGGGAGAGAAGAGTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999404518 5:151295015-151295037 ATATAGAGGTTGCAGAGTGATGG - Intronic
1000987302 5:167874981-167875003 AGGTAGAAGTGGAAGAGTGATGG - Intronic
1002935921 6:1672293-1672315 ATGGAGTGGAAGAACAGGGAAGG + Intronic
1003201856 6:3968753-3968775 ATGTGGTGGAAGAAGATTTATGG - Intergenic
1004576209 6:16897687-16897709 ATGGATGGGTAGATGAGTGATGG + Intergenic
1005797986 6:29387861-29387883 AAATTTTGGTAGAAGAGTGAGGG - Intronic
1005976566 6:30804547-30804569 CTGTAGTTGTAGAAAAGTGCAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007326087 6:41061043-41061065 ATGTTGTGCTGGAAGAGTGATGG + Intronic
1008348434 6:50458255-50458277 ATGTATTGGTTGAATAGTTACGG - Intergenic
1008439980 6:51521514-51521536 AGGTTGGGGTAGAAGTGTGAAGG - Intergenic
1008837951 6:55860524-55860546 TTGTAATGCTAGAAGTGTGAAGG - Intronic
1011112310 6:83852423-83852445 GTTTAGTGGTAGATAAGTGAGGG + Intergenic
1011275962 6:85631658-85631680 AGGTAGTGTTAAAAGAGTTAAGG - Intronic
1011807500 6:91088646-91088668 GTGTATTGGCAGAAGAGTGTGGG + Intergenic
1011935617 6:92773024-92773046 CTGTAGTGTTAGAAAAGTGTTGG + Intergenic
1012976167 6:105783401-105783423 ATGGAGTGCTAGAAGAGTGCTGG - Intergenic
1013295208 6:108752629-108752651 ATGTATAGGTGGAAGAGGGAAGG + Intergenic
1015042391 6:128738113-128738135 ATCTAGTGATAGCAGACTGAGGG + Intergenic
1015849087 6:137553034-137553056 ATGAAGTGGTAGCAGTGTGCAGG + Intergenic
1016764280 6:147774655-147774677 CTGTGGTTGTAGAAGAGTGGAGG + Intergenic
1016854702 6:148655577-148655599 ATGATGTCCTAGAAGAGTGAAGG - Intergenic
1018055644 6:160049994-160050016 GTTTATTGGTAGAAGAGTGCAGG + Intronic
1018269025 6:162055908-162055930 ATGTAATGGTAAAGGAGGGAGGG - Intronic
1018543274 6:164907331-164907353 CTGTAGTGGTAGGAGAGTGATGG - Intergenic
1021292675 7:18865380-18865402 AGGGAGTGGTAAAAGAGAGAAGG + Intronic
1021877521 7:25062470-25062492 ACATAGTGGTAGAAGAGCAATGG + Intergenic
1024006487 7:45228184-45228206 ATTTAGAGGTAGAAGAGAGGAGG + Intergenic
1024718827 7:52111463-52111485 ATGTAGTGGAAGAAGATTTGTGG + Intergenic
1026142313 7:67716829-67716851 ATGTGGTGGGAGAAGATTTATGG + Intergenic
1026242089 7:68584813-68584835 ATGTGGTGGAAGAAGATTTATGG - Intergenic
1027229784 7:76265425-76265447 CTGTAGTGGGAGGAGAGGGAGGG - Exonic
1028749337 7:94365000-94365022 ATGTGGTGGAAGAAGATTTATGG - Intergenic
1028767086 7:94571583-94571605 ATGTAGTGGTAGAAAGCTTAGGG + Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030423606 7:109342030-109342052 ATGTAATGTTAGAATAGTCATGG + Intergenic
1033512614 7:142074701-142074723 ATGTTCTGGTAGAAAAGAGAAGG + Intronic
1033568597 7:142604615-142604637 ATGTATTAGTAGATGAATGAGGG - Intergenic
1033913642 7:146296273-146296295 ATGAATTGGTTGAAGAGTGCAGG - Intronic
1034238919 7:149594647-149594669 ATGTAGAGGTGGGAGAGTGTGGG - Intergenic
1034325988 7:150233693-150233715 GTGTAATGTAAGAAGAGTGATGG - Intergenic
1034527926 7:151677825-151677847 ATGTGGTGGAAGAAGATTGATGG - Intronic
1034767221 7:153735565-153735587 GTGTAATGTAAGAAGAGTGATGG + Intergenic
1035916122 8:3625426-3625448 ATGTAGTGGGAGAGGAAAGAGGG - Intronic
1036048229 8:5167368-5167390 ATGTAAAGTTAGAAAAGTGATGG - Intergenic
1036924185 8:12888226-12888248 ATGTATTTGTGGAAGATTGAAGG + Intergenic
1038122637 8:24635047-24635069 ATGTGGTGGAAGAAGATTAATGG + Intergenic
1039786603 8:40839796-40839818 ATGAAGTCTTGGAAGAGTGAGGG + Intronic
1040789795 8:51213735-51213757 ATGTAGTGGTAGAAAAAAAATGG - Intergenic
1040802673 8:51360861-51360883 ATGTGGTGGAAGAAGATTTACGG - Intronic
1041157354 8:55002188-55002210 ATGTAGGGGAAGAGGAGTGGAGG - Intergenic
1041346016 8:56898713-56898735 TTGTAGTGGAAGAAAAGGGACGG - Intergenic
1041451084 8:58007456-58007478 ATGGAGGGGTGGAAAAGTGATGG - Intronic
1042823857 8:72960529-72960551 ATATAGTGGCAGAACAGGGATGG + Intergenic
1043384443 8:79734152-79734174 AAGTAGTGGGAGATGAGTCATGG + Intergenic
1045633576 8:104156274-104156296 AGGTAGTGGCTGAAGAGAGAGGG - Intronic
1046005349 8:108474749-108474771 ATGTAGTGGTTGAAGAGTACAGG + Intronic
1046178613 8:110612379-110612401 ATTTAATGTTACAAGAGTGATGG - Intergenic
1046330642 8:112710650-112710672 ATGTAGTGGCCCAAGTGTGAAGG + Intronic
1046952769 8:120033903-120033925 ATGTACTGGTAGACAAATGAAGG + Intronic
1046964679 8:120151037-120151059 ATGTAGTGGATGATAAGTGAAGG + Intronic
1048291835 8:133187047-133187069 ATGTATGGGTTGAAGAATGAAGG - Intergenic
1049125338 8:140781911-140781933 ATGTAATGGTGGGAGAGGGAGGG + Intronic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051264026 9:15293952-15293974 ATGTGGTGGAAGAAGATTTATGG - Intronic
1052085025 9:24254381-24254403 CTGTAGAGGAAGAAGAGTTAGGG + Intergenic
1052548851 9:29921143-29921165 ATGTATTGTTGGAAGACTGACGG + Intergenic
1054903408 9:70392901-70392923 ATGCAGTGGTACAAGTGTGTTGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056151349 9:83792723-83792745 ATGTATAGGTAAAAGAGAGAGGG + Intronic
1056316576 9:85396080-85396102 GTGTGGGGGTAGAAAAGTGAGGG + Intergenic
1056718087 9:89049880-89049902 ACGTAGTGGAAGAAGATTTATGG - Intronic
1057620378 9:96629294-96629316 CTGTAGTTGTGGAAGGGTGAAGG + Intergenic
1058098726 9:100893496-100893518 ATGTGGTGGAAGAAGATTTATGG - Intergenic
1059710127 9:116860049-116860071 ATGGAGAGGAAGGAGAGTGATGG + Intronic
1187937213 X:24347493-24347515 ATGCAGTGGAAGAAGATTTATGG + Intergenic
1188305573 X:28557249-28557271 ATGTGGTGGCAGAAGAGAGAGGG + Intergenic
1192710670 X:73581993-73582015 AAATAGTGTTAGAAGACTGAGGG - Intronic
1195726073 X:107918011-107918033 ATGAAGTAGAAGAAGAGTCAAGG - Intronic
1196586581 X:117436112-117436134 ATGCAGGGGTAGAGGAGAGAAGG - Intergenic
1198498521 X:137218747-137218769 ATGTCCTTTTAGAAGAGTGAAGG - Intergenic
1199602525 X:149550591-149550613 ACACAGTGGTAGACGAGTGAGGG - Intergenic
1199647862 X:149928884-149928906 ACACAGTGGTAGACGAGTGAGGG + Intergenic
1201351026 Y:13041590-13041612 TTGTAGTGGTAGGAGGGAGATGG + Intergenic
1202110802 Y:21417196-21417218 ATGTAGTAGGAGAAGAGAGAAGG + Intergenic
1202233586 Y:22682524-22682546 ATGTAGTAGAAAAAGAGAGAAGG - Intergenic
1202309570 Y:23513634-23513656 ATGTAGTAGAAAAAGAGAGAAGG + Intergenic
1202561231 Y:26156958-26156980 ATGTAGTAGAAAAAGAGAGAAGG - Intergenic