ID: 963961908

View in Genome Browser
Species Human (GRCh38)
Location 3:151318880-151318902
Sequence TGTCCCTTCACTACAGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963961908 Original CRISPR TGTCCCTTCACTACAGTAGG TGG Intronic
902575935 1:17377593-17377615 AGTCCCTCCATCACAGTAGGCGG + Intronic
907618432 1:55949601-55949623 TTTCTCTTCTCTCCAGTAGGAGG - Intergenic
908465996 1:64396181-64396203 TCTCCCTTCTATATAGTAGGGGG + Intergenic
908534088 1:65062775-65062797 TGTCCCTTCACAACACTTAGTGG + Intergenic
909713133 1:78674498-78674520 TCTCCCTTTGCTACAGTAGGTGG - Intergenic
911171733 1:94777014-94777036 TCTCCCTTCTCTATAGTAGGAGG - Intergenic
913144186 1:115973056-115973078 TGTCGCATCTTTACAGTAGGAGG - Intergenic
915119379 1:153619157-153619179 TGCCCCTTCTCTAAAGAAGGAGG + Intronic
917351541 1:174083235-174083257 TGCCACTGCACTCCAGTAGGTGG - Intergenic
1065320622 10:24505753-24505775 TGTCCCTTCCCAAGAGAAGGAGG + Intronic
1065732985 10:28726127-28726149 TATCCCTTGACTACAATATGTGG - Intergenic
1067707528 10:48620965-48620987 TGTCACTTCACAAAAGTGGGAGG + Intronic
1069373054 10:67767266-67767288 TGTCCCCTCACTAGAGGAAGAGG + Intergenic
1069900315 10:71703079-71703101 GCTCCCTTTACTACAGTAGAGGG + Intronic
1073448519 10:103595434-103595456 TGTCCCTTCATTAGGGAAGGAGG - Exonic
1073948624 10:108782093-108782115 TGTCTCTTCTCCACAGTAGTTGG - Intergenic
1077460644 11:2707691-2707713 TTTCCCATCTCTACAGTGGGTGG - Intronic
1080406298 11:31982479-31982501 TGTGCCTTCTCCACAGTGGGAGG + Intronic
1086443109 11:86848057-86848079 TGTCCCTTACAAACAGTAGGAGG + Intronic
1086754451 11:90542267-90542289 TGGCACTTCACTACACTTGGTGG - Intergenic
1089845902 11:121458060-121458082 TGTCCCTCCATTACAGTGGGTGG - Intronic
1090128438 11:124115032-124115054 TGCCCCTCCCCTACAGCAGGGGG - Intergenic
1099141460 12:78981544-78981566 TCTCCCTTCACTCCATTAGTTGG - Intronic
1103368747 12:120402366-120402388 TCTGCCTTCACGACAGGAGGAGG + Intergenic
1108305872 13:49132023-49132045 CGTCCCTTCATCTCAGTAGGTGG + Intronic
1109814056 13:67556071-67556093 TCTCCCTACACTGCAGTAGTTGG - Intergenic
1112057264 13:95701388-95701410 TTTCCCTGCTCTGCAGTAGGAGG + Intronic
1114668824 14:24398437-24398459 TGTCCCTAGACTTCAGTGGGGGG + Intergenic
1129742884 15:77998499-77998521 TGTCACCTCTCTACAGAAGGTGG - Intronic
1130557869 15:84935530-84935552 AGTCCCTTCCCTGCAGCAGGGGG + Intronic
1131477104 15:92749258-92749280 TGTCTCTGCACTAAATTAGGTGG - Intronic
1133433174 16:5756256-5756278 TGTCCATACACTGCAGGAGGTGG - Intergenic
1134141444 16:11723214-11723236 TGCCCCTGCACTCCAGCAGGTGG + Intronic
1136044363 16:27603544-27603566 CTTCCCTTCACTGCAGTTGGGGG - Intronic
1138891559 16:61149928-61149950 TGTCTGTTCACTTCAGTGGGTGG - Intergenic
1142075134 16:88113615-88113637 TGTGCCTTCACCACAGTCTGCGG - Intronic
1147458640 17:40554426-40554448 GGCCCCTTCACTCCAGCAGGTGG + Exonic
1150008267 17:61483017-61483039 GGTCACCTCACTGCAGTAGGAGG - Exonic
1155366326 18:25052363-25052385 TGTCCCTTCACTGCAGTTTGGGG - Intergenic
1159366484 18:67472246-67472268 TTTCCATTCACTACAATATGGGG - Intergenic
1159782492 18:72676041-72676063 AGTCCCTTCACAACAGTACCTGG + Intergenic
928345733 2:30493603-30493625 TGTATCTTGACTACAGTTGGGGG - Intronic
932434230 2:71693881-71693903 TGTCCCCTCAGTTCAGTAGCTGG - Intergenic
934522947 2:95031321-95031343 TGTCCCTTCATTCCTGTTGGGGG - Intronic
935484002 2:103630137-103630159 GGTCCCTTCACTTCAGGAGGTGG - Intergenic
936256801 2:110923035-110923057 TCTCCCTACATCACAGTAGGGGG + Intronic
937503883 2:122514473-122514495 TGTTCGTTCACTCCAGCAGGAGG + Intergenic
942392605 2:175511311-175511333 TGTCACTGCACTACAGTGGCAGG + Intergenic
1174077212 20:47946165-47946187 TTTTATTTCACTACAGTAGGGGG + Intergenic
1178405135 21:32317370-32317392 TAACCCTGCACTACAGGAGGAGG + Intronic
1183122868 22:35744193-35744215 TCTCACGTCACTTCAGTAGGGGG + Exonic
949418258 3:3836781-3836803 TCTCCCTAGACTACAGTGGGTGG + Intronic
954535328 3:51355439-51355461 TGTCCCTTCTCTTCATCAGGCGG + Intronic
955937087 3:64112369-64112391 TCTCCCTTCTCTACAGGTGGGGG + Intronic
956045154 3:65188236-65188258 GGTCCCTTCATTACCGAAGGTGG - Intergenic
960005936 3:112781197-112781219 TGTCCCTTCAGTCCTGTGGGTGG + Intronic
963492941 3:146023652-146023674 TGGCCCTGCAATACATTAGGAGG - Intergenic
963961908 3:151318880-151318902 TGTCCCTTCACTACAGTAGGTGG + Intronic
964117165 3:153148372-153148394 TCTCCCTCCACTATAGAAGGTGG + Intergenic
964917007 3:161851493-161851515 TGTCCCTTACAAACAGTAGGAGG - Intergenic
972791703 4:42378415-42378437 TGTACTTTCAATCCAGTAGGTGG - Intergenic
976111392 4:81677609-81677631 TGTGGATTCAGTACAGTAGGTGG + Intronic
976648128 4:87406613-87406635 TGTCCCCCCACCACAGCAGGCGG - Intergenic
977458946 4:97300004-97300026 TGTTCCTTAACTATAGTAGGAGG - Intronic
978725096 4:111960254-111960276 TGTCCATGCAGTGCAGTAGGAGG + Intergenic
980116936 4:128688144-128688166 TGTCCCAAAACTACAGAAGGAGG + Intergenic
986323479 5:6653257-6653279 TGTCCCTCCTCTACAAAAGGAGG + Intronic
986553276 5:8982578-8982600 TGTCCCTGCAGTACAGCAGCAGG - Intergenic
992229821 5:74653082-74653104 TCTAGCTTGACTACAGTAGGAGG + Intronic
998041596 5:138954062-138954084 AGTCCCTTCTCTTCAGAAGGTGG + Intronic
1002345258 5:178544237-178544259 AGTCCCTTTACTTCAGTGGGAGG - Intronic
1006025406 6:31143544-31143566 TGTCTCTTCTGTACAGTTGGAGG + Intronic
1011935554 6:92772141-92772163 TGTGCCTTCAGCACAGTAGAAGG + Intergenic
1026239204 7:68557361-68557383 TTTCCCTTCTCTACAGGAAGGGG + Intergenic
1032117501 7:129129099-129129121 TGTCCCTTCACTTTATGAGGAGG + Intergenic
1035941719 8:3908991-3909013 TTCTCCTTCACTACTGTAGGAGG + Intronic
1037021675 8:13979260-13979282 TGTATCTTAATTACAGTAGGTGG + Intergenic
1037426656 8:18762717-18762739 TATCCCTTCAATACAGTATAAGG + Intronic
1053591411 9:39518118-39518140 TGTTCATTCACTAAATTAGGAGG - Intergenic
1053849254 9:42273477-42273499 TGTTCATTCACTAAATTAGGAGG - Intergenic
1054574896 9:66847171-66847193 TGTTCATTCACTAAATTAGGAGG + Intergenic
1193300459 X:79882207-79882229 TGTCTTTTCACTCCAGTAGGTGG - Intergenic
1201750009 Y:17422002-17422024 TGTCCCTTAAAAACAGTAGGAGG - Intergenic
1201897323 Y:19005728-19005750 TGTCCCTTCCCTTCCTTAGGCGG - Intergenic