ID: 963975326

View in Genome Browser
Species Human (GRCh38)
Location 3:151473865-151473887
Sequence ATGATAGCCCTTATAATTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963975323_963975326 -9 Left 963975323 3:151473851-151473873 CCCTGAAAATTCTCATGATAGCC No data
Right 963975326 3:151473865-151473887 ATGATAGCCCTTATAATTGGAGG No data
963975324_963975326 -10 Left 963975324 3:151473852-151473874 CCTGAAAATTCTCATGATAGCCC No data
Right 963975326 3:151473865-151473887 ATGATAGCCCTTATAATTGGAGG No data
963975321_963975326 11 Left 963975321 3:151473831-151473853 CCTGTTTTTTTAATAGCTTCCCC No data
Right 963975326 3:151473865-151473887 ATGATAGCCCTTATAATTGGAGG No data
963975322_963975326 -8 Left 963975322 3:151473850-151473872 CCCCTGAAAATTCTCATGATAGC No data
Right 963975326 3:151473865-151473887 ATGATAGCCCTTATAATTGGAGG No data
963975320_963975326 22 Left 963975320 3:151473820-151473842 CCTGGCTTGCTCCTGTTTTTTTA No data
Right 963975326 3:151473865-151473887 ATGATAGCCCTTATAATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963975326 Original CRISPR ATGATAGCCCTTATAATTGG AGG Intergenic
No off target data available for this crispr