ID: 963976099

View in Genome Browser
Species Human (GRCh38)
Location 3:151481769-151481791
Sequence TTAGTTGAGGGGATCTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963976099_963976106 24 Left 963976099 3:151481769-151481791 CCAACAGAGATCCCCTCAACTAA No data
Right 963976106 3:151481816-151481838 AGCAAATCTGTTAACTAAAGAGG No data
963976099_963976103 -6 Left 963976099 3:151481769-151481791 CCAACAGAGATCCCCTCAACTAA No data
Right 963976103 3:151481786-151481808 AACTAAGATTTCCCACTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963976099 Original CRISPR TTAGTTGAGGGGATCTCTGT TGG (reversed) Intergenic
No off target data available for this crispr