ID: 963978249

View in Genome Browser
Species Human (GRCh38)
Location 3:151507115-151507137
Sequence TGATTCTGGCTTGCAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963978249_963978256 26 Left 963978249 3:151507115-151507137 CCAGCAGCTGCAAGCCAGAATCA No data
Right 963978256 3:151507164-151507186 GCTTTCCCTGTTTTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963978249 Original CRISPR TGATTCTGGCTTGCAGCTGC TGG (reversed) Intergenic