ID: 963978256

View in Genome Browser
Species Human (GRCh38)
Location 3:151507164-151507186
Sequence GCTTTCCCTGTTTTGTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963978254_963978256 -10 Left 963978254 3:151507151-151507173 CCTTTATTCCTCTGCTTTCCCTG No data
Right 963978256 3:151507164-151507186 GCTTTCCCTGTTTTGTCTCCTGG No data
963978253_963978256 -9 Left 963978253 3:151507150-151507172 CCCTTTATTCCTCTGCTTTCCCT No data
Right 963978256 3:151507164-151507186 GCTTTCCCTGTTTTGTCTCCTGG No data
963978252_963978256 0 Left 963978252 3:151507141-151507163 CCAATATGGCCCTTTATTCCTCT No data
Right 963978256 3:151507164-151507186 GCTTTCCCTGTTTTGTCTCCTGG No data
963978251_963978256 12 Left 963978251 3:151507129-151507151 CCAGAATCAAGTCCAATATGGCC No data
Right 963978256 3:151507164-151507186 GCTTTCCCTGTTTTGTCTCCTGG No data
963978249_963978256 26 Left 963978249 3:151507115-151507137 CCAGCAGCTGCAAGCCAGAATCA No data
Right 963978256 3:151507164-151507186 GCTTTCCCTGTTTTGTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963978256 Original CRISPR GCTTTCCCTGTTTTGTCTCC TGG Intergenic
No off target data available for this crispr