ID: 963982069

View in Genome Browser
Species Human (GRCh38)
Location 3:151549451-151549473
Sequence CTGGATATAAAGAAGAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963982069_963982073 14 Left 963982069 3:151549451-151549473 CCTATCTTCTTCTTTATATCCAG No data
Right 963982073 3:151549488-151549510 CTCAATTCCTATGCATTTAAGGG No data
963982069_963982072 13 Left 963982069 3:151549451-151549473 CCTATCTTCTTCTTTATATCCAG No data
Right 963982072 3:151549487-151549509 CCTCAATTCCTATGCATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963982069 Original CRISPR CTGGATATAAAGAAGAAGAT AGG (reversed) Intergenic
No off target data available for this crispr