ID: 963982561

View in Genome Browser
Species Human (GRCh38)
Location 3:151556063-151556085
Sequence CAGTCTGACGGAACTGCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963982554_963982561 24 Left 963982554 3:151556016-151556038 CCCTCACTACTTGTATATGAGCA No data
Right 963982561 3:151556063-151556085 CAGTCTGACGGAACTGCTCTAGG No data
963982555_963982561 23 Left 963982555 3:151556017-151556039 CCTCACTACTTGTATATGAGCAG No data
Right 963982561 3:151556063-151556085 CAGTCTGACGGAACTGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963982561 Original CRISPR CAGTCTGACGGAACTGCTCT AGG Intergenic