ID: 963985859

View in Genome Browser
Species Human (GRCh38)
Location 3:151593858-151593880
Sequence TAGGGGATTTTGAGAGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963985854_963985859 5 Left 963985854 3:151593830-151593852 CCTTTTTTTAATAAATTTGATTT No data
Right 963985859 3:151593858-151593880 TAGGGGATTTTGAGAGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963985859 Original CRISPR TAGGGGATTTTGAGAGAAAA GGG Intergenic
No off target data available for this crispr