ID: 963990663

View in Genome Browser
Species Human (GRCh38)
Location 3:151649692-151649714
Sequence TAGAATGGATATGCTAGATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963990663_963990666 11 Left 963990663 3:151649692-151649714 CCCTATCTAGCATATCCATTCTA No data
Right 963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963990663 Original CRISPR TAGAATGGATATGCTAGATA GGG (reversed) Intergenic
No off target data available for this crispr