ID: 963990664

View in Genome Browser
Species Human (GRCh38)
Location 3:151649693-151649715
Sequence ATAGAATGGATATGCTAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963990664_963990666 10 Left 963990664 3:151649693-151649715 CCTATCTAGCATATCCATTCTAT No data
Right 963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963990664 Original CRISPR ATAGAATGGATATGCTAGAT AGG (reversed) Intergenic
No off target data available for this crispr