ID: 963990665

View in Genome Browser
Species Human (GRCh38)
Location 3:151649707-151649729
Sequence ATTTGAGATACTTAATAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963990665_963990666 -4 Left 963990665 3:151649707-151649729 CCATTCTATTAAGTATCTCAAAT No data
Right 963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963990665 Original CRISPR ATTTGAGATACTTAATAGAA TGG (reversed) Intergenic
No off target data available for this crispr