ID: 963990666

View in Genome Browser
Species Human (GRCh38)
Location 3:151649726-151649748
Sequence AAATTCAACATGTCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963990665_963990666 -4 Left 963990665 3:151649707-151649729 CCATTCTATTAAGTATCTCAAAT No data
Right 963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG No data
963990664_963990666 10 Left 963990664 3:151649693-151649715 CCTATCTAGCATATCCATTCTAT No data
Right 963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG No data
963990663_963990666 11 Left 963990663 3:151649692-151649714 CCCTATCTAGCATATCCATTCTA No data
Right 963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963990666 Original CRISPR AAATTCAACATGTCTGAAAC AGG Intergenic
No off target data available for this crispr