ID: 964000244

View in Genome Browser
Species Human (GRCh38)
Location 3:151762332-151762354
Sequence GTCCTCAGTGAGCTAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 251}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964000239_964000244 -4 Left 964000239 3:151762313-151762335 CCCTACTGGCTCCCATGGGGTCC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 251
964000240_964000244 -5 Left 964000240 3:151762314-151762336 CCTACTGGCTCCCATGGGGTCCT 0: 1
1: 0
2: 1
3: 15
4: 194
Right 964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 251
964000232_964000244 15 Left 964000232 3:151762294-151762316 CCCTGGCTGCGATGGACCACCCT 0: 1
1: 0
2: 1
3: 5
4: 87
Right 964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 251
964000231_964000244 16 Left 964000231 3:151762293-151762315 CCCCTGGCTGCGATGGACCACCC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 251
964000233_964000244 14 Left 964000233 3:151762295-151762317 CCTGGCTGCGATGGACCACCCTA 0: 1
1: 0
2: 0
3: 6
4: 55
Right 964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 251
964000237_964000244 -1 Left 964000237 3:151762310-151762332 CCACCCTACTGGCTCCCATGGGG 0: 1
1: 1
2: 1
3: 19
4: 203
Right 964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 251
964000229_964000244 28 Left 964000229 3:151762281-151762303 CCACATGCTACTCCCCTGGCTGC 0: 1
1: 0
2: 6
3: 38
4: 243
Right 964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG 0: 1
1: 0
2: 1
3: 25
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964000244 Original CRISPR GTCCTCAGTGAGCTAGAGGC TGG Intergenic
900014367 1:138152-138174 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
900014606 1:139296-139318 GTCCACAGTGAGGTAGAAGCTGG + Intergenic
900044232 1:493354-493376 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
900044472 1:494498-494520 GTCCACAGTGAGGTAGATGCTGG + Intergenic
900065640 1:728260-728282 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
900065877 1:729404-729426 GTCCACAGTGAGGTAGATGCTGG + Intergenic
900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG + Intergenic
902167638 1:14585162-14585184 TTCCTCAGAGTTCTAGAGGCTGG - Intergenic
904584080 1:31569466-31569488 GAGCTCAGTGAGCAGGAGGCTGG - Intergenic
906042431 1:42798470-42798492 GCCCACATTGAGCTTGAGGCGGG - Intergenic
906319337 1:44806731-44806753 GACATCACTGAGCAAGAGGCTGG - Intergenic
906573920 1:46870523-46870545 TTCCTCAAAGACCTAGAGGCAGG + Intergenic
907835445 1:58104216-58104238 GTCCACTGTGTGCTAGAGGTTGG - Intronic
908944250 1:69475076-69475098 GTCCTCTGGGAGCTAGGGCCTGG - Intergenic
910120029 1:83777322-83777344 GTCCTCAGTGAACAAAAGGGGGG + Intergenic
910515432 1:88054722-88054744 GTCCTCTGGGAGCTAGGGTCTGG + Intergenic
914957556 1:152177447-152177469 TTCCTCAAAGATCTAGAGGCAGG - Intergenic
919336581 1:196244048-196244070 GTCATCTGGGAGCTAGAGCCTGG - Intronic
920193926 1:204213660-204213682 GCCCACAGGTAGCTAGAGGCTGG - Intronic
920617358 1:207506618-207506640 TTCCTCAGTAAGCTACAGGCAGG + Intronic
920633690 1:207678103-207678125 TTCCTCAGTAAGCTATAGGCAGG + Intronic
921404539 1:214764809-214764831 GTTCTCTGTGAGCCACAGGCAGG + Intergenic
922100545 1:222474303-222474325 GCCCACTGTGAGGTAGAGGCCGG + Intergenic
922100826 1:222475853-222475875 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
922101000 1:222476753-222476775 GTCCACAGTGAGGCAGATGCTGG + Intergenic
922262040 1:223951647-223951669 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
922262100 1:223951891-223951913 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
922733617 1:227967919-227967941 GTCCACAGTGAGGCAGATGCTGG - Intergenic
922733796 1:227968819-227968841 GTCCACTGTGAGGCAGAGGCTGG - Intergenic
922734084 1:227970373-227970395 GCCCACTGTGAGGTAGAGGCCGG - Intergenic
922950534 1:229555214-229555236 GACCTGAGTGAGTTAGGGGCAGG - Intronic
923129815 1:231065525-231065547 TTCTTCAGGGAGCTAGGGGCGGG - Intergenic
924343689 1:243055742-243055764 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
924343746 1:243055970-243055992 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
924343927 1:243056870-243056892 GTCCACAGTGAGGCAGATGCTGG + Intergenic
924711835 1:246535819-246535841 GTTGAAAGTGAGCTAGAGGCCGG - Intergenic
1063087197 10:2830686-2830708 CATCTCAGTGAGATAGAGGCAGG - Intergenic
1065604655 10:27405237-27405259 GTCTTAAATGAGCTAAAGGCAGG + Intronic
1066064677 10:31753431-31753453 GTCCTCACAGTTCTAGAGGCTGG - Intergenic
1066732404 10:38448193-38448215 GTCCACAGTGAGGCAGATGCTGG - Intergenic
1067572463 10:47381471-47381493 TTCCTCAGTGTGCCAGAGCCAGG - Intronic
1069796205 10:71053436-71053458 ATCCTCAGTGGGCTGGGGGCAGG - Intergenic
1073448886 10:103597674-103597696 GCGCTCAGAGAGCAAGAGGCAGG - Exonic
1075870851 10:125772058-125772080 GGCATCAGGGAGCTAGAGGGTGG + Intronic
1076970564 11:129829-129851 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1076970802 11:130973-130995 GTCCACAGTGAGGTAGATGCTGG + Intergenic
1078369938 11:10736056-10736078 TTCCTCTGTGATCTGGAGGCTGG + Intergenic
1080767346 11:35309159-35309181 GTTCTCTGAGGGCTAGAGGCAGG - Intronic
1080970122 11:37264095-37264117 GTCAACAGTGATTTAGAGGCTGG + Intergenic
1082000193 11:47389913-47389935 GTCCTCAGTGAGCGAGCAGGGGG - Intergenic
1082260899 11:50075732-50075754 TTCCACTGTGAGGTAGAGGCTGG + Intergenic
1082774295 11:57234066-57234088 GGCCTTTGTGAGCTAGAGGCTGG - Exonic
1083160379 11:60850624-60850646 TTCCTCAGTGAGCTGGTGACTGG + Exonic
1084198209 11:67538362-67538384 GTCCTCAGAAAGCAAGAGGAGGG - Intergenic
1087676807 11:101172794-101172816 GGCCTCAGAGACCTAGAGGATGG - Intergenic
1090146856 11:124334012-124334034 GTCCTCAGTGAGGAGGAGGCTGG - Intergenic
1091631947 12:2168710-2168732 GTCCTCAGAGAGGTGGAGGTGGG + Intronic
1092387662 12:8048303-8048325 GTGCACAGTGATCTAGAGGAGGG + Intronic
1095929457 12:47611044-47611066 GTACTCAGTGCTCTTGAGGCAGG + Intergenic
1097156532 12:57016114-57016136 TTCCTCAGTCAGCTGGAGGAGGG + Intronic
1098231967 12:68380603-68380625 AGACTCAGAGAGCTAGAGGCTGG + Intergenic
1100099497 12:91086260-91086282 TTCCTCAAAGACCTAGAGGCAGG - Intergenic
1102987727 12:117292032-117292054 GTGCACAGTGACCTTGAGGCAGG + Intronic
1103359123 12:120343079-120343101 GTCCTCAGTCAGCTGCAGGCTGG + Exonic
1104122062 12:125809104-125809126 GTGCACAGTGAGCAAGAGGAAGG + Intergenic
1104323531 12:127774236-127774258 GTGCACAGTGAGCAAGAGGAAGG - Intergenic
1104821264 12:131678923-131678945 GTCCTCAGTGAGGCAGTGCCTGG - Intergenic
1112906096 13:104424442-104424464 GTCATCAGTAAGCAAAAGGCAGG - Intergenic
1114546792 14:23508876-23508898 GGCCTCAGTGAGCAACAAGCAGG + Intronic
1114770297 14:25423080-25423102 TTCCTCAAAGACCTAGAGGCAGG - Intergenic
1115301844 14:31893664-31893686 TTCCTCAGTGAGGAGGAGGCGGG + Intergenic
1115829361 14:37317534-37317556 GTCCACAGTGAGGGAGAGTCTGG - Intronic
1116765909 14:49070438-49070460 GTCATCTGTGAGCTAGGGTCTGG - Intergenic
1116930783 14:50688634-50688656 GTCCTCTAGGAGCTAGAGCCTGG + Intergenic
1119425694 14:74533503-74533525 GTCTGCAGTGAGCTGGAGGAGGG + Intronic
1119814657 14:77555128-77555150 CTCCTCACTGAACTAAAGGCTGG - Intronic
1121243886 14:92449138-92449160 GTCAACAGTGAGCTGGAGGCTGG + Exonic
1121826724 14:97016316-97016338 GACCACAGTGAGCTTGATGCTGG + Intergenic
1122116487 14:99530114-99530136 GTCCACCGTGAGCCAGATGCTGG - Intronic
1122265444 14:100544637-100544659 GCCCTGGGTGAGCCAGAGGCAGG - Intronic
1123449783 15:20352406-20352428 GGCCCCTGTGAGCGAGAGGCGGG - Intergenic
1123914852 15:25013573-25013595 GTTCTTAGGGAGCCAGAGGCAGG + Intergenic
1124696337 15:31867657-31867679 GACTTCAGTGAACTACAGGCTGG - Intronic
1126021361 15:44405261-44405283 GTCCTCAGTGAAGTAGAGAAGGG + Intronic
1128800094 15:70491861-70491883 GTCTTCAGAGAGCAAGTGGCTGG - Intergenic
1129673793 15:77621637-77621659 GTCCTCAGAGAGCTACACCCAGG + Intronic
1131180206 15:90234080-90234102 GTCCTAGGCGAGCTGGAGGCGGG + Exonic
1132834288 16:1944958-1944980 GCCCTGAGTGATCTAGAGCCTGG - Intronic
1138349465 16:56338792-56338814 GTCCCCAGTGAGCATGAGCCTGG + Intronic
1139845686 16:69919598-69919620 GTCCACAGTGAGCTGGAGGTGGG + Intronic
1141790019 16:86228026-86228048 GTCCTCAATCAGCCAGAGGAGGG + Intergenic
1142256826 16:89017811-89017833 GTCCTCACTGTTCTGGAGGCTGG - Intergenic
1142380520 16:89729457-89729479 TCCCTCAGTGAGCGGGAGGCGGG + Intronic
1142449448 16:90166513-90166535 GTCCACAGTGAGGTAGATGCTGG - Intergenic
1142449625 16:90167409-90167431 GTCCACTGTGAGGCAGAGGCTGG - Intergenic
1142449684 16:90167653-90167675 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1142457404 17:64192-64214 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1142457643 17:65336-65358 ATCCACAGTGAGGTAGATGCTGG + Intergenic
1144653435 17:17020962-17020984 GGCCACAGTGAGCCAGAGGTGGG + Intergenic
1144835974 17:18156934-18156956 GTCCTGGGTCAGCCAGAGGCAGG - Exonic
1146053539 17:29569663-29569685 CTCCTCAGGGAGCTGGAGCCTGG - Intronic
1149108474 17:52997450-52997472 GTCATCTGGGAGCTAGAGCCTGG - Intergenic
1149230941 17:54533114-54533136 TTCCTCAAAGACCTAGAGGCAGG - Intergenic
1152785658 17:82246659-82246681 GGCCTCTGTGACCTACAGGCAGG + Intronic
1152789011 17:82268257-82268279 GTGCTCAGCGACCTTGAGGCAGG - Intronic
1153206067 18:2702924-2702946 CTCCTCATTGCCCTAGAGGCAGG + Intronic
1153268650 18:3296862-3296884 GTCCTCTGTGAGGTAGGGTCGGG - Intergenic
1153715094 18:7839479-7839501 GTCATCTGGGAGCTAGAAGCTGG + Intronic
1160246893 18:77166318-77166340 TTTCTCAGTGATCTGGAGGCCGG - Intergenic
1160647755 19:201262-201284 GTCCACAGTGAGGTAGATGCTGG + Intergenic
1162449253 19:10744585-10744607 GGCCCAAGTGAACTAGAGGCAGG - Intronic
1162785815 19:13034059-13034081 GTACTCAGTGACCTAGAAGCCGG - Intronic
1163610962 19:18301342-18301364 GTCCTCTGTGCCCTGGAGGCTGG - Intergenic
1163622673 19:18370073-18370095 GTGCTGAGTGAGCGAGAGGAGGG + Intergenic
1167353978 19:48992358-48992380 GTCCTAAGTTAGTCAGAGGCTGG - Intronic
1167749919 19:51373197-51373219 GTCCTGAGGGAGGAAGAGGCGGG + Intergenic
925269390 2:2591547-2591569 GTCATCTGGGAGCTAGAGCCTGG - Intergenic
927105418 2:19819513-19819535 GTCCTCAGTGAGCTCGAGGGAGG - Intergenic
929525987 2:42703365-42703387 GTCCTAAGTGACCTAGAGATGGG + Intronic
930501986 2:52233089-52233111 TTCCTCAGAGAGCTAAAAGCAGG + Intergenic
932292580 2:70594938-70594960 GTCTTCACTGAGCCAGAAGCGGG - Intergenic
933016366 2:77132502-77132524 TTTCTCAGAGATCTAGAGGCTGG + Intronic
937302314 2:120850759-120850781 GTCATCACTGTGCGAGAGGCAGG + Intronic
938217258 2:129529231-129529253 GTAGTCAGTGAGGTAGGGGCGGG + Intergenic
940749572 2:157611314-157611336 TTCCTCAGTGAGTTAGAGTATGG + Intronic
941071085 2:160955314-160955336 GGCTTCAGTGATCTTGAGGCTGG - Intergenic
943085850 2:183310272-183310294 GGCCTCAGTGAGCTAAGGACTGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
1169934933 20:10873227-10873249 GCCCACAGTAGGCTAGAGGCAGG - Intergenic
1170142673 20:13140931-13140953 GTCCACATTGGGTTAGAGGCAGG - Intronic
1171241331 20:23569294-23569316 TGCCTCAGTGAGATAGAGGTTGG + Intergenic
1171398936 20:24859221-24859243 GTCCTCAGATACCTAAAGGCGGG + Intergenic
1171520763 20:25772667-25772689 GTCCCCAGTCAGCTAGGGCCTGG + Intronic
1171556157 20:26083824-26083846 GTCCCCAGTCAGCTAGGGCCTGG - Intergenic
1175898545 20:62350977-62350999 GTCCTCAGTAAGGTAGGGCCGGG - Intronic
1175946140 20:62559651-62559673 GGCCTCACTGAGCCAGAGGGAGG + Intronic
1176278696 20:64288664-64288686 GTCCACTGTGAGGCAGAGGCTGG - Intergenic
1181012804 22:20052349-20052371 GTCCTCGAGGAGCTTGAGGCAGG + Intronic
1181368817 22:22400074-22400096 GTCCTCACTGAGAGAGGGGCAGG - Intergenic
1183362452 22:37389758-37389780 GTCCTCAGGTAGCTCCAGGCAGG - Intronic
1185302137 22:50087454-50087476 GGCCTCAGTGAGAAGGAGGCAGG + Intergenic
950492923 3:13317068-13317090 GCCCTGGGTGAGCGAGAGGCTGG - Exonic
950572169 3:13808090-13808112 CACATCAGGGAGCTAGAGGCAGG - Intergenic
950660409 3:14463632-14463654 GTCCTCAGGAAGGGAGAGGCAGG + Intronic
952126629 3:30308422-30308444 GTCCTCAGTAACTTAGAGGTGGG - Intergenic
954806160 3:53222158-53222180 CTTCTCACTGTGCTAGAGGCTGG - Intergenic
959581520 3:107987785-107987807 CTCATCTGTGAGCTAGAGGCAGG + Intergenic
959675603 3:109031767-109031789 GTCCTGATTGAATTAGAGGCTGG - Intronic
964000244 3:151762332-151762354 GTCCTCAGTGAGCTAGAGGCTGG + Intergenic
966441959 3:179955154-179955176 GTTCTGAGGAAGCTAGAGGCAGG + Intronic
968370092 3:198218853-198218875 GTCCACAGTGAGGTAGATGCTGG - Intergenic
968529072 4:1080707-1080729 GTCCACAGGTAGCAAGAGGCAGG - Intronic
971825350 4:31614361-31614383 TTGCTCAGTGAGCTGGAGGGAGG + Intergenic
972264446 4:37445512-37445534 GTCATCAGTCAGCTGGGGGCTGG - Exonic
975004973 4:69272590-69272612 GCCCTCAGTGAGAGAGAGACAGG - Intergenic
975866663 4:78730769-78730791 GACCTCAGCGAGCTAGAGTGAGG - Intergenic
979258792 4:118630818-118630840 GTCCACAGTGAGGCAGATGCTGG - Intergenic
979258968 4:118631721-118631743 GTCCACTGTGAGGCAGAGGCTGG - Intergenic
979259248 4:118633273-118633295 GCCCACTGTGAGGTAGAGGCCGG - Intergenic
979259391 4:118633831-118633853 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
979329099 4:119407286-119407308 GCCCACTGTGAGGTAGAGGCCGG + Intergenic
979329385 4:119408840-119408862 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
979329557 4:119409738-119409760 GTCCACAGTGAGGCAGATGCTGG + Intergenic
980687051 4:136242060-136242082 GACCTCTGTGAGATACAGGCAGG - Intergenic
982278053 4:153656974-153656996 GCCCTCAGTGAGCTAGAGATGGG + Intergenic
984655234 4:182310411-182310433 GACGTCAGTGAGCAGGAGGCAGG + Intronic
985552648 5:541346-541368 ATCCTCAGTGACCTGGAGGTCGG - Intergenic
985563241 5:602433-602455 GTCCTCAGGGACCAAGACGCAGG - Intergenic
985640925 5:1063190-1063212 GCCCTCGGTCAGCTATAGGCAGG - Intronic
985757332 5:1726732-1726754 ATCCTCAGCGTGCTGGAGGCTGG - Intergenic
986754557 5:10823667-10823689 GCTCTCTGTGAGCCAGAGGCAGG + Intergenic
988376188 5:30439112-30439134 GTCATCAAGAAGCTAGAGGCTGG - Intergenic
992849781 5:80795369-80795391 TTCCTCAGAGTTCTAGAGGCTGG + Intronic
996110151 5:119555840-119555862 CACCTTAGGGAGCTAGAGGCTGG + Intronic
998702776 5:144723356-144723378 CTCCTCAGTGTGCTACAGGACGG + Intergenic
998760337 5:145425350-145425372 TTCCTCAAAGAGCTAGAGACAGG + Intergenic
999011027 5:148040839-148040861 GTCCTTAGTGTGCTAGATCCTGG + Intronic
1000057756 5:157623042-157623064 TTCCTCAGGGATCTAGAGCCAGG + Intergenic
1001385873 5:171338260-171338282 GTCTTCAGTGAGCTGTAGGTAGG - Intergenic
1001450615 5:171821566-171821588 GTACACAGGGAGCTAGAGACAGG + Intergenic
1001754736 5:174159624-174159646 GGCCTCAGTGACCAAGAGGCTGG + Intronic
1002729371 5:181324431-181324453 GTCCACAGTGAGGTAGATGCTGG - Intergenic
1002729611 5:181325575-181325597 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1002754424 6:146583-146605 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
1002759416 6:190222-190244 GGCCTCAGAGGGCTAGGGGCTGG - Intergenic
1008013511 6:46491885-46491907 TTCCTCAGTTAGCCAGAGTCGGG - Intronic
1009847384 6:69150894-69150916 GTCCTCTGGGAGCTAGGGCCAGG + Intronic
1011459620 6:87589825-87589847 GTCCTCAGTCAGCTGGAGGGTGG - Intronic
1013770546 6:113623251-113623273 TTACTAAGTGAGGTAGAGGCAGG + Intergenic
1014285711 6:119494904-119494926 GGCCTCAGTGAACTAGAAGATGG + Intergenic
1018871107 6:167782951-167782973 GCCCTCAGTGGGCCAGAGGAGGG + Intergenic
1018901919 6:168055956-168055978 GTCTCCAGTGAGCTGGAGGGTGG + Exonic
1019748141 7:2712212-2712234 GTCCTCAGTTACCCAGGGGCGGG - Intronic
1020012744 7:4815535-4815557 GTCCTCAGTGGCCCAGAGCCGGG - Intronic
1022140725 7:27491366-27491388 TTCCTCAGTGAGCTGGTGACTGG - Intergenic
1022680290 7:32538896-32538918 ATCCTCAGAGAGCAAGAGGAGGG + Intronic
1023343115 7:39243394-39243416 TTCCTCAGTCAGCTGGATGCAGG + Intronic
1024073873 7:45808764-45808786 GTCCACTGTGAGGCAGAGGCTGG - Intergenic
1024074157 7:45810319-45810341 GCCCACTGTGAGGTAGAGGCTGG - Intergenic
1024604698 7:51013953-51013975 GCCCTCAGTGAGCTCGGGTCTGG + Intergenic
1024648796 7:51388414-51388436 GTCCTCTGTGAGGCCGAGGCCGG + Intergenic
1024649028 7:51389299-51389321 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1024649171 7:51389879-51389901 GCCCACTGTGAGGTAGAGGCCGG + Intergenic
1024649458 7:51391433-51391455 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
1024649638 7:51392332-51392354 GTCCACAGTGAGGCAGATGCTGG + Intergenic
1025053254 7:55745209-55745231 GCCCACTGTGAGGTAGAGGCCGG + Intergenic
1025053540 7:55746763-55746785 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
1025053718 7:55747662-55747684 GTCCACAGTGAGGCAGATGCTGG + Intergenic
1025131356 7:56375682-56375704 GCCCACTGTGAGGTAGAGGCCGG + Intergenic
1025131641 7:56377237-56377259 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
1025131821 7:56378136-56378158 GTCCACAGTGAGGCAGATGCTGG + Intergenic
1025178321 7:56812883-56812905 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1025179189 7:56816415-56816437 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1025179646 7:56818301-56818323 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1025180096 7:56820139-56820161 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1025180567 7:56822121-56822143 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1025181883 7:56827552-56827574 GTCCGCTGTGAGGCAGAGGCTGG + Intergenic
1025182447 7:56830302-56830324 GTCCACTGTGAGGCAGAGGCTGG + Intergenic
1025281252 7:57627630-57627652 GTCCCCAGTCAGCTAGGGACTGG + Intergenic
1025303477 7:57837877-57837899 GTCCCCAGTCAGCTAGGGACTGG - Intergenic
1025689482 7:63746692-63746714 GTCCACTGTGAGGCAGAGGCTGG - Intergenic
1025690035 7:63749443-63749465 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025690473 7:63751270-63751292 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025691362 7:63754869-63754891 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025691800 7:63756692-63756714 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025692247 7:63758515-63758537 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025692693 7:63760338-63760360 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025693109 7:63762017-63762039 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025693555 7:63763840-63763862 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1025912831 7:65841429-65841451 GTCCGCTGTGAGGTAGAGGCTGG - Intergenic
1026904989 7:74057713-74057735 GTTCTCCGTGAGCCAGTGGCGGG - Intronic
1026942735 7:74297073-74297095 GTCCTCAGTCAGCTTGGGCCTGG + Intronic
1029307053 7:99628003-99628025 GCACTCAGTGAGGCAGAGGCAGG + Intronic
1029576619 7:101407610-101407632 GTCCTCAGTGAGGTAGGAGATGG + Intronic
1030990296 7:116291365-116291387 GTCATCTGGGAGCTAGAGCCTGG - Intronic
1032051095 7:128651567-128651589 GTCCACAGTGAGGCAGATGCTGG - Intergenic
1032051272 7:128652452-128652474 GTCCACTGTGAGGCAGAGGCTGG - Intergenic
1032051332 7:128652696-128652718 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1033283644 7:140022921-140022943 GTCCTCAGGAAGGTGGAGGCTGG + Intergenic
1034200471 7:149280487-149280509 GTCCCCAGGGAGATAGAAGCTGG - Intronic
1034549399 7:151810682-151810704 GTCACCGGTGAGCTAGAGCCTGG - Intronic
1035132707 7:156670308-156670330 CTCCTCAGTGAGCTGAAGGCAGG - Intronic
1035838771 8:2787993-2788015 TTCCTCACTGAGCCAGAGGGAGG + Intergenic
1037305995 8:17504262-17504284 GTGCTTAGTGAGATTGAGGCCGG + Intronic
1038668556 8:29562800-29562822 GCCCTCACTGAACTAGAGCCAGG - Intergenic
1040360871 8:46663076-46663098 TTCCTCAAAGATCTAGAGGCAGG - Intergenic
1042058648 8:64793138-64793160 GACCTTAGTGAGCTAAATGCAGG - Intronic
1042816336 8:72881705-72881727 TCCCTCTCTGAGCTAGAGGCAGG - Intronic
1044827124 8:96209252-96209274 GTCCTCATAGTGCTGGAGGCTGG + Intergenic
1045507563 8:102789304-102789326 GTCCCCAGTGCGGGAGAGGCAGG - Intergenic
1047144316 8:122179845-122179867 TTCCTCACTGTTCTAGAGGCTGG - Intergenic
1048446525 8:134497325-134497347 ATCCTCTGTGAGCCAGAGGAGGG + Intronic
1048498104 8:134952016-134952038 TTTCTCACTGATCTAGAGGCTGG - Intergenic
1049239564 8:141530314-141530336 GTCCTCACTGGGAAAGAGGCAGG - Intergenic
1050802981 9:9638787-9638809 GTCCTCACAGTTCTAGAGGCTGG + Intronic
1051171912 9:14327229-14327251 GGCCTCACTGAGCAAAAGGCAGG - Intronic
1053059475 9:35019346-35019368 TTCCTCAAAGATCTAGAGGCAGG - Intergenic
1054813987 9:69456917-69456939 GGCCCCAGTGAGCTAGAAGGTGG - Intronic
1058101144 9:100918873-100918895 CTCCTCAGTGTCCTAGAGGCAGG + Intergenic
1060150588 9:121285812-121285834 GTCCTCAGAGAGGGAGAAGCAGG + Intronic
1060719045 9:125962030-125962052 ATCCTCAAAGACCTAGAGGCAGG - Intronic
1061495475 9:130971474-130971496 GACCCCAGTGAGCTAGGGGAGGG + Intergenic
1062754032 9:138278123-138278145 GTCCACAGTGAGGTAGATGCTGG - Intergenic
1203577343 Un_KI270745v1:19700-19722 GTCCACAGTGAGGTAGATGCTGG - Intergenic
1203577581 Un_KI270745v1:20844-20866 GTCCGCTGTGAGGCAGAGGCTGG - Intergenic
1185568042 X:1111711-1111733 CTCCTCAATGAGCTGGGGGCGGG - Intergenic
1185826787 X:3258846-3258868 GTCCTCATGGAGATGGAGGCAGG - Intergenic
1188442870 X:30230559-30230581 GACCTCAGTTAACTAGAGGGAGG + Exonic
1188854911 X:35181958-35181980 TTCCTCAAAGACCTAGAGGCAGG - Intergenic
1190220233 X:48508340-48508362 GTTCTCTGTGAACTAGAGGGAGG - Intergenic
1191182653 X:57579587-57579609 TTCCCCAGTGAGCAAGAGCCAGG + Intergenic
1192858542 X:75040184-75040206 GTCATCCGGGAGGTAGAGGCTGG + Intergenic
1198575366 X:138004742-138004764 TTCCTCAGTGAGGCAGAAGCTGG - Intergenic
1199239105 X:145526107-145526129 GTCATCAGGGAGCTAGGGCCTGG - Intergenic
1200232730 X:154452253-154452275 GTCAAAAGTGAGCTGGAGGCCGG + Intergenic
1202246912 Y:22829469-22829491 GTCATCAGTGAGCTATAACCAGG - Intergenic
1202399901 Y:24463217-24463239 GTCATCAGTGAGCTATAACCAGG - Intergenic
1202470879 Y:25206869-25206891 GTCATCAGTGAGCTATAACCAGG + Intergenic