ID: 964004665

View in Genome Browser
Species Human (GRCh38)
Location 3:151812835-151812857
Sequence AAGAGTGTGAAATGCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 299}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964004665_964004668 8 Left 964004665 3:151812835-151812857 CCATCCTGGCATTTCACACTCTT 0: 1
1: 0
2: 0
3: 22
4: 299
Right 964004668 3:151812866-151812888 GCATCACAGAAAACCTTTCATGG 0: 1
1: 1
2: 1
3: 21
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964004665 Original CRISPR AAGAGTGTGAAATGCCAGGA TGG (reversed) Intergenic
900121052 1:1048903-1048925 GAGAGTGGGGAAGGCCAGGAAGG - Exonic
901015013 1:6224074-6224096 AACAGTTTGAAATGACATGAGGG + Exonic
901024685 1:6272911-6272933 CAGAGTGAGCACTGCCAGGAGGG - Intronic
901641777 1:10696248-10696270 AGGAGTGGGGACTGCCAGGAAGG - Intronic
901719499 1:11185112-11185134 GACAGTGTGACATGCTAGGATGG - Intronic
901779329 1:11582861-11582883 CAGACTGTGAAATATCAGGAAGG + Intergenic
902326743 1:15705759-15705781 CAGACTGTGAAAGGCCAGGGTGG - Intronic
904503567 1:30932675-30932697 AACAGTGTTAAATGCCAGTTTGG + Intronic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906178131 1:43793780-43793802 AAGAGAGTGAAAAGGCAGGCTGG + Intronic
907879230 1:58529561-58529583 AACAGAGTGAAAAGCAAGGAAGG + Intronic
909712073 1:78663033-78663055 AAAAGAGGGAAATGCAAGGAGGG - Intronic
909925378 1:81431927-81431949 AACAGAATGAAATGCCGGGAGGG + Intronic
910662501 1:89688810-89688832 AAGAGTGATAAATGCCTGGTAGG + Intronic
910831537 1:91466496-91466518 AGGATTGTGTAATGCCAGGTTGG + Intergenic
911070306 1:93826982-93827004 GAGATTGTGGAATACCAGGAAGG + Intronic
911198868 1:95023791-95023813 AAGAGTCTGAAAAACCAGGAGGG - Intronic
911351030 1:96755820-96755842 AAGAGTGGGAAAGGACAGGCAGG + Intronic
914433372 1:147639685-147639707 TAGAGTGTGAAATAACAGCAAGG - Intronic
914853781 1:151335069-151335091 AAGAGTGAGGAATGGTAGGAAGG + Intergenic
916593322 1:166215411-166215433 AAGAGTCTGAAATGGCAAAAAGG - Intergenic
918200571 1:182262479-182262501 AAGTATGTGAAATGCCTGGATGG + Intergenic
919131056 1:193451107-193451129 AAATGTATGAAATGCCAGAAGGG + Intergenic
920419259 1:205819628-205819650 AACAGAGTGAAATGGCAGGAAGG + Intergenic
920743608 1:208604738-208604760 AACAGAGTGAAATGTCTGGAAGG - Intergenic
922089180 1:222379371-222379393 ATGAGAGTAAAATGTCAGGAAGG + Intergenic
922997177 1:229973364-229973386 CTTAGTGTGAACTGCCAGGAAGG - Intergenic
923219389 1:231879583-231879605 AAGACAGGGAAAGGCCAGGATGG + Intronic
924136859 1:240976265-240976287 AAGAGTGTCAATAGCTAGGAAGG + Intronic
1066121551 10:32293505-32293527 AAGAGTGTGAGATTGCAGGTTGG - Intronic
1068624107 10:59221818-59221840 CAGAGTCTGAAGTTCCAGGATGG + Intronic
1069456664 10:68559595-68559617 AATGGTGTGAAATGCAATGAGGG + Intergenic
1071613653 10:87055128-87055150 CAGGGTGTGAACTGCCAGCAGGG + Intronic
1073878826 10:107955965-107955987 CAGAGTGTGTGAAGCCAGGAGGG + Intergenic
1074144684 10:110706632-110706654 AAGGGTGGGAAATTTCAGGACGG + Intronic
1076418268 10:130307978-130308000 AAAAGCCTGAAATTCCAGGAGGG - Intergenic
1077316094 11:1920009-1920031 CAGAGTGTGGGAGGCCAGGAGGG + Intronic
1078357287 11:10641974-10641996 AAGAGTGTCAGAGGCCAGCAGGG - Intronic
1079273595 11:19012686-19012708 AGGAATGTGAAATGCTAGGCTGG - Intergenic
1080212582 11:29804105-29804127 AAGAGTAGAAAATGCCAGGGAGG + Intergenic
1083740175 11:64705754-64705776 AGGAGAGGGGAATGCCAGGAAGG - Intronic
1085659971 11:78355033-78355055 AAGATTGTGAAATGTCATAAAGG - Intronic
1085715525 11:78869757-78869779 ACCAGTGTGATGTGCCAGGAGGG - Intronic
1089665432 11:120014898-120014920 AATAGTGTGAAAGCCTAGGAAGG - Intergenic
1090124099 11:124067776-124067798 AAGTGTGTGAATAGCCAGCATGG - Intergenic
1092995411 12:13945286-13945308 AAGAGTGAGAAGTGGCAGGGTGG + Intronic
1093721920 12:22453333-22453355 AATAGTATGAAATGCCATAAAGG - Intronic
1094321020 12:29183235-29183257 AAAAGAGTGAATTGTCAGGATGG - Intronic
1095375533 12:41523695-41523717 AATAGTGTGAAATTCCAGTATGG + Intronic
1095601869 12:44022693-44022715 AAAAGTGTGAAATATTAGGAAGG + Intronic
1095879999 12:47124171-47124193 ATGAGGGTGAAAAGCAAGGAGGG - Intronic
1095928444 12:47603009-47603031 AAGAAAGTGAAATGCAATGAGGG + Intergenic
1095944995 12:47748762-47748784 AAGATTGGGAAATGAAAGGAGGG + Intronic
1097138864 12:56882517-56882539 AGGATTGGGAAATTCCAGGATGG - Intergenic
1098302385 12:69067405-69067427 GTGAGTGTAAAATGCAAGGACGG + Intergenic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1098917962 12:76276665-76276687 AAGCGTGTGTAATGCCATGCCGG - Intergenic
1099229772 12:80009803-80009825 AAGAGTGTAAGATGCTGGGAGGG - Intergenic
1099638191 12:85244030-85244052 AATAGGGGGAAATGCCATGAGGG - Intronic
1101254388 12:102963436-102963458 GATAGTGGTAAATGCCAGGAAGG - Intergenic
1101949622 12:109164531-109164553 CTGTGTGTGAAATGCTAGGAAGG - Intronic
1102689918 12:114752250-114752272 ATGAGGGTGAAAGGTCAGGAGGG - Intergenic
1104028937 12:125050020-125050042 AAGAGTCTGAATTTGCAGGAGGG - Intergenic
1105330887 13:19414126-19414148 GAGAGTGTGGCATGCCACGATGG + Intergenic
1105949114 13:25213746-25213768 AAGAGAGGGAGAGGCCAGGAAGG - Intergenic
1106041698 13:26099795-26099817 AAGAGTGAGAAATGACACCAGGG + Intergenic
1106386651 13:29291906-29291928 ATGATTTTGAAATGCAAGGAGGG - Intronic
1107064178 13:36195139-36195161 AAATGTGTCCAATGCCAGGAAGG + Intronic
1109732033 13:66424992-66425014 AAAATTATGACATGCCAGGATGG + Intronic
1111884618 13:94004687-94004709 CACAGTGTAAAATGCCAGGAAGG + Intronic
1112567824 13:100566389-100566411 AAGAGTGTGAAGGGCCTGAAAGG - Intronic
1113360242 13:109623782-109623804 AAGAGAGAGAAATGCAAAGATGG - Intergenic
1113569393 13:111343175-111343197 CAGAGGGTGAAATGACAGGGAGG - Intronic
1114223000 14:20713799-20713821 CAGAGTATATAATGCCAGGAAGG - Intergenic
1114727428 14:24953959-24953981 AAGAGGGAGAACTCCCAGGATGG + Intronic
1117559579 14:56923063-56923085 ACCAGTGTGCAATGCCAGGCTGG + Intergenic
1118037876 14:61887980-61888002 AAGCATGTGAAAAGCCAAGACGG - Intergenic
1118179054 14:63472779-63472801 AAGAGTGGGAAATGAGAGGGAGG + Intronic
1119344345 14:73910153-73910175 AAGGGCCTAAAATGCCAGGAAGG + Intronic
1119687759 14:76646077-76646099 AAGCCTCTGAAATGCCAGGTTGG + Intergenic
1120201015 14:81538310-81538332 AGGAGTGGGAAATTCCAGCATGG - Intergenic
1120254187 14:82097198-82097220 AAGACTGAGAAAGCCCAGGATGG - Intergenic
1120398077 14:83993487-83993509 AACAGTGTGAAAAGCAAAGAAGG + Intergenic
1120537496 14:85715012-85715034 AAGAGTGAGAAATGGCAAGAAGG + Intergenic
1120703272 14:87722106-87722128 AAGAGGGAGATATACCAGGAAGG - Intergenic
1121110083 14:91306810-91306832 AAGAGGCTGAATTGCCATGAAGG + Intronic
1121452924 14:94020847-94020869 AACTGTGAGAAATGCTAGGATGG + Intergenic
1121558988 14:94860533-94860555 CAGAATGTGAAATGGGAGGATGG - Intergenic
1121944838 14:98109878-98109900 AAGAGTGTGAGAATACAGGAAGG + Intergenic
1124857630 15:33406112-33406134 AAGAGTGTCTAATGGCAGTAGGG + Intronic
1126893915 15:53237508-53237530 AAGAGTGTGAGATACCAGCCAGG - Intergenic
1126989224 15:54353236-54353258 AATAGTGTCAGATGCCAGGCAGG + Intronic
1127623537 15:60757839-60757861 GAGAGTGTGAAAAGGAAGGAGGG - Intronic
1127831395 15:62754537-62754559 AACAGTGTGTACTGCAAGGAAGG + Intronic
1127904756 15:63368380-63368402 AAGAGAGTAACAGGCCAGGAAGG + Intronic
1128037322 15:64538322-64538344 AAAAGCTTAAAATGCCAGGATGG - Intronic
1128284971 15:66429279-66429301 AAGAGAGAGAAGTGCCAGTAGGG + Intronic
1131142940 15:89992449-89992471 AGGAGTCTGATATGGCAGGATGG + Intergenic
1131843964 15:96469177-96469199 AAGAGGGTGGAATGCATGGAAGG + Intergenic
1132097073 15:98994670-98994692 GACAGTGTGAAATGCAAGGAGGG - Intronic
1132207549 15:99996975-99996997 ACGAGAGTCAGATGCCAGGAGGG - Intronic
1134073899 16:11277261-11277283 AAGAGTGAGGAATGCAAGGGTGG - Intronic
1134199855 16:12188968-12188990 ATGATTGTGATATGGCAGGAGGG + Intronic
1134595401 16:15491862-15491884 AAGAGAGTAAAATGCCATTACGG - Intronic
1134830990 16:17322757-17322779 TAAAGTGTGAAATGCTATGAAGG - Intronic
1136544585 16:30948244-30948266 AAGAGTGGGAAGAGCCAGGCTGG - Exonic
1137996496 16:53220523-53220545 AAGGAAGTGAAATGCAAGGAAGG - Intronic
1138392648 16:56681918-56681940 AAGAGTGGAGAATGCAAGGACGG + Intronic
1138542859 16:57699008-57699030 ACGAGTGTGAAGTGCCCGTAAGG + Exonic
1139861271 16:70023548-70023570 AAAACTGTGAAGAGCCAGGAGGG + Intergenic
1140396506 16:74631780-74631802 AAGTTTGTGGAATGACAGGATGG - Intronic
1140654845 16:77129807-77129829 AAGACTGTAATATGGCAGGAAGG - Intergenic
1141073967 16:80985657-80985679 AAGTGTGAGAACTGCCACGAAGG + Intronic
1141816670 16:86415079-86415101 AACTGGGTGAAATGCCATGAAGG - Intergenic
1142534480 17:604985-605007 AACAGTGAGAAGGGCCAGGAAGG + Intronic
1143825779 17:9605856-9605878 GAGAGTATGCAATGCCAAGAGGG + Intronic
1144098610 17:11924032-11924054 AAGAGTGTGAAAGGACAGATGGG - Intronic
1146526518 17:33571597-33571619 AAATGTGTGAAATGCTATGAAGG + Intronic
1147157345 17:38550944-38550966 GACAGTGGGAAATGCCGGGATGG + Intronic
1147529596 17:41263197-41263219 AAGAGAGTGAAAAGGAAGGAAGG + Intergenic
1147873654 17:43605437-43605459 ATGAGTGAGAAATGGCAGGGAGG + Intergenic
1149288809 17:55195681-55195703 AACACTTTGAAAGGCCAGGATGG - Intergenic
1149839389 17:59945511-59945533 AAGAGTGTGAAATACCTGACAGG - Exonic
1152005331 17:77676851-77676873 AAGAGTGAGAAATTCCAGCCAGG + Intergenic
1152732683 17:81980341-81980363 CAGGGTGGGCAATGCCAGGAGGG - Intronic
1156850706 18:41722630-41722652 AAGAGTATGAAAGGTCAGAATGG + Intergenic
1156932086 18:42657777-42657799 AAGAGTGTGAAAGGAGAGGGTGG + Intergenic
1157574371 18:48733767-48733789 CTGAGTGTGAAGAGCCAGGAGGG - Intronic
1158519464 18:58159165-58159187 AAGAGTTGGAAGTGACAGGAAGG + Intronic
1160760869 19:783557-783579 AACAGAGCGAAATTCCAGGAAGG - Intergenic
1161272168 19:3396002-3396024 AAGAGCCTGAAATCCCAGCATGG - Intronic
1161471034 19:4456963-4456985 AAGAGTCTGGAAGGCCAGGGAGG - Intronic
1163505226 19:17701813-17701835 GTGAGTGTGAAATGCCTGCAAGG + Intergenic
1166391938 19:42413226-42413248 TAAAGTGTCAAATGGCAGGATGG - Intronic
1166982270 19:46638408-46638430 ATGAGTGTGTACTGCCATGATGG - Intergenic
1167060998 19:47146275-47146297 AAGAGTTTCAAATGACAGGAAGG + Intronic
925837756 2:7962537-7962559 AAGAGTGTAAGCTGCCAGAAGGG - Intergenic
926111267 2:10185707-10185729 AGGAGTTTGAAAGGCAAGGAAGG - Intronic
927019417 2:19001263-19001285 AAGAGGGTGAAATGAGATGAAGG - Intergenic
927210153 2:20634236-20634258 AAGTGTTGGAAATGCCAGAAAGG - Intronic
927339203 2:21962079-21962101 AAAAGCCTGAAATGCCAGGTTGG - Intergenic
928148060 2:28799379-28799401 AAGGGTGTCAAATGGCTGGATGG - Exonic
929601575 2:43207826-43207848 ATGAGTGTGCAGTGGCAGGAGGG + Intergenic
931020276 2:58037038-58037060 ATGAGTCTGAAATGGGAGGATGG - Intronic
931308258 2:61053608-61053630 TAGAGTATGAAATTGCAGGAGGG - Intergenic
932365690 2:71151775-71151797 ACCAGTGTGCAATGCCAGGCTGG - Intergenic
938287632 2:130130457-130130479 AAGACTGTGAAAAGACAGTAGGG + Intergenic
938427961 2:131208402-131208424 AAGACTGTGAAAAGACAGTAGGG - Intronic
941227087 2:162864190-162864212 AAGAGTGAGAAGTGCCATCAGGG + Intergenic
942242807 2:173979073-173979095 AGGAGCGTGAAATGGGAGGATGG - Intergenic
943793990 2:191968709-191968731 TACACTGTGAGATGCCAGGAGGG + Intronic
944544331 2:200784246-200784268 GAGGGAGAGAAATGCCAGGATGG - Intergenic
945289558 2:208113591-208113613 AAGAGAGTGGAACACCAGGAGGG - Intergenic
946456641 2:219832014-219832036 CAGAGTGTGAAGGGGCAGGAAGG + Intergenic
947139900 2:227011050-227011072 AAGAGAGGGAAATGGAAGGAAGG + Intronic
948309236 2:236972627-236972649 GAGAGTGAGAAAAGCCAGGTCGG - Intergenic
1168939449 20:1696354-1696376 GAGAGTATCTAATGCCAGGATGG + Intergenic
1169314880 20:4582202-4582224 AAGACTGAGACATGACAGGAGGG - Intergenic
1171101924 20:22392369-22392391 TAGAGTGTGAAATTTCAGAAAGG + Intergenic
1172622879 20:36331272-36331294 AAGAGTGTGAGAGGCCAGGTGGG + Intronic
1172741132 20:37168478-37168500 AAGAGTGGGGAAAGCCAGGATGG - Intronic
1173257886 20:41407822-41407844 AAGAGTGCGAGACGCCACGAAGG + Intronic
1174739840 20:53001748-53001770 AAGTGTGTGACATTTCAGGAAGG + Intronic
1177396273 21:20539337-20539359 AAGAGAGAAAAGTGCCAGGATGG - Intergenic
1179721726 21:43320180-43320202 TAGAGAGTGAAATGGCAGAAAGG + Intergenic
1183004963 22:34893656-34893678 CAGAGTGTGCACAGCCAGGAAGG + Intergenic
1184933865 22:47704288-47704310 AAGAATGTGAAAAGCCGGCAGGG - Intergenic
949526200 3:4906855-4906877 AAGAGACTGAAATGGGAGGATGG - Intergenic
950448560 3:13052693-13052715 GACAACGTGAAATGCCAGGAGGG - Intronic
950839265 3:15951098-15951120 AAGAGACTGAAATGGGAGGATGG - Intergenic
951491764 3:23278525-23278547 AGGAGTTTTAAATGCCAGCAAGG + Intronic
952442112 3:33341470-33341492 AAGAGTATAAAGTGGCAGGATGG + Intronic
952894541 3:38069120-38069142 GGGAGTGGGAAATGGCAGGATGG + Intronic
953452514 3:43016425-43016447 AGCAGTGTGACATGACAGGAAGG + Intronic
953951363 3:47192919-47192941 AAGTGTGTGAAATGCATGGGGGG - Intergenic
955134387 3:56201434-56201456 AGGAGTGTGAAAAGTCAGCAAGG + Intronic
955787898 3:62559144-62559166 AAGTGTGTCAAATGCAAGGAAGG - Intronic
956484469 3:69707621-69707643 AAGAATATAAAATGGCAGGAGGG + Intergenic
957975667 3:87440952-87440974 AAGAGTGAGAAATCCCTGAAAGG - Intergenic
959665090 3:108911696-108911718 AATATTGTGAAAAGCCACGAGGG - Intronic
960084026 3:113571566-113571588 TAGAGTGTGAAATTGCAGGCAGG + Intronic
961097502 3:124170207-124170229 AAGTTTGTGAGATGCCAGGAAGG - Intronic
961344751 3:126256699-126256721 AAAGGTGGGAGATGCCAGGAAGG - Intergenic
962826206 3:139102591-139102613 AAGAGTGTGCAAGGTCAGGAGGG + Intronic
963549840 3:146705435-146705457 TAGATTGTGAAATGCTAAGACGG + Intergenic
964004665 3:151812835-151812857 AAGAGTGTGAAATGCCAGGATGG - Intergenic
965079564 3:164019863-164019885 AAGAGGGTGAAACCGCAGGATGG + Intergenic
967057674 3:185843900-185843922 AAGAGTTAGAAATGCCAGATGGG + Intergenic
967106699 3:186260311-186260333 AAGGGAGTAAAATGGCAGGAAGG + Intronic
967501003 3:190197422-190197444 CAGAGTCTGAAAGGCCAGGGTGG + Intergenic
968497155 4:925098-925120 ATGAATGTGCAATGCCAGAAGGG + Intronic
969511671 4:7621265-7621287 AGGGGTGTGAGATGCCGGGAGGG - Intronic
970392850 4:15633358-15633380 ACCAGTGTGAAATGACAGCAGGG - Intronic
972648456 4:40992630-40992652 AGGTGTGTGAAATGACTGGATGG + Intronic
973630297 4:52813952-52813974 AAGAGTGTTAAAGTCAAGGAAGG + Intergenic
974829014 4:67167568-67167590 AAGACATTGATATGCCAGGAGGG - Intergenic
975557641 4:75680612-75680634 GAGAGTGGGAAATGGAAGGATGG - Intronic
975601348 4:76103223-76103245 AACATTGTGAAAAGCCAGCACGG + Intronic
977100447 4:92805955-92805977 ATGATTGTGTAGTGCCAGGAAGG - Intronic
977423239 4:96830538-96830560 AAGAGAGAGAAATGGCAGGAAGG - Intergenic
980117028 4:128689136-128689158 AAGAATGTAAAATGCAATGATGG - Intergenic
981529168 4:145735240-145735262 AAGATTGTCAGATGCCAGTAGGG + Intronic
981886717 4:149683842-149683864 ACAAATGTGAAATGCCAGGAGGG + Intergenic
982358721 4:154495703-154495725 AGGAGGCTGAGATGCCAGGATGG + Intergenic
983946544 4:173592095-173592117 AAGAGAGTGAAATTATAGGAAGG - Intergenic
984161642 4:176259930-176259952 AACTATGTGAAATGTCAGGAAGG - Intronic
984568015 4:181354664-181354686 AAGATTTTGAAAAGCCAGGCTGG - Intergenic
984946552 4:184973159-184973181 AAGATGGTGAAATACCAAGAAGG - Intergenic
985128702 4:186720811-186720833 AAGAGTGAGAAATGTGAGGCAGG + Intronic
987768835 5:22272956-22272978 AAGAGAGAGAAGTGCCAGCAAGG + Intronic
990291004 5:54351630-54351652 AAGGGAGTCAAATGCCAAGATGG - Intergenic
991002390 5:61795331-61795353 GAGAGTGTGATGTGCCAGGCAGG + Intergenic
993490728 5:88544356-88544378 AAGAGTCTGAAGTGAAAGGAGGG - Intergenic
996155231 5:120090989-120091011 AAGTGTGACAAATGCCAGGAAGG + Intergenic
996734695 5:126747897-126747919 AAAAGTGGTAAATGGCAGGAAGG + Intergenic
997580823 5:135015797-135015819 AACAGTGGGAAATGCTAAGAGGG + Intergenic
997952589 5:138253791-138253813 AGGAGTGTGAAATGCTGGAAGGG - Exonic
998783130 5:145680640-145680662 AAGAGAGAGAATTGCCAAGAGGG + Intronic
999293322 5:150441820-150441842 AAGACTGGGAAACGCTAGGAAGG + Intergenic
1000037354 5:157459741-157459763 AGGAGGGTGAAATGGAAGGAAGG + Intronic
1000400980 5:160826860-160826882 AGGATTGGGAAATGCCAGCATGG + Intronic
1000922239 5:167151948-167151970 TAGTGTGTGCAATGCCTGGATGG - Intergenic
1001085294 5:168696152-168696174 AAGACTGTGATATGCCAAGAGGG - Intronic
1001135413 5:169098670-169098692 AAATGTGTCAAATGACAGGAGGG + Intronic
1002174004 5:177391232-177391254 CAGAGAGTGAACTGCCGGGAGGG - Intronic
1002561481 5:180085008-180085030 AAGACTGTGAAAGGCCACGCAGG - Intergenic
1003333000 6:5145118-5145140 GTGTGTGTGAAATGCCAGGTTGG - Intronic
1003499709 6:6694433-6694455 AAGAGTGTGGAGTGACAGGAAGG + Intergenic
1003743256 6:8967733-8967755 AAGAATGGGAAATCCCAGAAGGG - Intergenic
1004022721 6:11789434-11789456 AAGAGGGTGAAACGGCAGGACGG - Intronic
1004619562 6:17321115-17321137 AAGAGGGTGAAACAGCAGGACGG + Intergenic
1005891865 6:30146921-30146943 GAGACTGTGAAGGGCCAGGAGGG + Intronic
1006012257 6:31053052-31053074 AGGAGTGTGAAATTGCAGGTGGG - Intergenic
1007249062 6:40483332-40483354 AATAGTGGGAAAGTCCAGGAAGG - Intronic
1008546596 6:52589004-52589026 CAGAGTGTAGAAGGCCAGGAAGG - Intergenic
1008629929 6:53353883-53353905 CAGAGTGTGAAAGGCAGGGAGGG - Intergenic
1009033635 6:58090636-58090658 ACCAGTGTGAAATGGCAGGCTGG - Intergenic
1009209248 6:60842345-60842367 ACCAGTGTGAAATGGCAGGCTGG - Intergenic
1009603064 6:65827936-65827958 GAGAGTGTGATGTGGCAGGATGG + Intergenic
1010437520 6:75851215-75851237 AAGAGTATGAAATGCCCAAAAGG + Intronic
1011517778 6:88170726-88170748 AAGGCTGAGAAATGGCAGGAAGG + Intergenic
1012147605 6:95705168-95705190 AAGAATGGTAAAGGCCAGGAAGG + Intergenic
1013776622 6:113685821-113685843 AAGATTGCTAAATACCAGGATGG - Intergenic
1014039266 6:116805916-116805938 AAGACAGTGAAAAGCAAGGAAGG + Intronic
1014768764 6:125437405-125437427 GTGAGTGAGAAATGCCAGGAGGG + Intergenic
1015139141 6:129910068-129910090 AAGACAGAGCAATGCCAGGAGGG - Intergenic
1016845431 6:148564143-148564165 CAGAGTGGGGAATGGCAGGAGGG + Intergenic
1017014415 6:150088715-150088737 AAGAGGGGGAAGTGTCAGGATGG + Intergenic
1017359442 6:153549387-153549409 CAGGGAGTGAAATGGCAGGATGG - Intergenic
1017436090 6:154417203-154417225 AAGGGTGAGAAAGGCCAGCAAGG - Intronic
1017740057 6:157398379-157398401 AAGAGTCTCTAATGCCAGGTGGG + Intronic
1017778364 6:157697163-157697185 AAGGGTATGGAGTGCCAGGAAGG - Intergenic
1019257958 7:63626-63648 AGGGCTCTGAAATGCCAGGAGGG + Intergenic
1019309688 7:353956-353978 CAGGGAGTGAGATGCCAGGAGGG + Intergenic
1019972159 7:4549869-4549891 AAGCCTGTGAACTGCCTGGAAGG - Intergenic
1020687658 7:11315616-11315638 AAGACTTTTAAATGCCAGGCTGG + Intergenic
1023209101 7:37783955-37783977 AAGACTATAAAATGCCAGGTGGG + Intronic
1023258994 7:38340045-38340067 AAGAGAGAGAAAAGCAAGGAAGG + Intergenic
1023259915 7:38348648-38348670 AAGAGAGAGAAAAGCAAGGAAGG + Intergenic
1023260898 7:38357807-38357829 AAGAGAGAGAAAAGCAAGGAAGG + Intergenic
1023547439 7:41333292-41333314 AAAAGAGTCAAAGGCCAGGAAGG + Intergenic
1025950587 7:66142258-66142280 GAGAGGCTGAAATTCCAGGAGGG - Intronic
1026031848 7:66801113-66801135 AAGAGTGTGCCACCCCAGGAAGG + Intronic
1026273274 7:68854806-68854828 AGGAGTCTGAGATGCCATGATGG - Intergenic
1026835950 7:73639193-73639215 AAGAAACAGAAATGCCAGGAGGG + Intergenic
1028843089 7:95450008-95450030 AAGACTTTGAAAGGCCAAGATGG - Intergenic
1029335681 7:99897387-99897409 GAGAGTGTAAAATCCCAGGGAGG - Intronic
1029963550 7:104713793-104713815 TAGATTTTTAAATGCCAGGAAGG + Intronic
1030161708 7:106516150-106516172 AAGAGTGTGAGGTGTGAGGATGG - Intergenic
1030175841 7:106652249-106652271 AGGACTGTGAAATCCCAAGATGG - Intergenic
1031873495 7:127112249-127112271 AAGGATGAGAAAGGCCAGGAAGG - Intronic
1032866442 7:135929981-135930003 AAGACTGTGAAAGGCCCAGATGG - Exonic
1033289871 7:140074544-140074566 AAGAGTGGGAGAAGCCAGGGAGG + Intergenic
1034514048 7:151559907-151559929 GAGTGTGTGAAATGAGAGGAAGG + Intronic
1035658740 8:1331047-1331069 AAGAGACTGCAATGCCAGGGAGG + Intergenic
1037466335 8:19164279-19164301 AAAAGCATGACATGCCAGGAAGG + Intergenic
1037608609 8:20458074-20458096 ATAAGTGTAAAATGCCATGAGGG + Intergenic
1037616853 8:20526926-20526948 AATAGTTTCAAATGCCAAGATGG - Intergenic
1040563221 8:48542982-48543004 AAGAGCCTGAGATCCCAGGAAGG + Intergenic
1040594594 8:48825186-48825208 AAGAGTGGTAAATCCAAGGAAGG - Intergenic
1041128803 8:54673895-54673917 AAGATTGTGATAGGCCATGATGG + Intergenic
1042020514 8:64369103-64369125 AACAGCTTTAAATGCCAGGAGGG - Intergenic
1042171994 8:66000502-66000524 AAGAGTCTGAAAGTCCAGAATGG + Intergenic
1042304980 8:67321980-67322002 TGGAGTGTGGAATGCAAGGAAGG - Intronic
1043365238 8:79525286-79525308 CAGAGTGTGAAATTGCATGAAGG - Intergenic
1043492627 8:80764370-80764392 AAGAGAGAGAAGTGCCAGCAGGG + Intronic
1045597804 8:103676244-103676266 TAGACTGTTAAATGCCAGAAAGG + Intronic
1045833598 8:106493651-106493673 AAGATAGTGAAATCTCAGGAAGG - Intronic
1046784356 8:118250471-118250493 TAAAGTATAAAATGCCAGGAAGG + Intronic
1047226465 8:122959232-122959254 AAAATTGTGAAATGTCAGAAAGG + Intronic
1047228944 8:122979683-122979705 AAGGGTGGTAAATGGCAGGAGGG - Intergenic
1047945489 8:129874016-129874038 AAAAGGGTGAAATACTAGGAAGG + Intronic
1048267355 8:132999204-132999226 CAGAGTGAGAAAGGCCAAGATGG + Intronic
1049849653 8:144823970-144823992 AGGAGTGGGCACTGCCAGGAGGG - Intergenic
1050352549 9:4754193-4754215 AAGAGGGTGAAGTGGGAGGATGG + Intergenic
1050646918 9:7730120-7730142 AAGAGAATGAAATTCCAGGGTGG - Intergenic
1052007983 9:23373577-23373599 AATAGTGTGAAATTCAAGCAAGG + Intergenic
1056409851 9:86314236-86314258 AACAGTGTCAAATTCCAGAATGG - Intronic
1056858438 9:90156855-90156877 AAGAGTCAAAAATGCCATGAAGG + Intergenic
1057626650 9:96684137-96684159 AAAAGTGTTAAGTGCCAAGAAGG + Intergenic
1058748591 9:108016623-108016645 GAGAGTGTGGAAGGCCAGGCTGG + Intergenic
1058791507 9:108450530-108450552 AAGAGTGAGAAATACAAAGATGG + Intergenic
1059937601 9:119326964-119326986 AAGCATGTGAAATGGCATGAAGG + Intronic
1060240796 9:121901069-121901091 AAGAGGTTGAAATACCAGGCAGG - Intronic
1061039737 9:128133073-128133095 GAGAGTGTGACATGGCAGTAGGG - Intergenic
1061718636 9:132537593-132537615 AAGGGTGTGGAAGGCCTGGAGGG - Exonic
1187178534 X:16919486-16919508 CAGAGTCTGACATGCAAGGAGGG - Intergenic
1187233837 X:17447957-17447979 AAGACTCTGAAATCCCAGGATGG - Intronic
1188038517 X:25344859-25344881 AAGAGTGTATAATGGCAGCAAGG + Intergenic
1188414315 X:29914030-29914052 AAGACAGTGAAATTCAAGGAAGG - Intronic
1188522555 X:31055027-31055049 AAGAATGAAAAAAGCCAGGAAGG - Intergenic
1189268138 X:39731762-39731784 AAGAGGGAGAAAAGTCAGGAGGG - Intergenic
1189641381 X:43075644-43075666 AAGTATTTGAAGTGCCAGGAGGG + Intergenic
1195251302 X:103050909-103050931 AAGAGTTGGAAATTCCAGGTGGG - Intergenic
1195695470 X:107663714-107663736 TAGAGTCTGAAGGGCCAGGAAGG + Intergenic
1196008709 X:110863597-110863619 AAGAGTGTCCAAAGTCAGGATGG + Intergenic
1196262153 X:113595900-113595922 AAGATTGGGGAATTCCAGGATGG - Intergenic
1199060689 X:143351910-143351932 AGGAGTGAGAAGTGCCAGCAGGG + Intergenic
1199476603 X:148253579-148253601 AAGAGAGAGAAGTGCCAGCAGGG - Intergenic
1199726781 X:150591294-150591316 AATACTGTGAAATGTCATGATGG - Intronic
1200897186 Y:8388210-8388232 AACAGTGTCAATTGCCAGCACGG + Intergenic
1201890750 Y:18941226-18941248 AAGAGTCTGAAATGGGAGGATGG - Intergenic