ID: 964004889

View in Genome Browser
Species Human (GRCh38)
Location 3:151815073-151815095
Sequence CACAGTTGACATTCTAGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 1, 2: 10, 3: 21, 4: 254}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964004884_964004889 7 Left 964004884 3:151815043-151815065 CCTATTAGGCAAACAAGTAGTCT 0: 1
1: 0
2: 1
3: 12
4: 117
Right 964004889 3:151815073-151815095 CACAGTTGACATTCTAGTGGTGG 0: 1
1: 1
2: 10
3: 21
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964004889 Original CRISPR CACAGTTGACATTCTAGTGG TGG Intronic
900312476 1:2040804-2040826 CACAGCTGACATTGTCGTGGAGG - Intergenic
901615728 1:10538083-10538105 CAGAGCTTAAATTCTAGTGGAGG + Intronic
902542532 1:17165130-17165152 CACAGTCGACAGTCTTCTGGTGG + Intergenic
902801572 1:18833251-18833273 AGCAGCTCACATTCTAGTGGAGG - Intergenic
902969980 1:20041269-20041291 CACAGGTGACACTCTGGAGGGGG - Intronic
904220708 1:28966507-28966529 TGGAGTTTACATTCTAGTGGGGG + Intronic
904437998 1:30511804-30511826 CAGTGTTCACGTTCTAGTGGAGG - Intergenic
905016731 1:34782981-34783003 CCAAGTTGACATTCTAGAGGGGG + Intronic
906122829 1:43405924-43405946 AAGAGTTGAGATTTTAGTGGGGG + Intronic
906634895 1:47402819-47402841 CAGGGCTCACATTCTAGTGGGGG + Intergenic
907785949 1:57612793-57612815 TACAGTTTACATTCTAGTTGGGG - Intronic
909501931 1:76344498-76344520 TAGAGTTTACATTCTAGTGGTGG - Intronic
910200788 1:84696347-84696369 CTGAGTTTATATTCTAGTGGAGG - Intergenic
910234568 1:85022538-85022560 TAAAGCTTACATTCTAGTGGAGG + Intronic
910306284 1:85767948-85767970 TGAAGTTTACATTCTAGTGGAGG + Intronic
911285878 1:95991617-95991639 TAGAGCTGGCATTCTAGTGGAGG + Intergenic
911617915 1:100035551-100035573 CAGAGCTTACATTCTAGTGGGGG - Intergenic
913207094 1:116549171-116549193 TAGAGTTGACATTCTATTAGGGG + Intronic
913338392 1:117732460-117732482 CAGAGTTGAGATGCCAGTGGGGG + Intergenic
913551456 1:119920680-119920702 TAAAGTTTACTTTCTAGTGGAGG - Intronic
913564913 1:120063449-120063471 CTCAGGTAACATTCTAATGGAGG + Intronic
913633217 1:120730114-120730136 CTCAGGTAACATTCTAATGGAGG - Intergenic
914285499 1:146222799-146222821 CTCAGGTAACATTCTAATGGAGG + Intronic
914546530 1:148673554-148673576 CTCAGGTAACATTCTAATGGAGG + Intronic
914620035 1:149397116-149397138 CTCAGGTAACATTCTAATGGAGG - Intergenic
914883265 1:151564345-151564367 TACAGCTGACATTCTTGTTGGGG - Intronic
915072867 1:153286798-153286820 CAGAGCTGACATTCTAGTTGGGG + Intergenic
915468189 1:156110230-156110252 TGGAGCTGACATTCTAGTGGAGG - Intronic
916899579 1:169206183-169206205 CACAGAGGACGTTCTAGTTGGGG - Intronic
918479260 1:184960570-184960592 TACAGCTTACATTCTAGTGGTGG + Intronic
919040877 1:192386839-192386861 CCCAGAAGACCTTCTAGTGGAGG - Intergenic
919434037 1:197534425-197534447 AAGAGTTCACATTCTGGTGGAGG - Intronic
919963970 1:202502586-202502608 CGGAATTTACATTCTAGTGGGGG + Intronic
920719393 1:208372830-208372852 CACAATAGGCATTCTAGTGTAGG + Intergenic
921121395 1:212140548-212140570 CTCATGTTACATTCTAGTGGAGG - Intergenic
921925579 1:220707677-220707699 CAGAGGTGACATTCGAGTTGGGG - Intergenic
923303746 1:232668851-232668873 CAGAGTTTACATTCTATTTGGGG + Intergenic
923575025 1:235150745-235150767 CACAGCTTACAGTCTGGTGGAGG + Intronic
924475975 1:244382172-244382194 CAGGGCTGACATTCTGGTGGGGG + Intronic
1064083545 10:12327796-12327818 TGGAGTTGACATTCTAGTGTGGG - Intergenic
1065095766 10:22279275-22279297 AACACTTGACATTCTAGAAGGGG + Intergenic
1065857066 10:29839329-29839351 AAGAGTTGACATTTTAGTGTAGG + Intergenic
1066435353 10:35392584-35392606 CACTGAGAACATTCTAGTGGTGG + Intronic
1070221462 10:74450391-74450413 AAGAGTTTACAATCTAGTGGAGG - Intronic
1071063442 10:81601736-81601758 GAGAGTTTACCTTCTAGTGGGGG + Intergenic
1071628816 10:87201128-87201150 CACTGTAGCCATTCTAGAGGCGG + Intergenic
1071767580 10:88685935-88685957 CAGAGCTTACATTTTAGTGGTGG + Intergenic
1071947937 10:90669045-90669067 CAGAGTTTATAATCTAGTGGGGG - Intergenic
1072089783 10:92116448-92116470 TACATCTGACATTCTTGTGGGGG - Intronic
1074298648 10:112213534-112213556 CACAGCTGTCAGTCTGGTGGGGG + Intronic
1074350919 10:112736317-112736339 CATAGCTTACAATCTAGTGGTGG - Intronic
1074848992 10:117423687-117423709 TGCAGCTGACATTCTAATGGGGG + Intergenic
1074876067 10:117614306-117614328 CAGGGTTTACATTCTAGTGGTGG + Intergenic
1075109455 10:119566379-119566401 CACAGTTGAGATTCTTGAAGTGG - Intergenic
1075303942 10:121350877-121350899 CAGACTTTACATTCTAGTAGGGG - Intergenic
1076307070 10:129472945-129472967 CACAGTAGACATTCTCGACGTGG + Intronic
1078396734 11:10988118-10988140 CAGAGCTTACATTCTAGAGGAGG - Intergenic
1078898402 11:15618614-15618636 CAAAGTTCACAGTCTAGTGAGGG - Intergenic
1080551136 11:33375214-33375236 TGGAGCTGACATTCTAGTGGGGG - Intergenic
1080817124 11:35769373-35769395 CACAGTTGGCATTGTTTTGGGGG + Intronic
1081736021 11:45404861-45404883 CTCAGTTTATATTCTAGTAGGGG - Intergenic
1083404600 11:62447848-62447870 TAGAGTTGACACTCTAGTGGGGG + Intronic
1085068435 11:73519426-73519448 CAGAGTTTACACTCTAGAGGAGG + Intronic
1085509320 11:77079829-77079851 CACTTTAGTCATTCTAGTGGGGG + Intronic
1087607346 11:100392965-100392987 CACAAGTGACATATTAGTGGAGG - Intergenic
1088203001 11:107360434-107360456 CACAATAGACATACAAGTGGGGG + Intronic
1088517740 11:110656810-110656832 CAGAGTTGACATTCACGTGCGGG - Intronic
1088879983 11:113965499-113965521 TAGAGCTTACATTCTAGTGGAGG + Intergenic
1089758408 11:120704578-120704600 CAGAGCTTACATTCTAGTAGAGG - Intronic
1091076890 11:132627482-132627504 CACAGTTTACACTATGGTGGTGG + Intronic
1093403362 12:18775292-18775314 TAAAGTTTAAATTCTAGTGGAGG - Intergenic
1093842329 12:23919183-23919205 CACAGGAGCCATTCTAGTTGGGG - Intronic
1094270801 12:28612091-28612113 CACAGTTGAGATTGGAGTTGGGG + Intergenic
1094543413 12:31381189-31381211 CATAGTTTATATTCCAGTGGAGG - Intergenic
1095232712 12:39760699-39760721 TGGAGTTTACATTCTAGTGGAGG - Intronic
1095276952 12:40297047-40297069 AAGAGTTCACAGTCTAGTGGGGG - Intronic
1098916866 12:76266701-76266723 CACAGTAGACATGATAGTGCTGG + Intergenic
1101863231 12:108499806-108499828 CACAGCTTACTTTCTGGTGGAGG - Intergenic
1102287084 12:111666568-111666590 CAGAGTTTAGAATCTAGTGGAGG + Intronic
1102744331 12:115237035-115237057 CAGAGTTTACAATCTAGTGATGG + Intergenic
1103373514 12:120437627-120437649 CAGACTTTATATTCTAGTGGGGG + Intergenic
1103506668 12:121445664-121445686 CAGAGCTTACATTTTAGTGGAGG + Intronic
1104278546 12:127352885-127352907 CAAAGCTGACATTCTAGTGGAGG - Intergenic
1105588935 13:21773156-21773178 GAGAGCTTACATTCTAGTGGAGG - Intergenic
1106945593 13:34824249-34824271 TACGGTTGCCAGTCTAGTGGTGG + Intergenic
1107171166 13:37343143-37343165 TAGAGATTACATTCTAGTGGAGG - Intergenic
1107938196 13:45362637-45362659 CAGAGCTCACCTTCTAGTGGAGG - Intergenic
1108798856 13:54067734-54067756 CCCAGTTGACTCTCTAGGGGAGG + Intergenic
1110430034 13:75413000-75413022 CACAGCTTACCTTCCAGTGGGGG + Intronic
1110460185 13:75736600-75736622 AAGAGTTTACATTCTAGTGAAGG + Intronic
1110756284 13:79178696-79178718 CACAGTTATCATTTTTGTGGTGG + Intergenic
1113295870 13:108957956-108957978 TAGAGCTGACATGCTAGTGGAGG + Intronic
1114878830 14:26758380-26758402 CACAGCTGACATTATACTCGAGG + Intergenic
1116823766 14:49651609-49651631 TACAGTTTACATTCTAGTAGGGG + Intronic
1117320958 14:54623007-54623029 CAGGGCTGACAGTCTAGTGGAGG - Intronic
1118131095 14:62964530-62964552 CAGAGTTAATATTCTGGTGGGGG - Intronic
1118506969 14:66423980-66424002 CAAAGCTTACATTCTAGTCGGGG - Intergenic
1118683852 14:68271184-68271206 TGTAGTTTACATTCTAGTGGTGG - Intronic
1119770731 14:77219363-77219385 CAGAGCTCACCTTCTAGTGGAGG + Intronic
1121220420 14:92280781-92280803 CGGAGCTTACATTCTAGTGGGGG + Intergenic
1122574145 14:102731270-102731292 CAGCGTGGACAGTCTAGTGGAGG + Intergenic
1122680410 14:103456636-103456658 TAGAGTTTACATTCTAGTTGGGG - Intronic
1126441557 15:48695010-48695032 CAGAGTTTTCATTCTAGTTGGGG - Intergenic
1130698851 15:86158713-86158735 TTCATTTGACATTCTAGTTGCGG + Intronic
1131067138 15:89441773-89441795 CAGAGCTGACATTCTGGTGGAGG + Intergenic
1131540362 15:93270318-93270340 CACACTGGACATTCTTGTAGAGG - Intergenic
1133720491 16:8490072-8490094 CAGAGCTGACATTCTTGTGAAGG + Intergenic
1133951294 16:10395807-10395829 CACGGTTAACATCATAGTGGAGG + Intronic
1135331640 16:21565065-21565087 CAAAGCTTACATTCTGGTGGAGG - Intergenic
1136227315 16:28867622-28867644 CACAGTTCTCTTTCAAGTGGAGG - Intronic
1136287149 16:29251199-29251221 CACAGTTTACATTCTAACGAAGG - Intergenic
1136400514 16:30015063-30015085 CACAGTTACCATTCTTGTGCAGG - Intronic
1137933351 16:52609500-52609522 AGGAGCTGACATTCTAGTGGAGG + Intergenic
1137960968 16:52881801-52881823 CAGAGTTGATAATTTAGTGGGGG - Intergenic
1140089577 16:71826642-71826664 TGGAGCTGACATTCTAGTGGGGG + Intergenic
1141346381 16:83250376-83250398 CACGGTTCACATTCTAGTTAGGG + Intronic
1142092756 16:88223831-88223853 CACAGTTTACATTCTAACGAAGG - Intergenic
1142877570 17:2861302-2861324 AACAGTTTCCATTCTAGGGGAGG - Intronic
1143147801 17:4787981-4788003 CAGAGGTCACATTCCAGTGGGGG + Intergenic
1144054827 17:11531057-11531079 CACAGTTGACCTTGTCTTGGTGG - Intronic
1144181287 17:12755000-12755022 CACACTTCACATTCTTGGGGTGG - Intronic
1144321441 17:14125055-14125077 CACTGTTCACATTTTAGGGGAGG - Intronic
1145109975 17:20154187-20154209 TAAAGTTTACACTCTAGTGGAGG + Intronic
1145942166 17:28748279-28748301 CACAGTAGACACTCTCCTGGGGG - Exonic
1146208634 17:30924757-30924779 CAGAGCTTACATTCTAGTGTGGG + Intronic
1146913870 17:36665623-36665645 CACAGTAGGCATTCGACTGGGGG - Intergenic
1151121349 17:71796676-71796698 CAGAGCTGACATTCTAGTGGTGG - Intergenic
1152358982 17:79821479-79821501 CGGTGTTTACATTCTAGTGGGGG + Intergenic
1152912321 17:83012407-83012429 GAGTGTTGACATTTTAGTGGAGG - Intronic
1153962328 18:10150205-10150227 CACAGCAGACATTCTGATGGAGG - Intergenic
1154113007 18:11586351-11586373 CACAGTTGACCTTTGAGTTGGGG - Intergenic
1155620577 18:27774112-27774134 CACTGTTAACTTTCTAGTTGTGG - Intergenic
1156511349 18:37639576-37639598 GACAGTTCACATTATAGTGAGGG + Intergenic
1159244205 18:65783814-65783836 CACAGTTTACATTCTAGTGAGGG + Intronic
1159592723 18:70352501-70352523 CAGAGTCGACATTCTGATGGAGG + Intergenic
1160039850 18:75335430-75335452 CACAGTCGACATTCCAGTGGTGG - Intergenic
1164410631 19:28001912-28001934 CACAGTTGACTTTCTTGTCAAGG + Intergenic
1167011151 19:46809030-46809052 TGGAGGTGACATTCTAGTGGGGG - Intergenic
925699399 2:6618596-6618618 CACAGTTGAGCTTCTGGAGGCGG - Intergenic
926920152 2:17932099-17932121 CACAGTTGTCATGCTGATGGTGG - Exonic
928138317 2:28705787-28705809 AGCAGTTCACATCCTAGTGGGGG - Intergenic
928351809 2:30564001-30564023 TACAGTTGAGATTCTAGAAGTGG + Intronic
931653740 2:64491278-64491300 CAGAACTTACATTCTAGTGGTGG + Intergenic
931784324 2:65605603-65605625 CACAATTGACATTTTGGTTGAGG - Intergenic
932010003 2:67966208-67966230 TGGAGTTTACATTCTAGTGGTGG - Intergenic
932658890 2:73635038-73635060 AGCAGATGACATTCTAGTTGTGG + Intergenic
933985627 2:87589965-87589987 TGCAGTTGACATGCTAGTGAGGG + Intergenic
936308216 2:111360839-111360861 TGCAGTTGACATGCTAGTGAGGG - Intergenic
936889719 2:117354984-117355006 CTCAGATGACATTCTAGTGGAGG + Intergenic
937031225 2:118742523-118742545 CTGAGTGCACATTCTAGTGGGGG - Intergenic
937140962 2:119599791-119599813 CACAGTTTACATTCTAGTGGGGG - Intronic
937141013 2:119600127-119600149 TCCAGTTTACATTCTAGTTGGGG + Intronic
938906550 2:135842248-135842270 CAGAGTTGCTTTTCTAGTGGTGG - Intronic
939314257 2:140526937-140526959 CATAGATGACTTTCTAGTAGTGG - Intronic
940200621 2:151146251-151146273 TCTAGTTGACTTTCTAGTGGGGG - Intergenic
941350006 2:164420200-164420222 TAAAGCTGACATTCTAGTGTGGG - Intergenic
943344624 2:186723992-186724014 TAGAGTTAACATTCTAGTTGGGG + Intronic
943511880 2:188836370-188836392 GACAGTAGACATGCTACTGGTGG - Intergenic
944300052 2:198113428-198113450 CAGAGCTGACAGTCTAGTGGGGG + Intronic
947135022 2:226968711-226968733 GGCAGTTGGCATTCTAGAGGGGG + Intronic
947485166 2:230541312-230541334 CACAGTAGACCTTCAAGAGGAGG - Exonic
948432938 2:237931752-237931774 CACAGTTGTCATGTAAGTGGGGG + Intergenic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1170672904 20:18451637-18451659 CACATTAGACATCCAAGTGGAGG - Intronic
1170843142 20:19940173-19940195 CAGAGCTTACCTTCTAGTGGTGG - Intronic
1172531670 20:35635301-35635323 CAGAATTTATATTCTAGTGGGGG - Intronic
1172767659 20:37359326-37359348 CAAAGCTCACATTCTAGAGGGGG + Intronic
1173550647 20:43930997-43931019 CAAAGCCGACATTCTAGTGAAGG - Intronic
1174295739 20:49543802-49543824 CACAGCTGACACTCCAGTGGGGG - Intronic
1175159100 20:56994849-56994871 CAAAGCTCACATTCTAGAGGAGG + Intergenic
1175969945 20:62680383-62680405 CCCATTTGACATTGTACTGGAGG - Intronic
1179047690 21:37861150-37861172 CAGAGTTGACAGTCTAGGGTAGG - Intronic
1179149867 21:38800671-38800693 CACAGGGTACATCCTAGTGGTGG - Intergenic
1181018173 22:20083300-20083322 CAGAGCTCACATTTTAGTGGGGG - Intronic
1182867299 22:33614783-33614805 CACAGCTGACAGTCTCATGGAGG - Intronic
1184147913 22:42622394-42622416 CGCAGCTGACCTTCCAGTGGGGG - Intronic
949433610 3:4004477-4004499 AAATGTTTACATTCTAGTGGAGG - Intronic
949978049 3:9478517-9478539 TGGAGTTTACATTCTAGTGGAGG + Intronic
950683156 3:14599096-14599118 CAGAGTTTACATTCTAGAGGGGG - Intergenic
951402549 3:22251545-22251567 CACTATTGACATTTTGGTGGAGG + Intronic
951481553 3:23167271-23167293 TAGAGCTTACATTCTAGTGGGGG - Intergenic
951875790 3:27423679-27423701 CAGAATTAACGTTCTAGTGGTGG + Intronic
953962213 3:47274921-47274943 TACAGTTGATATTCTAGTATAGG - Intronic
955112812 3:55965998-55966020 AACAGGTGACATTTTAGCGGTGG - Intronic
955636026 3:61030595-61030617 CAAAGTTTAGATTCTAGTGGTGG + Intronic
956714414 3:72065760-72065782 TAGAGTTTATATTCTAGTGGTGG + Intergenic
957122783 3:76117732-76117754 CGAAGCTTACATTCTAGTGGGGG + Intronic
957311646 3:78527544-78527566 CAGAGCTCACAATCTAGTGGTGG + Intergenic
957610763 3:82462410-82462432 CAAAGATGACATTCTAGTCAAGG - Intergenic
957659956 3:83136895-83136917 AACAATTGAAATTCTAGAGGTGG + Intergenic
957750900 3:84414008-84414030 ACCAGTTGACATTCTAGAGATGG - Intergenic
959283316 3:104375560-104375582 CAGTGTTGACATTCTGGTTGTGG - Intergenic
962186949 3:133270258-133270280 CTCAGCTTGCATTCTAGTGGTGG - Intronic
962246112 3:133795369-133795391 GCCATTTGACATTCTAGAGGTGG - Intronic
962291833 3:134144087-134144109 CAGAGTTGCTTTTCTAGTGGTGG - Intronic
962408438 3:135120399-135120421 AACAGATGACAGTGTAGTGGTGG + Intronic
963075105 3:141338864-141338886 TAGACCTGACATTCTAGTGGGGG + Intronic
964004889 3:151815073-151815095 CACAGTTGACATTCTAGTGGTGG + Intronic
964207657 3:154192133-154192155 CACAGGTGCCATTCTAGCAGTGG + Intronic
964544880 3:157822835-157822857 CAGAGTTTACATTCTGGTGGGGG - Intergenic
965491170 3:169338381-169338403 CAGAGTTGACAGTCTAGGGCAGG - Intronic
967329295 3:188274605-188274627 CACAGCTAAAGTTCTAGTGGAGG - Intronic
969210481 4:5683572-5683594 CGGAGCTGACATTCTAGTGAGGG + Intronic
969333050 4:6491101-6491123 CAGAGATGACATTACAGTGGGGG - Intronic
970953866 4:21787876-21787898 CAGAGCTGACATTCTAGTGGGGG + Intronic
971221115 4:24706739-24706761 CACAGTTGACACTGGAGTGCTGG - Intergenic
972408416 4:38767573-38767595 AAGAGTTTGCATTCTAGTGGGGG + Intergenic
973342436 4:49019149-49019171 CAGAGTTTGCATTCTAGTAGGGG + Intronic
973783664 4:54315054-54315076 CATAGTTTACATTCTAGAAGGGG - Intergenic
974241732 4:59258202-59258224 CACAGTTTACAGTCCATTGGAGG + Intergenic
975416835 4:74114264-74114286 TGGAGCTGACATTCTAGTGGGGG + Intronic
976072243 4:81254665-81254687 GAGAGTTTACATTCTAGTTGGGG - Intergenic
977152826 4:93534491-93534513 TAAAGTTTACATTCTAGTGCAGG - Intronic
978193125 4:105939146-105939168 CAAAGCTGACATGCTAATGGGGG + Intronic
978387779 4:108192806-108192828 AGGAGTAGACATTCTAGTGGTGG + Intergenic
980034705 4:127870679-127870701 CACAGAGGACATTCTAGTGGGGG + Intergenic
980728445 4:136796472-136796494 CACAATTGCCATTCTAGTGTGGG + Intergenic
981183739 4:141776706-141776728 TATAATTGACATTCTAATGGAGG - Intergenic
984017151 4:174440548-174440570 CAGAGTAGCCATTCTAATGGGGG - Intergenic
989480075 5:41920500-41920522 CAGAGCTTATATTCTAGTGGAGG + Exonic
993112471 5:83675384-83675406 CACAGGAGACATTCTAGATGAGG + Intronic
993318246 5:86438769-86438791 CACAGTTGACATGTTACTAGGGG + Intergenic
994851639 5:105061726-105061748 CACAGCTTACATTCCAGTTGTGG - Intergenic
995848523 5:116520346-116520368 TAGAGCTTACATTCTAGTGGAGG - Intronic
995893040 5:116978284-116978306 TAGAGTTTACATTCTAGTGAAGG - Intergenic
997655280 5:135549728-135549750 CCCAGCTGACTTGCTAGTGGAGG - Intergenic
997792223 5:136771193-136771215 CACAGTTTACATTAGTGTGGGGG + Intergenic
998210570 5:140194219-140194241 CACAGCCTACAGTCTAGTGGAGG + Intronic
998602985 5:143604030-143604052 AAGAGTTTACATTCTAATGGAGG + Intergenic
998705542 5:144755450-144755472 AAGAGCTGACAGTCTAGTGGAGG + Intergenic
999433542 5:151544337-151544359 CACAGTGGAAGTCCTAGTGGAGG - Exonic
999700770 5:154225703-154225725 CAAAGTTCACATTTTAATGGAGG + Intronic
1004031439 6:11873959-11873981 GACAGTTTACCTTCTAGTGGGGG + Intergenic
1005688951 6:28283301-28283323 CACTGTTGTCATTCAAGGGGTGG - Intronic
1006348949 6:33506646-33506668 AAGGGTTCACATTCTAGTGGAGG + Intergenic
1007374098 6:41444515-41444537 CAGAGGTGACATGCCAGTGGTGG + Intergenic
1008805697 6:55424926-55424948 TACAGTTGATATTCTACTGGAGG - Intergenic
1009278976 6:61722424-61722446 CTCAGTAGAGATTCTAGAGGAGG - Intronic
1010535905 6:77029943-77029965 CAGAGTTTACATTTTAGTGACGG - Intergenic
1010785978 6:80001894-80001916 TGGAGTTTACATTCTAGTGGGGG + Intergenic
1014627809 6:123751067-123751089 CAGAGTTTACATTCTAGTGGGGG + Intergenic
1015146816 6:129996157-129996179 AAGAGTTCAAATTCTAGTGGGGG - Intergenic
1017038025 6:150284709-150284731 CACAGTCTCCATTCTAGGGGAGG + Intergenic
1017935633 6:159002339-159002361 CAGAATTTATATTCTAGTGGAGG + Intergenic
1018124615 6:160669690-160669712 CAAAGGTGAGATTCTTGTGGTGG - Intergenic
1020458662 7:8403255-8403277 GAGAGCTGACATTCTGGTGGAGG + Intergenic
1021051310 7:15988718-15988740 CAAAGTTTACAGTCTAGTTGGGG - Intergenic
1021990490 7:26136805-26136827 GACAGATGGCATTCTATTGGGGG + Intergenic
1022052073 7:26685916-26685938 CAAAGATGACATTCCAGTGATGG - Intronic
1024948008 7:54831338-54831360 CATAGTTGTCATTTTTGTGGTGG - Intergenic
1029810762 7:103045950-103045972 ACCATTTGACATTCTAGAGGTGG + Intronic
1029840274 7:103355348-103355370 CACATTTGACATTTTTGTGTAGG - Intronic
1030103345 7:105965765-105965787 CAGGGCTGACATTCTAGTTGAGG - Intronic
1032123851 7:129176435-129176457 CTAAGTTTACATTCTACTGGAGG + Intergenic
1032945672 7:136849528-136849550 GACAGTTGAGATTCCACTGGAGG + Intergenic
1033437872 7:141350380-141350402 CAGACCTTACATTCTAGTGGGGG - Intronic
1034165843 7:149024446-149024468 AACAGTCCACATTTTAGTGGGGG + Intronic
1035330383 7:158093034-158093056 CGAAGTTGTGATTCTAGTGGTGG - Intronic
1036826218 8:11978141-11978163 CATAGATGTCATTCTACTGGTGG + Intergenic
1037227930 8:16617659-16617681 CACATTTAACATTATACTGGAGG - Intergenic
1040395142 8:46991671-46991693 TGCAGTTTACATTCTAGTGAAGG - Intergenic
1040588636 8:48768097-48768119 TACAGTTGACATACTAGTGGTGG + Intergenic
1043510027 8:80941249-80941271 CATAGTTCACATTCCAGTGGTGG + Intergenic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1045243628 8:100423957-100423979 CAGAGCTTACATTTTAGTGGGGG + Intergenic
1045565191 8:103307468-103307490 CAGAATTTATATTCTAGTGGAGG + Intronic
1046344199 8:112901462-112901484 CAAAGTTGACCTACTACTGGAGG + Intronic
1047287620 8:123501762-123501784 CACAGTCCACATTCAAGTTGAGG - Exonic
1050068562 9:1786630-1786652 CAGAGTTTACATTCTAGTGGGGG - Intergenic
1050656419 9:7833421-7833443 TAGAGCTTACATTCTAGTGGAGG - Intronic
1050867978 9:10528491-10528513 TAAATTTGACATTCTTGTGGTGG - Intronic
1051431089 9:16981248-16981270 TAGAGTTGACATCCTACTGGGGG - Intergenic
1061206796 9:129168900-129168922 TAGAGCTTACATTCTAGTGGTGG - Intergenic
1062062380 9:134503327-134503349 GACAGTTGTCACCCTAGTGGGGG + Intergenic
1062702545 9:137914919-137914941 TGGAGCTGACATTCTAGTGGGGG + Intronic
1188029940 X:25253116-25253138 TGTAGTTTACATTCTAGTGGAGG - Intergenic
1188151093 X:26676549-26676571 CACAGTTGACATTAAAGAAGTGG + Intergenic
1188157099 X:26753521-26753543 ACCATTTGACATTCTAGGGGTGG + Intergenic
1190120302 X:47653691-47653713 TACAGCTGACATTCTAGTCAGGG - Intronic
1191925172 X:66301304-66301326 CAGAACTTACATTCTAGTGGAGG - Intergenic
1191936746 X:66435156-66435178 CACAGTTAATAGGCTAGTGGAGG + Intergenic
1192372256 X:70524197-70524219 AAGAGCTTACATTCTAGTGGGGG - Intergenic
1195009461 X:100721407-100721429 TACAGCTTACAATCTAGTGGGGG - Intronic
1197181488 X:123541629-123541651 CAGAGCTTCCATTCTAGTGGAGG + Intergenic
1199654153 X:149978199-149978221 TATAGCTTACATTCTAGTGGGGG - Intergenic
1200031833 X:153303308-153303330 TGGAGCTGACATTCTAGTGGAGG - Intergenic
1200094658 X:153651617-153651639 CACAGCAGACTTTCTAGTGGGGG + Intergenic