ID: 964010406

View in Genome Browser
Species Human (GRCh38)
Location 3:151885637-151885659
Sequence TTATCTACAAGCCCCTGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964010406_964010415 10 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010415 3:151885670-151885692 TCCTTGGGACAGACACCTGGGGG No data
964010406_964010412 7 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010412 3:151885667-151885689 ATCTCCTTGGGACAGACACCTGG No data
964010406_964010408 -6 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010408 3:151885654-151885676 AGATAAAACTCCCATCTCCTTGG No data
964010406_964010418 15 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010418 3:151885675-151885697 GGGACAGACACCTGGGGGAAGGG No data
964010406_964010422 26 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010422 3:151885686-151885708 CTGGGGGAAGGGGAAGCTGTGGG No data
964010406_964010421 25 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010421 3:151885685-151885707 CCTGGGGGAAGGGGAAGCTGTGG No data
964010406_964010419 16 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010419 3:151885676-151885698 GGACAGACACCTGGGGGAAGGGG No data
964010406_964010409 -5 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010409 3:151885655-151885677 GATAAAACTCCCATCTCCTTGGG No data
964010406_964010413 8 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010413 3:151885668-151885690 TCTCCTTGGGACAGACACCTGGG No data
964010406_964010414 9 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010414 3:151885669-151885691 CTCCTTGGGACAGACACCTGGGG No data
964010406_964010417 14 Left 964010406 3:151885637-151885659 CCCAGTCAGGGGCTTGTAGATAA No data
Right 964010417 3:151885674-151885696 TGGGACAGACACCTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964010406 Original CRISPR TTATCTACAAGCCCCTGACT GGG (reversed) Intergenic