ID: 964011671

View in Genome Browser
Species Human (GRCh38)
Location 3:151899196-151899218
Sequence CACCTACCCTCTGAGCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964011667_964011671 -1 Left 964011667 3:151899174-151899196 CCCACCAAACTATCCTTGAAAAC 0: 10
1: 91
2: 364
3: 649
4: 981
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011664_964011671 5 Left 964011664 3:151899168-151899190 CCCCTGCCCACCAAACTATCCTT 0: 42
1: 106
2: 280
3: 515
4: 829
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011661_964011671 19 Left 964011661 3:151899154-151899176 CCTCATTCCCTAGTCCCCTGCCC No data
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011662_964011671 12 Left 964011662 3:151899161-151899183 CCCTAGTCCCCTGCCCACCAAAC 0: 18
1: 69
2: 164
3: 210
4: 416
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011663_964011671 11 Left 964011663 3:151899162-151899184 CCTAGTCCCCTGCCCACCAAACT 0: 19
1: 69
2: 179
3: 237
4: 591
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011669_964011671 -5 Left 964011669 3:151899178-151899200 CCAAACTATCCTTGAAAACACCT No data
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011668_964011671 -2 Left 964011668 3:151899175-151899197 CCACCAAACTATCCTTGAAAACA No data
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011666_964011671 3 Left 964011666 3:151899170-151899192 CCTGCCCACCAAACTATCCTTGA 0: 36
1: 101
2: 154
3: 345
4: 659
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data
964011665_964011671 4 Left 964011665 3:151899169-151899191 CCCTGCCCACCAAACTATCCTTG 0: 40
1: 92
2: 162
3: 324
4: 741
Right 964011671 3:151899196-151899218 CACCTACCCTCTGAGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964011671 Original CRISPR CACCTACCCTCTGAGCCTTC AGG Intergenic
No off target data available for this crispr