ID: 964015483 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:151940390-151940412 |
| Sequence | TCATCTCAATTGGTTGTTCA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 964015480_964015483 | 25 | Left | 964015480 | 3:151940342-151940364 | CCTGTATAAGATGAAAGCTAGTT | No data | ||
| Right | 964015483 | 3:151940390-151940412 | TCATCTCAATTGGTTGTTCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 964015483 | Original CRISPR | TCATCTCAATTGGTTGTTCA AGG | Intergenic | ||