ID: 964015483

View in Genome Browser
Species Human (GRCh38)
Location 3:151940390-151940412
Sequence TCATCTCAATTGGTTGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964015480_964015483 25 Left 964015480 3:151940342-151940364 CCTGTATAAGATGAAAGCTAGTT No data
Right 964015483 3:151940390-151940412 TCATCTCAATTGGTTGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964015483 Original CRISPR TCATCTCAATTGGTTGTTCA AGG Intergenic