ID: 964017731

View in Genome Browser
Species Human (GRCh38)
Location 3:151967712-151967734
Sequence CAATCTAAGGAGAATGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964017728_964017731 -3 Left 964017728 3:151967692-151967714 CCTGAAAAAGCACAAACAGACAA No data
Right 964017731 3:151967712-151967734 CAATCTAAGGAGAATGGAACTGG No data
964017727_964017731 11 Left 964017727 3:151967678-151967700 CCTACATCAAAAAGCCTGAAAAA No data
Right 964017731 3:151967712-151967734 CAATCTAAGGAGAATGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964017731 Original CRISPR CAATCTAAGGAGAATGGAAC TGG Intergenic
No off target data available for this crispr