ID: 964018834

View in Genome Browser
Species Human (GRCh38)
Location 3:151982184-151982206
Sequence AGGCTAAAAGTTTGTGACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964018834_964018838 20 Left 964018834 3:151982184-151982206 CCAATGTCACAAACTTTTAGCCT No data
Right 964018838 3:151982227-151982249 TATTGTTGTAGGTCTGTTATGGG No data
964018834_964018837 19 Left 964018834 3:151982184-151982206 CCAATGTCACAAACTTTTAGCCT No data
Right 964018837 3:151982226-151982248 TTATTGTTGTAGGTCTGTTATGG No data
964018834_964018836 9 Left 964018834 3:151982184-151982206 CCAATGTCACAAACTTTTAGCCT No data
Right 964018836 3:151982216-151982238 GCTAAGACATTTATTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964018834 Original CRISPR AGGCTAAAAGTTTGTGACAT TGG (reversed) Intergenic
No off target data available for this crispr